gene PH01005417G0030
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01005417:9573 - 12306(- stand)   Name
Alternate name Locus tag PH01005417G0030
Length of gene 2734  bp Length of CDS 1350  bp
Product information
Feature type
CDS
Product name
TKL_IRAK_DUF26-la.6 - DUF26 kinases have homology to DUF26 containing loci
Alternate name
Molecular weight
(predicted)
49543.0275200001  kDa
Isoeletric point
(predicted)
5.76704788208007
Length
449  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_129433 37
Please click OG5_129433 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 50 100 150 200 250 300 350 400 449
Detailed signature matches
    1. PF01657 (Stress-ant...)
    2. PS51473 (GNK2)
    1. SSF56112 (Protein k...)
    1. PF00069 (Pkinase)
    2. PS50011 (PROTEIN_KI...)
    1. SM00220 (S_TKc)
    1. PS00108 (PROTEIN_KI...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24420 (FAMILY N...)
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0004674 protein serine/threonine kinase activity
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173623 220 328 6.76E-30 cd00180 PKc cl09925 N
superfamily 245201 220 328 6.76E-30 cl09925 PKc_like superfamily - N
non-specific 132954 238 396 4.24E-29 cd06623 PKc_MAPKK_plant_like cl09925 N
non-specific 173724 238 333 1.46E-26 cd06606 STKc_MAPKKK cl09925 NC
non-specific 173660 238 332 1.94E-26 cd05123 STKc_AGC cl09925 NC
non-specific 173624 232 404 6.71E-25 cd00192 PTKc cl09925 N
non-specific 173659 233 332 1.30E-24 cd05122 PKc_STE cl09925 NC
non-specific 173755 238 403 6.31E-24 cd08215 STKc_Nek cl09925 N
non-specific 173723 233 332 2.74E-21 cd06605 PKc_MAPKK cl09925 NC
non-specific 173661 238 332 1.52E-20 cd05570 STKc_PKC cl09925 NC
non-specific 173669 238 333 3.39E-20 cd05578 STKc_Yank1 cl09925 NC
non-specific 132943 233 332 5.25E-20 cd06612 STKc_MST1_2 cl09925 NC
non-specific 132952 234 332 5.44E-20 cd06621 PKc_MAPKK_Pek1_like cl09925 NC
non-specific 173668 238 332 6.77E-20 cd05577 STKc_GRK cl09925 NC
non-specific 173628 216 401 7.72E-20 cd05038 PTKc_Jak_rpt2 cl09925 N
non-specific 173663 222 332 1.04E-19 cd05572 STKc_cGK_PKG cl09925 NC
non-specific 132951 234 332 1.91E-19 cd06620 PKc_MAPKK_Byr1_like cl09925 NC
non-specific 173757 238 332 2.77E-19 cd08217 STKc_Nek2 cl09925 NC
non-specific 173672 238 332 5.07E-19 cd05581 STKc_PDK1 cl09925 NC
non-specific 132956 238 332 6.23E-19 cd06625 STKc_MEKK3_like cl09925 NC
non-specific 173670 223 331 1.03E-18 cd05579 STKc_MAST_like cl09925 NC
non-specific 173728 229 331 1.58E-18 cd06614 STKc_PAK cl09925 NC
non-specific 143345 230 332 3.34E-18 cd07840 STKc_CDK9_like cl09925 NC
non-specific 173731 235 332 4.11E-18 cd06627 STKc_Cdc7_like cl09925 NC
non-specific 173761 219 404 6.55E-18 cd08221 STKc_Nek9 cl09925 N
non-specific 173678 238 332 1.02E-17 cd05587 STKc_cPKC cl09925 NC
non-specific 173732 224 332 1.28E-17 cd06628 STKc_MAPKKK_Byr2_like cl09925 NC
non-specific 173733 240 332 1.45E-17 cd07829 STKc_CDK_like cl09925 NC
non-specific 173771 241 332 1.81E-17 cd08529 STKc_FA2-like cl09925 NC
non-specific 173726 233 332 3.71E-17 cd06610 STKc_OSR1_SPAK cl09925 NC
non-specific 132940 234 332 3.88E-17 cd06609 STKc_MST3_like cl09925 NC
non-specific 132957 241 333 4.08E-17 cd06626 STKc_MEKK4 cl09925 NC
non-specific 173729 237 332 1.33E-16 cd06617 PKc_MKK3_6 cl09925 NC
