gene PH01008027G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01008027:229 - 6969(- stand)   Name
Alternate name Locus tag PH01008027G0010
Length of gene 6741  bp Length of CDS 1599  bp
Product information
Feature type
CDS
Product name
serine/threonine protein kinase
Alternate name
Molecular weight
(predicted)
59934.2872200001  kDa
Isoeletric point
(predicted)
6.36204147338867
Length
532  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_213194 2
Please click OG5_213194 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT4G18950.1
Integrin-linked protein kinase family
Integrin-linked protein kinase family; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: regulation of signal transduction, protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 p
3E-141
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g54480.1 serine/threonine protein kinase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 50 100 150 200 250 300 350 400 450 500 532
Detailed signature matches
    1. PS50297 (ANK_REP_RE...)
    2. SSF48403 (Ankyrin r...)
    3. PF12796 (Ank_2)
    1. SSF56112 (Protein k...)
    1. PS50011 (PROTEIN_KI...)
    1. PF07714 (Pkinase_Tyr)
    1. SM00248 (ANK)
    2. PR01415 (ANKYRIN)
    3. PS50088 (ANK_REPEAT)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR23257 (SERINE-T...)
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0005515 protein binding
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238125 28 132 1.27E-24 cd00204 ANK cl02529 -
superfamily 243072 28 132 1.27E-24 cl02529 ANK superfamily - -
non-specific 173624 154 429 1.13E-33 cd00192 PTKc cl09925 -
superfamily 245201 154 429 1.13E-33 cl09925 PKc_like superfamily - -
non-specific 173724 140 420 7.97E-24 cd06606 STKc_MAPKKK cl09925 -
non-specific 173660 147 419 4.39E-23 cd05123 STKc_AGC cl09925 -
non-specific 173659 140 420 1.27E-21 cd05122 PKc_STE cl09925 -
non-specific 133171 132 432 1.35E-21 cd05039 PTKc_Csk_like cl09925 -
non-specific 238125 28 109 5.45E-21 cd00204 ANK cl02529 N
non-specific 173623 147 429 1.98E-20 cd00180 PKc cl09925 -
non-specific 132963 191 420 4.48E-20 cd06632 STKc_MEKK1_plant cl09925 -
non-specific 173637 134 429 1.48E-18 cd05059 PTKc_Tec_like cl09925 -
non-specific 173629 147 431 1.27E-17 cd05041 PTKc_Fes_like cl09925 -
non-specific 133243 134 430 2.53E-17 cd05112 PTKc_Itk cl09925 -
non-specific 132956 193 420 2.22E-15 cd06625 STKc_MEKK3_like cl09925 -
non-specific 173671 197 410 3.38E-15 cd05580 STKc_PKA cl09925 C
non-specific 173755 187 421 4.63E-15 cd08215 STKc_Nek cl09925 -
non-specific 173633 150 423 5.49E-15 cd05052 PTKc_Abl cl09925 -
non-specific 173658 134 422 6.34E-15 cd05114 PTKc_Tec_Rlk cl09925 -
non-specific 133165 146 430 1.58E-14 cd05033 PTKc_EphR cl09925 -
non-specific 132961 193 420 2.74E-14 cd06630 STKc_MEKK1 cl09925 -
non-specific 133248 140 432 4.91E-14 cd05148 PTKc_Srm_Brk cl09925 -
