gene PH01017692G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01017692:1807 - 2627(- stand)   Name
Alternate name Locus tag PH01017692G0010
Length of gene 821  bp Length of CDS 1053  bp
Product information
Feature type
CDS
Product name
peroxidase precursor
Alternate name
Molecular weight
(predicted)
37752.64072  kDa
Isoeletric point
(predicted)
8.30836105346679
Length
351  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH02SNP00026690 PH01017692:1939 A A->G
PH02SNP00079120 PH01017692:1939 A A->G
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_164439 5
Please click OG5_164439 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G71695.1
Peroxidase superfamily protein
Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress, oxidation reduction; LOCATED IN: cell wall, vacuole, membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED D
8E-135
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g73170.1 peroxidase precursor, putative, expressed 5E-171
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
1 50 100 150 200 250 300 351
Detailed signature matches
    1. SSF48113 (Heme-depe...)
    1. PR00461 (PLPEROXIDASE)
    1. PS50873 (PEROXIDASE_4)
    2. PF00141 (peroxidase)
    3. PR00458 (PEROXIDASE)
    1. PS00436 (PEROXIDASE_2)
    1. PS00435 (PEROXIDASE_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31537 (FAMILY N...)
  2. PTHR31537:SF0 (SUBF...)
GO term prediction

Biological Process

GO:0006979 response to oxidative stress
GO:0055114 oxidation-reduction process

Molecular Function

GO:0004601 peroxidase activity
GO:0020037 heme binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Metabolism Amino acid metabolism Phenylalanine metabolism  
Metabolism Biosynthesis of other secondary metabolites Phenylpropanoid biosynthesis  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K00430 peroxidase EC:1.11.1.7
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173827 37 330 4.15E-154 cd00693 secretory_peroxidase cl00196 -
superfamily 241676 37 330 4.15E-154 cl00196 plant_peroxidase_like superfamily - -
non-specific 215545 36 332 8.28E-67 PLN03030 PLN03030 cl00196 -
non-specific 215745 54 296 4.92E-60 pfam00141 peroxidase cl00196 -
non-specific 173823 52 313 7.47E-27 cd00314 plant_peroxidase_like cl00196 -
non-specific 173825 54 311 9.55E-15 cd00691 ascorbate_peroxidase cl00196 -
non-specific 178467 131 314 4.81E-11 PLN02879 PLN02879 cl00196 N
non-specific 166005 31 319 5.89E-11 PLN02364 PLN02364 cl00196 -
multi-dom 178218 132 314 1.96E-10 PLN02608 PLN02608 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific heme binding site G67,A70,A71,I73,R74,F77,N106,T108,R110,L176,P177,P178,V185,F189,L200,L203,S204,G206,H207,V209,G210,I211,A212,H213,S216,F274,S276,F308 29 28 173827
specific active site G67,A70,A71,I73,R74,F77,H78,T108,R110,L176,P177,P178,P179,V185,F189,L200,L203,S204,G206,H207,V209,G210,I211,A212,H213,G215,S216,F274,S276,F308 31 30 173827
specific substrate binding site R74,I104,P105,L176,P177,P178,P179,H213,G215,S216 10 10 173827
specific calcium binding sites D79,V82,D86,S88,T208,D252,T255,T258,D260 9 9 173827
 