non-specific 132960 236 333 1.75E-16 cd06629 STKc_MAPKKK_Bck1_like cl09925 NC
non-specific 173768 246 400 2.14E-16 cd08228 STKc_Nek6 cl09925 N
non-specific 173697 246 342 2.36E-16 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173696 238 332 3.35E-16 cd05605 STKc_GRK4_like cl09925 NC
non-specific 173764 238 400 3.66E-16 cd08224 STKc_Nek6_Nek7 cl09925 N
non-specific 132963 238 396 4.30E-16 cd06632 STKc_MEKK1_plant cl09925 N
non-specific 133248 238 330 6.08E-16 cd05148 PTKc_Srm_Brk cl09925 NC
non-specific 173706 238 332 6.26E-16 cd05615 STKc_cPKC_alpha cl09925 NC
non-specific 173769 246 403 1.08E-15 cd08229 STKc_Nek7 cl09925 N
non-specific 173698 238 332 1.27E-15 cd05607 STKc_GRK7 cl09925 NC
non-specific 173683 179 380 1.39E-15 cd05592 STKc_nPKC_theta_delta cl09925 C
non-specific 173626 238 328 1.60E-15 cd05034 PTKc_Src_like cl09925 NC
non-specific 173636 214 333 2.06E-15 cd05057 PTKc_EGFR_like cl09925 NC
non-specific 173699 238 332 2.14E-15 cd05608 STKc_GRK1 cl09925 NC
non-specific 173722 246 342 2.45E-15 cd05633 STKc_GRK3 cl09925 NC
non-specific 173673 238 331 2.47E-15 cd05582 STKc_RSK_N cl09925 NC
non-specific 173760 213 333 2.88E-15 cd08220 STKc_Nek8 cl09925 NC
non-specific 133178 231 405 3.28E-15 cd05046 PTK_CCK4 cl09925 N
non-specific 133199 238 330 4.18E-15 cd05068 PTKc_Frk_like cl09925 NC
non-specific 143333 241 332 4.69E-15 cd05118 STKc_CMGC cl09925 NC
non-specific 173719 238 332 4.73E-15 cd05630 STKc_GRK6 cl09925 NC
non-specific 173707 238 332 5.30E-15 cd05616 STKc_cPKC_beta cl09925 NC
non-specific 173747 248 348 5.89E-15 cd07852 STKc_MAPK15 cl09925 NC
non-specific 173680 241 331 6.23E-15 cd05589 STKc_PKN cl09925 NC
non-specific 173640 226 333 7.48E-15 cd05067 PTKc_Lck_Blk cl09925 NC
non-specific 173772 238 332 7.87E-15 cd08530 STKc_CNK2-like cl09925 NC
non-specific 173625 238 406 8.86E-15 cd05032 PTKc_InsR_like cl09925 N
non-specific 132991 231 331 9.04E-15 cd06917 STKc_NAK1_like cl09925 NC
non-specific 173739 234 328 9.05E-15 cd07838 STKc_CDK4_6_like cl09925 NC
non-specific 173720 250 332 9.16E-15 cd05631 STKc_GRK4 cl09925 NC
non-specific 173682 242 332 1.04E-14 cd05591 STKc_nPKC_epsilon cl09925 NC
non-specific 173674 242 337 1.06E-14 cd05583 STKc_MSK_N cl09925 NC
non-specific 133212 220 337 1.14E-14 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 NC
non-specific 173671 238 331 1.20E-14 cd05580 STKc_PKA cl09925 NC
non-specific 173725 234 332 1.22E-14 cd06608 STKc_myosinIII_like cl09925 NC
non-specific 143346 240 332 1.38E-14 cd07841 STKc_CDK7 cl09925 NC
non-specific 173721 238 332 1.61E-14 cd05632 STKc_GRK5 cl09925 NC
non-specific 132973 234 332 1.85E-14 cd06642 STKc_STK25-YSK1 cl09925 NC
non-specific 143367 241 348 1.99E-14 cd07862 STKc_CDK6 cl09925 NC
non-specific 132971 226 338 3.20E-14 cd06640 STKc_MST4 cl09925 NC
non-specific 143354 238 332 6.50E-14 cd07849 STKc_ERK1_2_like cl09925 NC
non-specific 133204 238 333 6.69E-14 cd05073 PTKc_Hck cl09925 NC
non-specific 133165 221 405 6.97E-14 cd05033 PTKc_EphR cl09925 N
non-specific 132949 238 332 7.49E-14 cd06618 PKc_MKK7 cl09925 NC
non-specific 132946 241 332 7.62E-14 cd06615 PKc_MEK cl09925 NC
non-specific 132982 238 332 8.08E-14 cd06651 STKc_MEKK3 cl09925 NC
non-specific 133194 229 404 9.03E-14 cd05063 PTKc_EphR_A2 cl09925 N
non-specific 133171 238 334 9.49E-14 cd05039 PTKc_Csk_like cl09925 NC