non-specific 173670 198 427 6.33E-14 cd05579 STKc_MAST_like cl09925 -
non-specific 173764 156 421 9.34E-14 cd08224 STKc_Nek6_Nek7 cl09925 -
non-specific 133221 195 431 1.01E-13 cd05090 PTKc_Ror1 cl09925 -
non-specific 173639 181 432 1.34E-13 cd05066 PTKc_EphR_A cl09925 -
non-specific 173664 195 399 2.07E-13 cd05573 STKc_ROCK_NDR_like cl09925 C
non-specific 238125 51 129 3.29E-13 cd00204 ANK cl02529 C
non-specific 133179 146 431 4.16E-13 cd05048 PTKc_Ror cl09925 -
non-specific 133194 192 432 7.79E-13 cd05063 PTKc_EphR_A2 cl09925 -
non-specific 173726 196 421 3.06E-12 cd06610 STKc_OSR1_SPAK cl09925 -
non-specific 133191 149 432 5.12E-12 cd05060 PTKc_Syk_like cl09925 -
non-specific 133214 193 430 7.76E-12 cd05083 PTKc_Chk cl09925 -
non-specific 173757 182 421 8.68E-12 cd08217 STKc_Nek2 cl09925 -
non-specific 173772 187 420 1.24E-11 cd08530 STKc_CNK2-like cl09925 -
non-specific 133216 143 437 1.41E-11 cd05085 PTKc_Fer cl09925 -
non-specific 173634 130 432 1.52E-11 cd05053 PTKc_FGFR cl09925 -
non-specific 173625 132 431 1.77E-11 cd05032 PTKc_InsR_like cl09925 -
non-specific 238125 28 77 1.83E-11 cd00204 ANK cl02529 N
non-specific 173769 184 427 2.19E-11 cd08229 STKc_Nek7 cl09925 -
non-specific 132954 140 421 2.67E-11 cd06623 PKc_MAPKK_plant_like cl09925 -
non-specific 133178 161 422 3.91E-11 cd05046 PTK_CCK4 cl09925 -
non-specific 173669 193 433 3.98E-11 cd05578 STKc_Yank1 cl09925 -
non-specific 173712 195 393 5.76E-11 cd05622 STKc_ROCK1 cl09925 NC
non-specific 173768 184 425 5.79E-11 cd08228 STKc_Nek6 cl09925 -
non-specific 173731 140 421 5.94E-11 cd06627 STKc_Cdc7_like cl09925 -
non-specific 173652 130 453 7.29E-11 cd05100 PTKc_FGFR3 cl09925 -
non-specific 173631 198 423 9.51E-11 cd05045 PTKc_RET cl09925 -
non-specific 133187 146 435 1.08E-10 cd05056 PTKc_FAK cl09925 -
non-specific 173657 134 433 1.26E-10 cd05113 PTKc_Btk_Bmx cl09925 -
non-specific 132940 149 420 1.41E-10 cd06609 STKc_MST3_like cl09925 -
non-specific 133232 128 432 2.51E-10 cd05101 PTKc_FGFR2 cl09925 -
non-specific 173711 195 388 2.56E-10 cd05621 STKc_ROCK2 cl09925 NC
non-specific 173645 191 431 3.28E-10 cd05084 PTKc_Fes cl09925 -
non-specific 173732 198 420 3.52E-10 cd06628 STKc_MAPKKK_Byr2_like cl09925 N
non-specific 132991 149 419 3.79E-10 cd06917 STKc_NAK1_like cl09925 -
non-specific 133220 195 433 4.43E-10 cd05089 PTKc_Tie1 cl09925 -
non-specific 173638 192 429 5.12E-10 cd05065 PTKc_EphR_B cl09925 -
non-specific 133228 158 425 7.68E-10 cd05097 PTKc_DDR_like cl09925 -
non-specific 173691 198 438 8.63E-10 cd05600 STKc_Sid2p_Dbf2p cl09925 C
non-specific 173758 147 428 1.17E-09 cd08218 STKc_Nek1 cl09925 -
non-specific 133219 163 448 1.23E-09 cd05088 PTKc_Tie2 cl09925 -
non-specific 133229 198 434 1.40E-09 cd05098 PTKc_FGFR1 cl09925 N
non-specific 173666 306 423 1.62E-09 cd05575 STKc_SGK cl09925 NC
non-specific 133213 157 432 1.65E-09 cd05082 PTKc_Csk cl09925 -