DNA sequence
Upstream 1000 bp region from PH01017692G0010 gene.
CGTTTTTGAAATTTTTGGGCGTGTCGGTGCATACCGGCACCCCACCCAGTTCTGCCCCTGCTCCATCAGCCTCGTGAAATCCCTCCTCTCCTCCCAGCCCCCCGTCGCCTCCATCCCCGACCTCTACCATGCCCATGCCGCCGTGGCCGCCTCCCTAGGTGACCCGCAACCCACCAGAGTATGGTTTGGTCGGTACTTATGTTATGTAATATGTTGATGTTATGTATGGTGATTGGTAAGTACTCATGTTACGTATGGTTTAGTCAGTACGTATGTGGTAGTGTCACTTAACCTGATATTATGGTCATGTACTCATGTGGTGGTTTGGTCCAACATATGTTACTCTATGTATGCGTGCACTAAACATGTATTTTTATCCGTTTCTAACCCGAATTCGGCACGTATCCGTCTTGTGCCCGTATCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTCATGCTGTAATGTGGTCCTATTTATAGGATGGGAGGGGGGAGAATTTGAGTTTACATAAATGACCATACTTTTAGGGAAACCATAAGGGTAGCTCCGTCTTTTCTAGTCGAGTGGGGTTGCCCATGTCGGGCCCACCGGCCGACGTCGCGTGTGCCGGCTGCGTAGTGGGGCTTCACGCTTGTCAGCTGCGTAGAGGGGTTTAGTTACGTAACTGAACCCACATTTCGCGTTGTCGTCGCCTCGCGTAACTACTATGTCGCGCTGCTAGTTTTTTGTTTTCATTGATCTGACCGATGTAGGCGTTGACCTTAGGGGAACGCAGGGACCCCTCCCCCAACAGTATGTGTATCCGGTTTGCCCGTATCTCACTCTGAATCAGAGGAAAAAATATGGATT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGTCTAGTACTGCTAGAACTAGTTTGCTCCTGGTAGTAGCACTTGTGGCTGCCGTGTTGTGTGCTCCTGCTGCCGAGGCAGCCAAGTACCCGCCGGTGGCCAAGGGCTTGTCGTTTGATTTCTACAAGAAGAGCTGCCCCAAGGCAGAGTCCATCGTGAAGGACTTCCTCCGGAAGGCCATCAAGAAGGACGTCGGCCTCGCCGCCGCGCTCATCCGCCTCCACTTCCACGACTGCTTCGTCCAAGGTTGCGATGGTTCCATCCTTCTGAGCAAGACGCCCGCCGGGGACAGCGAGCAGGAGGCTATACCCAACCTGACGCTCCGCCCGTCGGCGTTCAAGGCCATCAACGACATCCGAGCCCTCCTGCACAAGGCATGCGGCCTCGTCGTCTCCTGCGCCGACATCGTCACCCTCGCCGCCCGCGACTCCGTCCACCTGGCCGGCGGGCCGGAGTACAAGGTCCCCTTGGGCCGGCGTGACAGCCTCACGTTCGCGACGAGCGGTGAAGTCTCTGACGCCCTACCGCCACCGACCTCGAGTGTTCCCGTCCTCCTAAAATTCCTGGACAAGATCAACCTCGATGTCAACGACCTCGTGGCGCTCTCCGGCGGGCACACCGTCGGCATCGCGCACTGCGGGTCCTTCGACGGCCGCCTGTTCCCGCAGGACCCCACCATGAACAAGTGGTTCGCCGGCCACCTCAAGCTCACCTGCCCCACCAAGGGCGTCGACAACACCACCGTCAACGACATCCGGACGCCCAACACCTTCGACAACAAGTACTACGTCGACCTGCTCAACCGCCAGGGCCTCTTCACCTCCGACCAGGACATGTTCACTAACTCGACGACCAAGCCCATCGTCACAAAGTTCGCGCTGGACCAGTCGGCCTTCTTCGACCAGTTCATCTTCTCCTTTGTGAAGATGGGGCAGATCAAGGTGCTCACGGGCACCCAGGGTCAGATCCGAACCAACTGCTCCGTTCGCAACGCCGGCACCGCCGATCTCCCGTGGTCCGTCGTCGAGGCTGTCGAGAGCCTCGTGCTC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01017692G0010 gene.
CCAACCAATCACGGCATCATTACAACATGGACTTAAGGGCATATACAATAGTACAAATAACTGGTGTCTATATCAGCTATCTATATCATCTATAGATAGTACTAAAGATGGCTTATATAATGAGTTGTCTATATAAGATCCTATAATCTTTTAATTTTTACTTGGAAAAAATATTTGTTATAGATAACAACTCATACAATGATGTTTTGTGTTGTCTATAAGGGTTTTATAGACTGTCTGTTGCATGCTAAACAACTTCATTCTCTCTTTTTGTTCTCTCTTATCTATGTTATTAAAAATTTTACATGATAAAAATTATAGACTACTGATGTCACCTACTGTGCATGTTCTAATTAAAAGAAGCATCAGTTACCAACTAATTTATTTATATTCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01017692 Download
Protein sequence
Protein sequence
MASSTARTSLLLVVALVAAVLCAPAAEAAKYPPVAKGLSFDFYKKSCPKAESIVKDFLRKAIKKDVGLAAALIRLHFHDCFVQGCDGSILLSKTPAGDSEQEAIPNLTLRPSAFKAINDIRALLHKACGLVVSCADIVTLAARDSVHLAGGPEYKVPLGRRDSLTFATSGEVSDALPPPTSSVPVLLKFLDKINLDVNDLVALSGGHTVGIAHCGSFDGRLFPQDPTMNKWFAGHLKLTCPTKGVDNTTVNDIRTPNTFDNKYYVDLLNRQGLFTSDQDMFTNSTTKPIVTKFALDQSAFFDQFIFSFVKMGQIKVLTGTQGQIRTNCSVRNAGTADLPWSVVEAVESLVL
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above