non-specific 133201 238 333 1.15E-13 cd05070 PTKc_Fyn_Yrk cl09925 NC
non-specific 132950 234 332 1.31E-13 cd06619 PKc_MKK5 cl09925 NC
non-specific 133186 221 330 1.34E-13 cd05055 PTKc_PDGFR cl09925 NC
non-specific 173736 241 331 1.59E-13 cd07832 STKc_CCRK cl09925 NC
non-specific 133200 238 333 2.08E-13 cd05069 PTKc_Yes cl09925 NC
non-specific 132979 231 332 2.28E-13 cd06648 STKc_PAK_II cl09925 NC
non-specific 133211 238 406 2.84E-13 cd05080 PTKc_Tyk2_rpt2 cl09925 N
non-specific 132947 251 332 2.89E-13 cd06616 PKc_MKK4 cl09925 NC
non-specific 132961 235 332 3.26E-13 cd06630 STKc_MEKK1 cl09925 NC
non-specific 173641 238 330 3.50E-13 cd05072 PTKc_Lyn cl09925 NC
non-specific 143361 238 332 4.07E-13 cd07856 STKc_Sty1_Hog1 cl09925 NC
non-specific 133202 238 333 4.13E-13 cd05071 PTKc_Src cl09925 NC
non-specific 143368 241 348 4.16E-13 cd07863 STKc_CDK4 cl09925 NC
non-specific 132938 233 328 4.38E-13 cd06607 STKc_TAO cl09925 NC
non-specific 132953 234 332 5.62E-13 cd06622 PKc_MAPKK_PBS2_like cl09925 NC
non-specific 173738 238 332 6.22E-13 cd07835 STKc_CDK1_like cl09925 NC
non-specific 173681 238 331 6.82E-13 cd05590 STKc_nPKC_eta cl09925 NC
non-specific 132983 238 332 7.01E-13 cd06652 STKc_MEKK2 cl09925 NC
non-specific 132972 226 332 7.10E-13 cd06641 STKc_MST3 cl09925 NC
non-specific 173630 214 330 9.45E-13 cd05044 PTKc_c-ros cl09925 NC
non-specific 173639 232 404 9.81E-13 cd05066 PTKc_EphR_A cl09925 N
non-specific 173638 232 404 1.08E-12 cd05065 PTKc_EphR_B cl09925 N
non-specific 173675 238 331 1.14E-12 cd05584 STKc_p70S6K cl09925 NC
non-specific 133191 238 405 1.23E-12 cd05060 PTKc_Syk_like cl09925 N
non-specific 173741 230 332 1.25E-12 cd07843 STKc_CDC2L1 cl09925 NC
non-specific 132984 238 332 1.29E-12 cd06653 STKc_MEKK3_like_1 cl09925 NC
non-specific 173705 242 337 1.32E-12 cd05614 STKc_MSK2_N cl09925 NC
non-specific 173703 238 332 1.54E-12 cd05612 STKc_PRKX_like cl09925 NC
non-specific 132964 233 332 1.57E-12 cd06633 STKc_TAO3 cl09925 NC
non-specific 133172 238 406 1.70E-12 cd05040 PTKc_Ack_like cl09925 N
non-specific 173737 241 332 1.76E-12 cd07834 STKc_MAPK cl09925 NC
non-specific 173730 238 332 2.14E-12 cd06624 STKc_ASK cl09925 NC
non-specific 173676 238 331 2.15E-12 cd05585 STKc_YPK1_like cl09925 NC
non-specific 173749 241 348 2.19E-12 cd07855 STKc_ERK5 cl09925 NC
non-specific 132990 234 332 2.36E-12 cd06659 STKc_PAK6 cl09925 NC
non-specific 173677 242 331 2.57E-12 cd05586 STKc_Sck1_like cl09925 NC
non-specific 173664 238 331 2.93E-12 cd05573 STKc_ROCK_NDR_like cl09925 NC
non-specific 173637 214 398 2.95E-12 cd05059 PTKc_Tec_like cl09925 N
non-specific 133214 223 333 3.16E-12 cd05083 PTKc_Chk cl09925 NC
non-specific 173702 226 333 3.76E-12 cd05611 STKc_Rim15_like cl09925 NC
non-specific 173750 241 348 4.18E-12 cd07857 STKc_MPK1 cl09925 NC
non-specific 173763 222 332 4.75E-12 cd08223 STKc_Nek4 cl09925 NC
non-specific 132966 233 332 6.73E-12 cd06635 STKc_TAO1 cl09925 NC
non-specific 173758 222 347 7.79E-12 cd08218 STKc_Nek1 cl09925 N
non-specific 143363 241 348 8.28E-12 cd07858 STKc_TEY_MAPK_plant cl09925 NC
non-specific 173770 214 405 1.00E-11 cd08528 STKc_Nek10 cl09925 N
specific 216632 26 90 1.07E-11 pfam01657 Stress-antifung cl03296 -
superfamily 216632 26 90 1.07E-11 cl03296 Stress-antifung superfamily - -
non-specific 132980 237 332 1.10E-11 cd06649 PKc_MEK2 cl09925 NC