non-specific 133189 150 435 1.84E-09 cd05058 PTKc_Met_Ron cl09925 -
non-specific 132957 196 420 2.67E-09 cd06626 STKc_MEKK4 cl09925 -
non-specific 133227 158 422 3.29E-09 cd05096 PTKc_DDR1 cl09925 -
non-specific 88330 195 422 4.46E-09 cd05047 PTKc_Tie cl09925 -
non-specific 173728 135 421 4.52E-09 cd06614 STKc_PAK cl09925 -
non-specific 173661 147 373 4.83E-09 cd05570 STKc_PKC cl09925 C
non-specific 173628 142 432 5.76E-09 cd05038 PTKc_Jak_rpt2 cl09925 -
non-specific 132943 148 420 6.13E-09 cd06612 STKc_MST1_2 cl09925 -
non-specific 133230 158 432 1.36E-08 cd05099 PTKc_FGFR4 cl09925 -
non-specific 173695 201 381 1.55E-08 cd05604 STKc_SGK3 cl09925 C
non-specific 133180 160 243 1.85E-08 cd05049 PTKc_Trk cl09925 C
non-specific 132973 135 443 1.87E-08 cd06642 STKc_STK25-YSK1 cl09925 -
non-specific 133199 132 422 1.94E-08 cd05068 PTKc_Frk_like cl09925 -
non-specific 133195 192 430 2.02E-08 cd05064 PTKc_EphR_A10 cl09925 -
non-specific 173694 306 397 2.30E-08 cd05603 STKc_SGK2 cl09925 NC
non-specific 133234 162 432 2.32E-08 cd05103 PTKc_VEGFR2 cl09925 -
non-specific 173681 147 373 2.93E-08 cd05590 STKc_nPKC_eta cl09925 C
non-specific 132951 192 420 3.05E-08 cd06620 PKc_MAPKK_Byr1_like cl09925 -
non-specific 173632 161 241 3.35E-08 cd05051 PTKc_DDR cl09925 C
non-specific 132962 141 358 3.83E-08 cd06631 STKc_YSK4 cl09925 C
non-specific 173662 147 376 3.94E-08 cd05571 STKc_PKB cl09925 C
non-specific 173692 153 409 4.73E-08 cd05601 STKc_CRIK cl09925 C
non-specific 200936 56 81 4.88E-08 pfam00023 Ank cl02529 C
non-specific 173687 195 388 5.15E-08 cd05596 STKc_ROCK cl09925 NC
non-specific 133172 146 431 5.77E-08 cd05040 PTKc_Ack_like cl09925 -
non-specific 173678 140 373 6.25E-08 cd05587 STKc_cPKC cl09925 C
non-specific 133247 196 431 6.33E-08 cd05116 PTKc_Syk cl09925 -
non-specific 173636 150 430 7.97E-08 cd05057 PTKc_EGFR_like cl09925 -
non-specific 173676 198 396 8.02E-08 cd05585 STKc_YPK1_like cl09925 C
non-specific 173683 147 419 9.50E-08 cd05592 STKc_nPKC_theta_delta cl09925 C
non-specific 132960 196 420 1.27E-07 cd06629 STKc_MAPKKK_Bck1_like cl09925 N
non-specific 173730 138 420 1.30E-07 cd06624 STKc_ASK cl09925 -
non-specific 173760 192 421 1.31E-07 cd08220 STKc_Nek8 cl09925 -
non-specific 173759 188 428 1.49E-07 cd08219 STKc_Nek3 cl09925 -
non-specific 173675 196 419 1.76E-07 cd05584 STKc_p70S6K cl09925 C
non-specific 173736 198 369 1.90E-07 cd07832 STKc_CCRK cl09925 C
non-specific 173635 144 435 2.05E-07 cd05054 PTKc_VEGFR cl09925 -
non-specific 173630 195 429 2.41E-07 cd05044 PTKc_c-ros cl09925 -
non-specific 173693 201 409 2.70E-07 cd05602 STKc_SGK1 cl09925 C
non-specific 173626 132 239 3.26E-07 cd05034 PTKc_Src_like cl09925 C
non-specific 173703 193 392 3.36E-07 cd05612 STKc_PRKX_like cl09925 C
non-specific 173640 181 422 4.02E-07 cd05067 PTKc_Lck_Blk cl09925 -
non-specific 173686 147 376 4.74E-07 cd05595 STKc_PKB_beta cl09925 C
non-specific 173707 140 373 5.01E-07 cd05616 STKc_cPKC_beta cl09925 C
