gene PH01037242G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01037242:22 - 1857(- stand)   Name
Alternate name Locus tag PH01037242G0010
Length of gene 1836  bp Length of CDS 1140  bp
Product information
Feature type
CDS
Product name
hydroxyproline-rich glycoprotein family protein
Alternate name
Molecular weight
(predicted)
41383.42792  kDa
Isoeletric point
(predicted)
4.72846603393554
Length
379  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_164203 2
Please click OG5_164203 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os09g36890.1 hydroxyproline-rich glycoprotein family protein, putative, expressed 5E-117
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
GO term prediction

Biological Process

GO:0006357 regulation of transcription from RNA polymerase II promoter

Molecular Function

GO:0001104 RNA polymerase II transcription cofactor activity

Cellular Component

GO:0016592 mediator complex

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 192445 86 259 5.47E-20 pfam10018 Med4 cl10818 -
superfamily 192445 86 259 5.47E-20 cl10818 Med4 superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01037242G0010 gene.
ATGGTCGAGCTTACCACAGCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGGTGGTTGGGGGACTCGTCGGAGGTGTGGGTGCCGAGGACGAGCCGGTGGGAGCGGGTGGAGGAGTCCGGGGAAGGGAGCCACTGGACGTCTCTGCTCCACCTCATCTCCTCCCTTGCCTCCAACCTCTTCGAGCACTCGCCCAACCGCACCGCCTGGATCTCCGCGTATCGGGGGTCCCTCCCCACCTTCCTCCCGTCGTCGTCGGCCTCCGCGACGCCTCCGCCGCTCCCATCCCCGATCTCCTCCACCAAGGACGCGCTGTCGATGCTCACCTCTCTCCAGACGCAGCTCTTTGAGGCCGTCGCCGAGCAGCAGGAGACCCTCGACCTGCAGGACGCGCGATCGCGCCTCGCCCGCGAGGCGGGCGCCAAGGACGCCTCGCTCCTCGCCTTCGCGAAGAAGCTGCGCGAGGCCCACCACGTGCTCGACCGCCTCGTCGACGACTACGCCGACTACCGCCGCGACCCCAAGCGCCCTCGCGGTGCCGCCGCGGCCGATGACCCCGAGCCAGTGTCGGACGGCGACTTCGGCGCATCCCTCCACTCCAAGCTCAATCTGGACGATGTCCTAACCTACGCGCATCGCATAAGCTACACAACCTTCGCGCCGCCGGAGCATGGCGCCGGGCTGCCTCTGCGTGGGGCTTTGCCACCTGCGCCACAGGAAAACGAGATGCGGATGTCGCAGCTGTATCAGTTTGCGGATTTGGATGTTGGGGTGCCCAAGAAGCCCCTGGAGGCGAAGGAGCGGAGCACAGCGGAGGCGGAGGCCATGCCGCTATTCGAGCCTACACCGCCACTGGAGGAGCCGCCGGTGCCGCCGGTGCTACCAATCACTGTGTCACCTGGGTGGCGGAAAGGGATGTTCGAGCTGCCTGCTGATATTCCATTGCCGCCGCCTGGATGGAAGCCTGGGGACCCGATCACACTGCCGCTGGATGGGATTCCGGCTGGTGTCAAGGGTGAGGAGGCACGAGCCAGTGTGCCACAGATGCCTGTTGGGATGCAGCTAATGGCGCCGAAGCCTCAAGAGCCAATACAGGTCCAACGTGTTGAGCTTGACATTAACAATAGTTCTAGTAGTGATGAGTACAGTAGTGACGTTGGGAGCTCAGAAGAAGATGATGAGGATTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01037242G0010 gene.
GCTCGCGGACGTCGTTCTCCCGCTCCCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01037242 Download
Protein sequence
Protein sequence
MRWLGDSSEVWVPRTSRWERVEESGEGSHWTSLLHLISSLASNLFEHSPNRTAWISAYRGSLPTFLPSSSASATPPPLPSPISSTKDALSMLTSLQTQLFEAVAEQQETLDLQDARSRLAREAGAKDASLLAFAKKLREAHHVLDRLVDDYADYRRDPKRPRGAAAADDPEPVSDGDFGASLHSKLNLDDVLTYAHRISYTTFAPPEHGAGLPLRGALPPAPQENEMRMSQLYQFADLDVGVPKKPLEAKERSTAEAEAMPLFEPTPPLEEPPVPPVLPITVSPGWRKGMFELPADIPLPPPGWKPGDPITLPLDGIPAGVKGEEARASVPQMPVGMQLMAPKPQEPIQVQRVELDINNSSSSDEYSSDVGSSEEDDED
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above