non-specific 88519 238 332 1.13E-11 cd05618 STKc_aPKC_iota cl09925 NC
non-specific 133175 238 358 1.18E-11 cd05043 PTK_Ryk cl09925 N
non-specific 173666 238 331 1.26E-11 cd05575 STKc_SGK cl09925 NC
non-specific 173710 226 332 1.27E-11 cd05620 STKc_nPKC_delta cl09925 NC
non-specific 132965 233 401 1.27E-11 cd06634 STKc_TAO2 cl09925 N
non-specific 173635 238 405 1.32E-11 cd05054 PTKc_VEGFR cl09925 N
non-specific 173679 238 332 1.38E-11 cd05588 STKc_aPKC cl09925 NC
non-specific 132942 241 328 1.41E-11 cd06611 STKc_SLK_like cl09925 NC
non-specific 173693 238 331 1.41E-11 cd05602 STKc_SGK1 cl09925 NC
non-specific 132989 231 332 1.43E-11 cd06658 STKc_PAK5 cl09925 NC
non-specific 173740 216 305 1.44E-11 cd07842 STKc_CDK8_like cl09925 NC
non-specific 173634 238 330 1.45E-11 cd05053 PTKc_FGFR cl09925 NC
non-specific 133179 226 330 1.78E-11 cd05048 PTKc_Ror cl09925 NC
non-specific 133243 214 330 1.79E-11 cd05112 PTKc_Itk cl09925 NC
non-specific 132962 234 332 1.87E-11 cd06631 STKc_YSK4 cl09925 NC
non-specific 133240 214 406 1.93E-11 cd05109 PTKc_HER2 cl09925 N
non-specific 173631 238 330 2.54E-11 cd05045 PTKc_RET cl09925 NC
non-specific 132981 237 332 2.54E-11 cd06650 PKc_MEK1 cl09925 NC
non-specific 173654 214 330 2.94E-11 cd05108 PTKc_EGFR cl09925 NC
non-specific 173751 240 332 2.94E-11 cd07860 STKc_CDK2_3 cl09925 NC
non-specific 173742 230 348 3.07E-11 cd07845 STKc_CDK10 cl09925 NC
non-specific 173734 234 332 3.11E-11 cd07830 STKc_MAK_like cl09925 NC
non-specific 173727 241 327 3.13E-11 cd06613 STKc_MAP4K3_like cl09925 NC
non-specific 173662 238 332 3.20E-11 cd05571 STKc_PKB cl09925 NC
non-specific 173748 238 348 3.38E-11 cd07853 STKc_NLK cl09925 NC
non-specific 173691 245 371 3.54E-11 cd05600 STKc_Sid2p_Dbf2p cl09925 NC
non-specific 173704 238 331 4.66E-11 cd05613 STKc_MSK1_N cl09925 NC
non-specific 173709 238 332 5.51E-11 cd05619 STKc_nPKC_theta cl09925 NC
non-specific 173695 238 331 5.84E-11 cd05604 STKc_SGK3 cl09925 NC
non-specific 173629 239 406 6.73E-11 cd05041 PTKc_Fes_like cl09925 N
non-specific 132986 226 332 8.26E-11 cd06655 STKc_PAK2 cl09925 NC
non-specific 173752 238 332 8.44E-11 cd07861 STKc_CDK1_euk cl09925 NC
non-specific 173754 241 372 8.54E-11 cd07865 STKc_CDK9 cl09925 N
non-specific 132968 227 331 8.72E-11 cd06637 STKc_TNIK cl09925 NC
non-specific 132967 227 331 9.03E-11 cd06636 STKc_MAP4K4_6 cl09925 NC
non-specific 132978 233 332 9.15E-11 cd06647 STKc_PAK_I cl09925 NC
non-specific 133237 226 330 9.27E-11 cd05106 PTKc_CSF-1R cl09925 N
non-specific 133247 234 400 9.95E-11 cd05116 PTKc_Syk cl09925 N
non-specific 133233 238 404 1.01E-10 cd05102 PTKc_VEGFR3 cl09925 N
non-specific 173700 242 331 1.04E-10 cd05609 STKc_MAST cl09925 NC
non-specific 173686 238 332 1.15E-10 cd05595 STKc_PKB_beta cl09925 NC
non-specific 133213 223 333 1.17E-10 cd05082 PTKc_Csk cl09925 NC
non-specific 173656 214 330 1.40E-10 cd05111 PTK_HER3 cl09925 NC
non-specific 173633 220 400 1.47E-10 cd05052 PTKc_Abl cl09925 N
non-specific 132988 231 332 1.90E-10 cd06657 STKc_PAK4 cl09925 NC
non-specific 143364 241 348 1.96E-10 cd07859 STKc_TDY_MAPK_plant cl09925 NC
non-specific 143342 231 331 2.10E-10 cd07837 STKc_CdkB_plant cl09925 NC
non-specific 173655 215 330 2.24E-10 cd05110 PTKc_HER4 cl09925 NC
non-specific 173694 238 331 2.28E-10 cd05603 STKc_SGK2 cl09925 NC
non-specific 173647 232 330 2.35E-10 cd05091 PTKc_Ror2 cl09925 NC