non-specific 133212 159 433 7.66E-07 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 -
non-specific 173641 179 432 7.99E-07 cd05072 PTKc_Lyn cl09925 -
non-specific 133233 198 435 8.86E-07 cd05102 PTKc_VEGFR3 cl09925 -
non-specific 173668 198 423 9.27E-07 cd05577 STKc_GRK cl09925 -
non-specific 133186 132 431 9.58E-07 cd05055 PTKc_PDGFR cl09925 -
non-specific 132984 198 327 1.03E-06 cd06653 STKc_MEKK3_like_1 cl09925 NC
non-specific 173710 147 419 1.10E-06 cd05620 STKc_nPKC_delta cl09925 C
non-specific 132982 198 327 1.18E-06 cd06651 STKc_MEKK3 cl09925 C
non-specific 133211 159 432 1.18E-06 cd05080 PTKc_Tyk2_rpt2 cl09925 -
non-specific 132983 198 327 1.34E-06 cd06652 STKc_MEKK2 cl09925 C
non-specific 133193 188 429 1.59E-06 cd05062 PTKc_IGF-1R cl09925 -
non-specific 173673 192 419 1.77E-06 cd05582 STKc_RSK_N cl09925 C
non-specific 173723 198 421 1.84E-06 cd06605 PKc_MAPKK cl09925 -
non-specific 173672 159 420 2.42E-06 cd05581 STKc_PDK1 cl09925 -
non-specific 132971 135 443 2.51E-06 cd06640 STKc_MST4 cl09925 -
non-specific 173680 206 373 3.11E-06 cd05589 STKc_PKN cl09925 C
non-specific 173648 192 243 3.31E-06 cd05092 PTKc_TrkA cl09925 C
non-specific 197603 56 82 4.19E-06 smart00248 ANK cl02529 -
non-specific 173682 147 373 4.31E-06 cd05591 STKc_nPKC_epsilon cl09925 C
non-specific 133205 147 432 4.45E-06 cd05074 PTKc_Tyro3 cl09925 -
non-specific 173690 196 393 4.61E-06 cd05599 STKc_NDR_like cl09925 C
non-specific 173647 192 431 4.83E-06 cd05091 PTKc_Ror2 cl09925 -
non-specific 132972 135 443 5.28E-06 cd06641 STKc_MST3 cl09925 -
non-specific 133237 134 422 6.87E-06 cd05106 PTKc_CSF-1R cl09925 -
non-specific 133174 194 241 7.96E-06 cd05042 PTKc_Aatyk cl09925 C
non-specific 173649 160 243 8.08E-06 cd05093 PTKc_TrkB cl09925 C
non-specific 173733 198 322 9.97E-06 cd07829 STKc_CDK_like cl09925 C
non-specific 133167 207 432 1.01E-05 cd05035 PTKc_Axl_like cl09925 N
non-specific 173685 147 376 1.29E-05 cd05594 STKc_PKB_alpha cl09925 C
non-specific 132953 198 422 1.48E-05 cd06622 PKc_MAPKK_PBS2_like cl09925 -
non-specific 133181 146 422 1.63E-05 cd05050 PTKc_Musk cl09925 -
non-specific 173650 160 243 1.70E-05 cd05094 PTKc_TrkC cl09925 C
non-specific 133202 150 422 1.82E-05 cd05071 PTKc_Src cl09925 -
non-specific 173709 147 374 2.20E-05 cd05619 STKc_nPKC_theta cl09925 C
non-specific 173727 158 421 2.49E-05 cd06613 STKc_MAP4K3_like cl09925 -
non-specific 173721 306 388 2.90E-05 cd05632 STKc_GRK5 cl09925 NC
non-specific 133200 193 425 2.92E-05 cd05069 PTKc_Yes cl09925 -
non-specific 173642 193 432 3.05E-05 cd05075 PTKc_Axl cl09925 -
non-specific 88524 179 410 3.33E-05 cd05623 STKc_MRCK_alpha cl09925 C
non-specific 173696 306 419 3.56E-05 cd05605 STKc_GRK4_like cl09925 N
non-specific 173700 198 374 3.71E-05 cd05609 STKc_MAST cl09925 C
non-specific 133235 134 429 3.87E-05 cd05104 PTKc_Kit cl09925 -
non-specific 133201 179 422 3.92E-05 cd05070 PTKc_Fyn_Yrk cl09925 -
non-specific 173663 198 419 4.61E-05 cd05572 STKc_cGK_PKG cl09925 -
non-specific 132979 135 419 5.52E-05 cd06648 STKc_PAK_II cl09925 -
non-specific 173725 198 420 6.10E-05 cd06608 STKc_myosinIII_like cl09925 -
non-specific 173674 196 419 6.69E-05 cd05583 STKc_MSK_N cl09925 -
non-specific 173706 277 373 7.19E-05 cd05615 STKc_cPKC_alpha cl09925 NC
non-specific 173679 207 373 7.38E-05 cd05588 STKc_aPKC cl09925 C
non-specific 143341 198 324 8.08E-05 cd07836 STKc_Pho85 cl09925 C
non-specific 143338 154 320 8.96E-05 cd07833 STKc_CDKL cl09925 C
non-specific 173719 306 395 9.11E-05 cd05630 STKc_GRK6 cl09925 N
non-specific 133192 188 429 9.25E-05 cd05061 PTKc_InsR cl09925 -
non-specific 205784 56 82 9.47E-05 pfam13606 Ank_3 cl02529 -
non-specific 143346 198 325 0.000102377 cd07841 STKc_CDK7 cl09925 C
non-specific 173684 147 376 0.000119354 cd05593 STKc_PKB_gamma cl09925 C
non-specific 132976 196 420 0.000123866 cd06645 STKc_MAP4K3 cl09925 -
non-specific 173698 198 384 0.000140844 cd05607 STKc_GRK7 cl09925 C
non-specific 132980 198 436 0.000145324 cd06649 PKc_MEK2 cl09925 -
non-specific 173651 160 241 0.000175531 cd05095 PTKc_DDR2 cl09925 C
non-specific 173653 304 432 0.000181327 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 173765 178 428 0.000196318 cd08225 STKc_Nek5 cl09925 -
non-specific 88519 161 373 0.000198351 cd05618 STKc_aPKC_iota cl09925 C
non-specific 133238 304 426 0.000212591 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 173646 195 239 0.000242232 cd05087 PTKc_Aatyk1_Aatyk3 cl09925 C
non-specific 133168 197 239 0.000292782 cd05036 PTKc_ALK_LTK cl09925 C
non-specific 132981 198 423 0.000322701 cd06650 PKc_MEK1 cl09925 -
non-specific 132952 192 420 0.000351588 cd06621 PKc_MAPKK_Pek1_like cl09925 -
non-specific 143333 159 353 0.000371465 cd05118 STKc_CMGC cl09925 C
non-specific 132946 192 421 0.00039599 cd06615 PKc_MEK cl09925 -
non-specific 173702 208 373 0.000399273 cd05611 STKc_Rim15_like cl09925 NC
non-specific 173688 306 423 0.000466289 cd05597 STKc_DMPK_like cl09925 NC
non-specific 173708 203 373 0.000612179 cd05617 STKc_aPKC_zeta cl09925 C
non-specific 173713 306 410 0.000967461 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 133207 347 430 0.00124633 cd05076 PTK_Tyk2_rpt1 cl09925 N
non-specific 133217 192 242 0.00125547 cd05086 PTKc_Aatyk2 cl09925 C
non-specific 173720 306 419 0.00241924 cd05631 STKc_GRK4 cl09925 N
non-specific 173653 192 241 0.00424481 cd05105 PTKc_PDGFR_alpha cl09925 NC
non-specific 173632 351 423 0.00447772 cd05051 PTKc_DDR cl09925 N
non-specific 143356 159 230 0.00545908 cd07851 STKc_p38 cl09925 C
non-specific 173697 277 377 0.00586507 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173737 159 370 0.00620335 cd07834 STKc_MAPK cl09925 C
non-specific 173627 147 430 0.00646854 cd05037 PTK_Jak_rpt1 cl09925 -
non-specific 133240 304 432 0.00728025 cd05109 PTKc_HER2 cl09925 N