non-specific 132987 226 332 2.61E-10 cd06656 STKc_PAK3 cl09925 NC
non-specific 133235 254 404 3.36E-10 cd05104 PTKc_Kit cl09925 N
non-specific 133234 238 330 3.41E-10 cd05103 PTKc_VEGFR2 cl09925 N
non-specific 133181 232 330 3.60E-10 cd05050 PTKc_Musk cl09925 NC
non-specific 173685 238 332 4.15E-10 cd05594 STKc_PKB_alpha cl09925 NC
non-specific 173690 238 331 4.62E-10 cd05599 STKc_NDR_like cl09925 NC
non-specific 132985 226 332 4.74E-10 cd06654 STKc_PAK1 cl09925 NC
non-specific 132970 234 331 5.12E-10 cd06639 STKc_myosinIIIB cl09925 NC
non-specific 133221 223 330 5.18E-10 cd05090 PTKc_Ror1 cl09925 NC
non-specific 173708 238 332 5.54E-10 cd05617 STKc_aPKC_zeta cl09925 NC
non-specific 173644 238 348 6.92E-10 cd05079 PTKc_Jak1_rpt2 cl09925 NC
non-specific 173746 241 332 8.33E-10 cd07850 STKc_JNK cl09925 NC
non-specific 143356 234 332 1.01E-09 cd07851 STKc_p38 cl09925 NC
non-specific 143371 230 355 1.12E-09 cd07866 STKc_BUR1 cl09925 N
non-specific 133167 238 330 1.17E-09 cd05035 PTKc_Axl_like cl09925 NC
non-specific 173658 232 405 1.34E-09 cd05114 PTKc_Tec_Rlk cl09925 N
non-specific 173684 238 332 1.39E-09 cd05593 STKc_PKB_gamma cl09925 NC
non-specific 143341 241 332 1.42E-09 cd07836 STKc_Pho85 cl09925 NC
non-specific 133220 238 330 1.48E-09 cd05089 PTKc_Tie1 cl09925 NC
non-specific 133168 214 334 1.50E-09 cd05036 PTKc_ALK_LTK cl09925 N
non-specific 143338 238 331 1.65E-09 cd07833 STKc_CDKL cl09925 NC
non-specific 133230 238 330 1.68E-09 cd05099 PTKc_FGFR4 cl09925 NC
non-specific 88330 239 330 1.71E-09 cd05047 PTKc_Tie cl09925 NC
non-specific 143382 234 332 1.74E-09 cd07877 STKc_p38alpha_MAPK14 cl09925 NC
non-specific 133205 238 330 2.67E-09 cd05074 PTKc_Tyro3 cl09925 NC
non-specific 173759 225 402 3.02E-09 cd08219 STKc_Nek3 cl09925 N
non-specific 133229 238 330 3.29E-09 cd05098 PTKc_FGFR1 cl09925 NC
non-specific 133232 238 330 3.51E-09 cd05101 PTKc_FGFR2 cl09925 NC
non-specific 173653 238 330 3.96E-09 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 173651 238 404 4.13E-09 cd05095 PTKc_DDR2 cl09925 N
non-specific 133180 232 333 4.18E-09 cd05049 PTKc_Trk cl09925 NC
non-specific 173652 238 330 4.30E-09 cd05100 PTKc_FGFR3 cl09925 NC
non-specific 173765 238 332 4.82E-09 cd08225 STKc_Nek5 cl09925 NC
non-specific 173632 238 400 4.90E-09 cd05051 PTKc_DDR cl09925 N
non-specific 173692 238 332 5.34E-09 cd05601 STKc_CRIK cl09925 NC
non-specific 143385 238 332 6.17E-09 cd07880 STKc_p38gamma_MAPK12 cl09925 NC
non-specific 143381 241 395 6.19E-09 cd07876 STKc_JNK2 cl09925 NC
non-specific 133189 238 330 6.57E-09 cd05058 PTKc_Met_Ron cl09925 NC
non-specific 133227 238 406 6.74E-09 cd05096 PTKc_DDR1 cl09925 N
non-specific 143384 241 332 6.83E-09 cd07879 STKc_p38delta_MAPK13 cl09925 NC
non-specific 132969 234 331 6.92E-09 cd06638 STKc_myosinIIIA cl09925 NC
non-specific 173744 234 331 7.53E-09 cd07847 STKc_CDKL1_4 cl09925 NC
non-specific 173642 238 328 8.02E-09 cd05075 PTKc_Axl cl09925 NC
specific 216632 142 188 8.13E-09 pfam01657 Stress-antifung cl03296 N
superfamily 216632 142 188 8.13E-09 cl03296 Stress-antifung superfamily - N
non-specific 143359 241 332 8.82E-09 cd07854 STKc_MAPK4_6 cl09925 NC
non-specific 132974 241 328 1.03E-08 cd06643 STKc_SLK cl09925 NC
non-specific 132975 231 328 1.15E-08 cd06644 STKc_STK10_LOK cl09925 NC
non-specific 173762 234 328 1.49E-08 cd08222 STKc_Nek11 cl09925 NC