non-specific 173699 306 423 0.00929688 cd05608 STKc_GRK1 cl09925 N
non-specific 200936 28 54 0.00952846 pfam00023 Ank cl02529 -
multi-dom 214567 141 423 1.73E-35 smart00220 S_TKc - -
multi-dom 205076 28 118 3.31E-19 pfam12796 Ank_2 - -
multi-dom 197581 142 429 1.74E-32 smart00219 TyrKc - -
multi-dom 215690 141 423 3.77E-32 pfam00069 Pkinase - -
multi-dom 214568 142 429 4.44E-32 smart00221 STYKc - -
multi-dom 219530 141 429 4.43E-30 pfam07714 Pkinase_Tyr - -
multi-dom 205076 28 87 2.27E-17 pfam12796 Ank_2 - N
multi-dom 140343 23 112 2.21E-16 PTZ00322 PTZ00322 - C
multi-dom 215625 23 109 3.18E-13 PLN03192 PLN03192 - NC
multi-dom 223589 140 420 8.97E-12 COG0515 SPS1 - C
multi-dom 165205 28 122 4.88E-11 PHA02874 PHA02874 - NC
multi-dom 223738 28 114 5.55E-11 COG0666 Arp - N
multi-dom 222277 28 77 1.64E-09 pfam13637 Ank_4 - -
multi-dom 222939 28 148 3.81E-09 PHA02878 PHA02878 - NC
multi-dom 165205 36 148 5.94E-09 PHA02874 PHA02874 - NC
multi-dom 165206 29 114 1.06E-08 PHA02875 PHA02875 - NC
multi-dom 206028 43 94 1.76E-08 pfam13857 Ank_5 - -
multi-dom 222939 37 134 4.51E-08 PHA02878 PHA02878 - NC
multi-dom 223738 28 118 4.92E-08 COG0666 Arp - NC
multi-dom 222980 29 116 2.87E-07 PHA03095 PHA03095 - C
multi-dom 222980 37 113 4.08E-07 PHA03095 PHA03095 - C
multi-dom 223738 28 119 5.01E-07 COG0666 Arp - N
multi-dom 140289 198 375 5.51E-07 PTZ00263 PTZ00263 - NC
multi-dom 222980 27 113 3.22E-06 PHA03095 PHA03095 - C
multi-dom 215625 28 94 3.83E-06 PLN03192 PLN03192 - N
multi-dom 222984 29 118 4.36E-06 PHA03100 PHA03100 - C
multi-dom 165206 36 123 7.74E-06 PHA02875 PHA02875 - C
multi-dom 223738 51 119 9.83E-06 COG0666 Arp - NC
multi-dom 206028 28 64 1.58E-05 pfam13857 Ank_5 - N
multi-dom 222984 28 86 3.16E-05 PHA03100 PHA03100 - NC
multi-dom 165207 40 117 6.42E-05 PHA02876 PHA02876 - NC
multi-dom 222984 35 143 0.000145437 PHA03100 PHA03100 - NC
multi-dom 222980 40 107 0.000150685 PHA03095 PHA03095 - NC
multi-dom 222984 43 113 0.000349798 PHA03100 PHA03100 - NC
multi-dom 222980 36 103 0.000484859 PHA03095 PHA03095 - NC
multi-dom 165207 43 107 0.000501162 PHA02876 PHA02876 - NC
multi-dom 222980 36 109 0.000508278 PHA03095 PHA03095 - NC
multi-dom 234389 162 419 0.000558243 TIGR03903 TOMM_kin_cyc - C
multi-dom 165256 40 94 0.00064764 PHA02946 PHA02946 - C
multi-dom 165206 34 118 0.00316025 PHA02875 PHA02875 - C
multi-dom 222277 57 109 0.00955201 pfam13637 Ank_4 - -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic active site A163,K165,V211,M227,E228,F229,M230,D234,R236,R305,N306,L308,D319,L322,R346 26 15 173624
generic ATP binding site A163,K165,V211,M227,E228,F229,M230,D234,R305,N306,L308,D319 20 12 173624
generic substrate binding site D234,R236,R305,L322,R346 11 5 173624
generic activation loop (A-loop) A318,D319,F320,D321,L322,C323,R330,R346 11 8 173624
 
DNA sequence
Upstream 1000 bp region from PH01008027G0010 gene.
TCCGGAGGTAACCCCCCGTTGGCTCACCGACAGGAGTAGGGCGGTCCTCTCGGACCCCCGAACCTGTATAAATCATCGTGTCATTTCTTACTCTCGTGGACGAAGGCCCGTTAGACGGCCAACGTCCACCCCCTCACTCGTGTTTGGTTTTTACACCCACAACAGTCATATATCACAGACGGTTTTATTCACAAACCGTCTGTGATAATCCCGCAAATCACAGATGGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCCCGACCACGGCGGCGGTGATAGCAGCGCGGGCGCGGAGGGGTCGGGCGACGCGGCCGGCGTCATGAGCTTCCAGCTGATGTACCTGGCCCACGAGGGAAACGCGGAGGGGATCCGCGAGCTCCTCGACGCCGGCGCCGACCCCAACTTCCGCGACTCCGACGGCCGCACGGCGCTGCACATCGCCGCTTGCGAGGGCCACGCGGAGGTCGTCGAGCTGCTCCTTGACCGCGGCGCGGAGGCTATCGTCGAGGACCAGTGGGGCAGCACGCCTTTGGCGGATGCGATGCATTACCAGAATCATGATGTCATCAAGATCTTGGAGAAGCATGGCTCCAAGCTTAAGATTGCGCCTATGCATGTTAACAACCATCGTGAAGTTCCTGAATACGAGATTGACCCGAACGAGCTTGATTTCACTAATGGCAATGACTTATCTAAGGGTACATTTCAGAAAGCAACATGGAGGGGCATTCTGGTTGCTGTTAAGAAGCTGGATGATGATTTAATTACTGACGACAACAGAGTTGTATTTTCCTTACGGTTTGGATGGATGTCTTTGCATTGCAGACAGACATTCAGAGATGAGCTTGACGTGCTACAACTCATACGGCATCCAAATGTTGTGCAATTTTTGGGTGCTGTAACACAAAGCAGCCCAATGATGATTGTCATGGAATTTATGCCAAAGGGTGATTTGCGCAAACACCTCAGTAAGAAAGGAGCTCTGAAACCATCATATGCAGGTACATTTCAGAAAGCAACATGGAGGGGCATTCTGGTTGCTGTTAAGAAGCTGGATGATGATTTAATTACTGACGACAACAGAGGTGATTTGCGCAAACACCTCAGTAAGAAAGGAGCTCTGAAACCATCATATGCAGTGAAATTAGCCCTTGATATTGCAAGAAACATATTGAGGGATGATACTGGACACCTGAAGGTGGCAGATTTTGATTTGTGTAAGATGCTAAAATGGAGAAGAAAAGTTAGGGAGGATAAACCAGTAACTTCTCCAGGCGATGCCTGTAGGTATGTCGCTCCAGAAGTCATGCGAAAACAAGAGTATGATACTTTGATTCTTCAGGAGATGATTGAAGGATGTCTCCCTTTTTATGATAAGAAAATTGGTGAAATTGAGAAGGTGTACAATTCTAAAGAAAGGCCACCTTTCAGAGCTCCTCCAAAGCATTACGCTCATGGGTTAAGAGAGTTGATTGAGCAATGCTGGAGTGAAAATCCTGCTGACAGGCCTGATTTTAGAGTAGTCATTGATCGGTTGTCTTCTATACAAAGTGAACTAGCACATAGAAACCGTTGGAAGGGTTCTACAGACTACAGTGTACACTGTCCCCTTTCAAAAGTCTGCAGTGCACGTTACAGGAATTTCATCGGCATTCCGCACAAAGCTTACCCAGTATCATCCCCGCAACGGGAGAACGAGCGTTTTTTTAGATGGAATTACGAGGATTCCATTAAGCTGGAGACAGCTGAATCGCTGGTCATCAAAGAGTGTACAAAAGGAGGAGCCGAGTCGTGCCAAAGCATGGCCGAACCCGAGGGCAGTACCTTCACCTGTACTCCAGGAAACTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01008027G0010 gene.