non-specific 173735 238 330 1.55E-08 cd07831 STKc_MOK cl09925 NC
non-specific 173648 232 333 1.68E-08 cd05092 PTKc_TrkA cl09925 NC
non-specific 173718 230 331 1.76E-08 cd05629 STKc_NDR_like_fungal cl09925 NC
non-specific 133219 232 330 2.14E-08 cd05088 PTKc_Tie2 cl09925 NC
non-specific 133192 238 419 2.19E-08 cd05061 PTKc_InsR cl09925 N
non-specific 173713 238 332 2.23E-08 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 133193 214 328 2.38E-08 cd05062 PTKc_IGF-1R cl09925 NC
non-specific 173753 241 332 2.39E-08 cd07864 STKc_CDK12 cl09925 NC
non-specific 173645 232 330 2.43E-08 cd05084 PTKc_Fes cl09925 NC
non-specific 133216 239 406 2.46E-08 cd05085 PTKc_Fer cl09925 N
non-specific 173717 238 331 2.79E-08 cd05628 STKc_NDR1 cl09925 NC
non-specific 173701 235 281 2.96E-08 cd05610 STKc_MASTL cl09925 C
non-specific 143383 234 332 3.39E-08 cd07878 STKc_p38beta_MAPK11 cl09925 NC
non-specific 132977 229 328 3.65E-08 cd06646 STKc_MAP4K5 cl09925 NC
non-specific 173657 214 332 4.10E-08 cd05113 PTKc_Btk_Bmx cl09925 NC
non-specific 133228 238 379 4.96E-08 cd05097 PTKc_DDR_like cl09925 N
non-specific 133246 238 330 5.28E-08 cd05115 PTKc_Zap-70 cl09925 NC
non-specific 143377 238 332 5.53E-08 cd07872 STKc_PCTAIRE2 cl09925 NC
non-specific 143380 241 332 5.80E-08 cd07875 STKc_JNK1 cl09925 NC
non-specific 173650 232 333 7.18E-08 cd05094 PTKc_TrkC cl09925 NC
non-specific 173716 238 331 7.39E-08 cd05627 STKc_NDR2 cl09925 NC
non-specific 173688 238 332 7.88E-08 cd05597 STKc_DMPK_like cl09925 NC
non-specific 133238 221 330 9.03E-08 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 132976 240 328 1.24E-07 cd06645 STKc_MAP4K3 cl09925 NC
non-specific 173687 254 331 1.75E-07 cd05596 STKc_ROCK cl09925 NC
non-specific 143379 241 332 2.16E-07 cd07874 STKc_JNK3 cl09925 NC
non-specific 143372 233 332 2.52E-07 cd07867 STKc_CDC2L6 cl09925 NC
non-specific 143373 233 332 2.82E-07 cd07868 STKc_CDK8 cl09925 NC
non-specific 173743 238 331 3.49E-07 cd07846 STKc_CDKL2_3 cl09925 NC
non-specific 143378 241 332 4.07E-07 cd07873 STKc_PCTAIRE1 cl09925 NC
non-specific 133187 238 330 4.22E-07 cd05056 PTKc_FAK cl09925 NC
non-specific 173711 239 331 4.55E-07 cd05621 STKc_ROCK2 cl09925 NC
non-specific 143375 241 332 6.39E-07 cd07870 STKc_PFTAIRE2 cl09925 NC
non-specific 143344 241 333 7.44E-07 cd07839 STKc_CDK5 cl09925 NC
non-specific 173712 254 331 8.73E-07 cd05622 STKc_ROCK1 cl09925 NC
non-specific 88524 250 332 9.24E-07 cd05623 STKc_MRCK_alpha cl09925 NC
non-specific 173689 244 332 1.49E-06 cd05598 STKc_LATS cl09925 NC
non-specific 143376 241 332 2.15E-06 cd07871 STKc_PCTAIRE3 cl09925 NC
non-specific 143349 241 280 2.82E-06 cd07844 STKc_PCTAIRE_like cl09925 NC
non-specific 173649 232 333 2.91E-06 cd05093 PTKc_TrkB cl09925 NC
non-specific 173745 244 332 3.56E-06 cd07848 STKc_CDKL5 cl09925 NC
non-specific 143374 241 331 6.53E-06 cd07869 STKc_PFTAIRE1 cl09925 NC
non-specific 133195 232 333 7.89E-06 cd05064 PTKc_EphR_A10 cl09925 NC
non-specific 173715 238 332 1.61E-05 cd05626 STKc_LATS2 cl09925 NC
non-specific 173665 241 331 2.17E-05 cd05574 STKc_phototropin_like cl09925 NC
non-specific 173714 250 332 5.09E-05 cd05625 STKc_LATS1 cl09925 NC
non-specific 173766 234 332 0.000184262 cd08226 PK_STRAD_beta cl09925 NC
non-specific 240159 245 281 0.000262742 cd05120 APH_ChoK_like cl17270 N
superfamily 247824 245 281 0.000262742 cl17270 APH_ChoK_like superfamily - N
non-specific 173646 238 279 0.000328434 cd05087 PTKc_Aatyk1_Aatyk3 cl09925 NC
non-specific 173756 234 331 0.000329909 cd08216 PK_STRAD cl09925 NC
non-specific 133174 238 328 0.000866985 cd05042 PTKc_Aatyk cl09925 NC
non-specific 133217 238 338 0.000972771 cd05086 PTKc_Aatyk2 cl09925 NC
non-specific 173667 253 341 0.00145799 cd05576 STKc_RPK118_like cl09925 NC
non-specific 173767 234 331 0.00201212 cd08227 PK_STRAD_alpha cl09925 NC
multi-dom 214567 238 332 4.40E-30 smart00220 S_TKc - NC
multi-dom 215690 226 332 5.44E-30 pfam00069 Pkinase - NC
multi-dom 214568 220 404 1.97E-26 smart00221 STYKc - N
multi-dom 197581 221 404 4.39E-26 smart00219 TyrKc - N
multi-dom 219530 238 404 9.06E-23 pfam07714 Pkinase_Tyr - N
multi-dom 223589 218 448 2.87E-21 COG0515 SPS1 - N
multi-dom 215036 238 396 1.11E-16 PLN00034 PLN00034 - N
multi-dom 240344 241 333 8.41E-16 PTZ00283 PTZ00283 - NC
multi-dom 215061 226 406 6.47E-11 PLN00113 PLN00113 - N
multi-dom 140289 244 331 7.08E-11 PTZ00263 PTZ00263 - NC
multi-dom 177557 226 330 1.04E-10 PHA03209 PHA03209 - NC
multi-dom 177649 238 332 3.46E-10 PLN00009 PLN00009 - NC
multi-dom 183880 232 330 8.28E-10 PRK13184 pknD - C
multi-dom 240233 230 348 8.51E-10 PTZ00024 PTZ00024 - NC
multi-dom 140293 248 333 1.42E-09 PTZ00267 PTZ00267 - NC
multi-dom 234389 246 333 1.67E-09 TIGR03903 TOMM_kin_cyc - C
multi-dom 173616 251 331 4.56E-09 PTZ00426 PTZ00426 - NC
multi-dom 223069 218 332 2.54E-08 PHA03390 pk1 - NC
multi-dom 165473 234 339 3.13E-07 PHA03207 PHA03207 - NC
multi-dom 173502 234 347 5.50E-07 PTZ00266 PTZ00266 - C
multi-dom 165478 232 332 2.24E-05 PHA03212 PHA03212 - NC
multi-dom 173333 238 348 4.30E-05 PTZ00036 PTZ00036 - NC
multi-dom 140307 225 386 0.000289771 PTZ00284 PTZ00284 - N
multi-dom 165476 226 330 0.00043831 PHA03210 PHA03210 - NC
multi-dom 223009 232 327 0.000672243 PHA03211 PHA03211 - NC
multi-dom 165291 226 405 0.00144856 PHA02988 PHA02988 - N
multi-dom 226168 245 281 0.00398118 COG3642 COG3642 - NC
multi-dom 178763 234 279 0.00405597 PLN03224 PLN03224 - NC
multi-dom 216618 214 281 0.00602326 pfam01636 APH - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific active site D257,K259,S261,N262,L264,D275,L278,G297,T298,Y299,G300 26 11 173623
specific ATP binding site D257,K259,S261,N262,L264,D275 20 6 173623
specific substrate binding site D257,K259,S261,L278,G297,T298,Y299,G300 11 8 173623
specific activation loop (A-loop) S274,D275,F276,G277,L278,A279,K280,G297,T298,Y299,G300 11 11 173623
 
DNA sequence
Upstream 1000 bp region from PH01005417G0030 gene.
GTTAGAATTTTCTCAAAAACTCCAGATTGATTTTGTGGAGGTTTTTTGATCTACTCCGGATTGATTTTGTGGAGGTTTTTTGGTCTACCTTTTACTACTCTGTACGGTGTATCGAAAACAGATGGGTCAATTTATAACACCTGAAAGTGGAGTCTATAAATAGATCCCTGCTATCTAGCCTCATCCGAACAATTCTACAAGAGCAGTTTTAACCATTTCATGGATTACAGTTACTTTTACGGCCGACAGTTTGACGTATGTGATGCCACACGTGCAAGTTGCTCTTTCAATGAGTGTTGTTTACCGAGTTTTGTGTTCTAGGTAGAGCATGTCAGATTCCATGATATGAGTTGTTCGCTATCTGTCTAGCACCATAGGTGATATTTTGTCTTATGCCAGTTTCATGATTGAGTATTTGTTTCAGGAGGTCAGTTGCACAAACTTAGACTTTGCTAGGGTTAGAAATTGTTGAAGTCCCAGATGTGTTCGTCTACTTTGTTGATAGTTGTGTGTTTGAACCTGCCGGTGATTTGCTCAATTTTGCTTCACGAGAAGCATTTGAATAAGACTGTTCCAGTCTTTCTTGTTCAAATTAGTCCGATGGACTTTCGAGGCACAATGTTCTTTTTATGAACACTTACTTTAAGAAGATTTTCATATTTTGGCTACATCAACGAACTCGTTTCAAGGTGGACATTGTTAAAGTGTAATCTAAATTCTTCATCGTGTCCGTGTTGAACACTGCGCCAAACATAGCACTGAGCGATGCAAGCGCCAAGCCGTGTCAGACGTGGCAACGGCTAGCGCATCCGACTTTGATTCGGTTTCCTTCTCTGTTAGGAACTCTTGTTATCTAGCTTATAAATATACCCCCGTAGTCTATAGGAAGAGCAAGAGCCGTATTGTAAATATCTTCTTGTATAGTGAATTCCGCCTTCGTACGTCCGTGGTTTTTCCGAAAAGGTTTTTCACATAAAATCCGTGTCTCTCATTCCCTTTCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAACGCCGGCGTCCTGCTCATACTCGGCCTCGTGCCGTTCGCGGCCGCCGATGAAGGTGGGGTATTATGCGACAACCTTAAACTTCTCTCCGCCACCCTCCCGAAGAACACCTCCTCTTCCCCCGAACACTTCGCCACCGCCACCGTCGGCCAAGTCCCCGACGTGGTATACGCGCTCGCACTCTGCCGCGGCGACATCGTCAACGACTCAGCTTGCGCCGAAAGCGTCGCCAACACGTTCGAGAAATTTATGCCGCAGTGCATGAACTACACGACCACGTTCGGGTTCGGCGGGTATTATTACTACGACGCCATGGTCGTCTACCTCAACGAGAACTTTCTCGTCCCCCCCAATATTACAGAAAATGACTCGCTCCTGGAGAAGTGGAACATCAAGAACATCACCGGCGACGCTGACAACTGCACGCCGGACCTGTCCGCCGGCGACTGCTTGGCATGTCTCCGTCATATCTTCGGTATGATGAACTCCACCATGTCCATGCGCATGGGAGCACAGATCCATGTCGTACGGTGTTCTTTCAGGTACGAGGCGTATGTGTTCTACCAAAGCGAACCCATGGTGCGTCTCGGGCCATCGGGCGCTGCGGCGCCGGTGCCGGCTCCGATGGTTCCGACCAGGGAGAAACACAAGAATGAAAATAAAAGAGCTTTGCTGGATTGGTACAAATGTCTAGCAATAATTGAAGGAATAGCACATGGACTTCTTTACCTACATAAGCACTCCCGATTGCGTGTCATACATCGAGATCTTAAACCAAGCAACATTCTCTTGGACAGCGAAATGAATCCCAAAATTTCAGATTTTGGGCTAGCAAAAATATTTAGCTCAAATAACACTGAAGGAAACACTACAAGAAGAGTGATTGGTACATATGGCTACATGGCTCCCGAGTATGCTTCCCAGGGCCTCTACTCTATCAAGTCCGATGTATTCAGCTTTGGTGTTCTAATTCTCGAGATCCTTAGCGGAAAAAGGAATTCCAGTTCTCATCAATGTGGAGACTTCATCAATCTCCTTGGATATGCATGGCAGTTATGGGAAGAGGGAAGATGGCTTGAACTCGTTGAAGCATCATTGGTTCCCAAGTGTCACTCGGCAGAAATGATGAGGTGCATCAACATTGCATTACTGTGTGTACAAGAGAATGCAGCTAATCGACCGACCATGTCAGATGTTGTTGCAATGCTAAGCAGTAAGACTATGATCCTGGCTGAGCCTAAGCACCCAGCATATTTCCATGCAAGAGTGGCAAATGAAGAGGCATCCACTGATACCGAGTCATGTAGTATTAATGATATGACCATATCGGCCCCAAGTGGTAGATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01005417G0030 gene.
GGGAAGAAGGGAGCTGCTCCCTCGGTCGCTATATATAGGTTGTTTTAGACATTACACGATCTTCGTTATCTAACTTTGATCATTAATGAATTAATACTAAAAATTATAAAATTAATATATTCTGAAAAAAATTCACAACAAATCTAGCGGTATTATTTTCCATTTGTTAGGAGATAAATGTCATCTTCGGCTGTCGATTTCAGTGTCAATAAAGCTACAAACAATTTCCACAAACCGTCTTGACTCCGCTACTCATAAATTCAAGACACTATCCGATCGACGTACCCACCAAGGCACCAACTAATTAAGGGCCCAGACCGAAGATCTAAGGGCCCAGACCTCCCCTCGCTAAGATCTAAAGGCCCAGATCTCCCCTCGCTAAGATCTAAGGGACCAGACCTCCCCTCGCCTAGATCTAGTGATCCAAACCTCCTCTCGTTTAGATCCAACCGTCCAGACCTCCCTTCATTTAGATCTAACGGCCCAGACCTCCCTTTCGCTTACATCTAAGGTTACAGACCTTCCTTCGTTTGGATCTAACGATCCATACCTCCTTCGCTTAGATGTAAGGACATAGACCTCCCATCGCTTGGATCTAACGGTCCCGACCTCCCCTCGATTGGATCTAACGATCCCGACCATCCCTCGAGTGGATCTAACGATCCCGACCTCCCCTCGCTTGGATCTAACAATCCAGACCACCCCTCGATTGGATCTAACGATCCAGACCTTCCCCCACCTAGATCTAACGATCTAGACCTCTCTTCGTTTAGATCTAACGATCCATATCTCTCTTCGTTTAGATCTAACGATTTGGACCTTACTTCACTTCATTTAGATCTAAGGGACCAGACCCCTGTTCGTTTAAATCTAACGATCTAGACCTCTCTTCGTTTTGATCTAACGGTTCAAATCTCTCTACCATTAGATCTGAGGGTTCAGACCTTCCTCTCGTTAGATCTCCCTCTTGATCTTTTTGCAAAGACCACCTTCTTGATCTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01005417 Download
Protein sequence
Protein sequence
MNAGVLLILGLVPFAAADEGGVLCDNLKLLSATLPKNTSSSPEHFATATVGQVPDVVYALALCRGDIVNDSACAESVANTFEKFMPQCMNYTTTFGFGGYYYYDAMVVYLNENFLVPPNITENDSLLEKWNIKNITGDADNCTPDLSAGDCLACLRHIFGMMNSTMSMRMGAQIHVVRCSFRYEAYVFYQSEPMVRLGPSGAAAPVPAPMVPTREKHKNENKRALLDWYKCLAIIEGIAHGLLYLHKHSRLRVIHRDLKPSNILLDSEMNPKISDFGLAKIFSSNNTEGNTTRRVIGTYGYMAPEYASQGLYSIKSDVFSFGVLILEILSGKRNSSSHQCGDFINLLGYAWQLWEEGRWLELVEASLVPKCHSAEMMRCINIALLCVQENAANRPTMSDVVAMLSSKTMILAEPKHPAYFHARVANEEASTDTESCSINDMTISAPSGR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above