GTAGACAGTACATTCTCTCTCTTTATTCCCTTTTATCTACATTAGCTTAAATCTTACGTGACAGAAACTATAGACAACTGATATAATTCTATTGTATATGACCTTAGTTCGATGTGTTTCGTGGTGTAACAACACTTCACTACATGTAACACTGTGTACTTATGTGATGTATTATTTTGTTAAGCCTATTCGGAACTCGAAATTGTACAGGGATTTTGTACGTCTAAACTGAAATAACTCGTCTACATTGAAAGTATAATTTTATGAAACGATGTTCACCATCTGATCAAAAACTAAACACCAAGACGACAGCTATAACGTTTGCTACAGTAAATACTCCGAGGGTTGTTCACAAGCTCACAAAAACATTGTTTATACAGAGAATCTCTACAGTGATGCAGAGCATCCCAATCTAGCGGAGTGACTAACAAGAGACTTGGACCAACTAAAGCTTCGGTTTAATATATGCTGGACATTGGAGACCTACAAAACTCGGAGCAGTTAGCGATGGAAACATTGCTAATAAGCTGTCGCCGCTGTACTGTAACAGGATAGGAGAGCCTTTAGGTGTAGTTGATGTTTGGACGTATTACGACGTTGCGATGGGGATAAGGACCTGTATGATTTCATTGCCTTTGATGTTGTCATTGTTACGCGGAAGAAACCAAGGGGGGCAAGGCAAAAAGAATTGTAAGCTCGTAGGTATGAACGTGTTCTAGGCTATCTAGAAGCCAGCCTAGATCTCCTAAGAAATTGCTTCGTTGAATAAGGTTGTCATAATCCGAAAGTAACCGTGTGTGCGTGTATATCTCGGTCGGCAGCAGATATGAAAGGAAGAACGTTGCTGGGAAAAGGTCCCAGTGAGGCTCCTTGTCCCTCGTAATCTTAATGTCCGAGTATATCTAGTGCCTTTTTTTTCGATAACACGAGTATATCTAGTGCTTTCCTCTCTATGTTTTTTTTAAAAAACCTTTTGACTAACTCAGCAAGGGCAATCCACG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01008027 Download
Protein sequence
Protein sequence
MAPDHGGGDSSAGAEGSGDAAGVMSFQLMYLAHEGNAEGIRELLDAGADPNFRDSDGRTALHIAACEGHAEVVELLLDRGAEAIVEDQWGSTPLADAMHYQNHDVIKILEKHGSKLKIAPMHVNNHREVPEYEIDPNELDFTNGNDLSKGTFQKATWRGILVAVKKLDDDLITDDNRVVFSLRFGWMSLHCRQTFRDELDVLQLIRHPNVVQFLGAVTQSSPMMIVMEFMPKGDLRKHLSKKGALKPSYAGTFQKATWRGILVAVKKLDDDLITDDNRGDLRKHLSKKGALKPSYAVKLALDIARNILRDDTGHLKVADFDLCKMLKWRRKVREDKPVTSPGDACRYVAPEVMRKQEYDTLILQEMIEGCLPFYDKKIGEIEKVYNSKERPPFRAPPKHYAHGLRELIEQCWSENPADRPDFRVVIDRLSSIQSELAHRNRWKGSTDYSVHCPLSKVCSARYRNFIGIPHKAYPVSSPQRENERFFRWNYEDSIKLETAESLVIKECTKGGAESCQSMAEPEGSTFTCTPGN
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above