gene PH01005083G0060
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01005083:22849 - 30429(+ stand)   Name
Alternate name Locus tag PH01005083G0060
Length of gene 7581  bp Length of CDS 2631  bp
Product information
Feature type
CDS
Product name
MIF4G domain containing protein
Alternate name
UPF2, RENT2
Molecular weight
(predicted)
99125.1811200001  kDa
Isoeletric point
(predicted)
5.2214012145996
Length
876  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_129338 7
Please click OG5_129338 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G39260.1
binding;RNA binding
binding;RNA binding; FUNCTIONS IN: RNA binding, binding; INVOLVED IN: translation, RNA metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g42040.1 MIF4G domain containing protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
  3. Domain
1 100 200 300 400 500 600 700 800 876
Detailed signature matches
    1. PF02854 (MIF4G)
    2. SM00543 (MIF4G)
    1. SSF48371 (ARM repeat)
    1. PF04050 (Upf2)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR12839 (NONSENSE...)
  2. PTHR12839:SF7 (SUBF...)
GO term prediction

Biological Process

GO:0016070 RNA metabolic process

Molecular Function

GO:0003677 DNA binding
GO:0003723 RNA binding
GO:0005488 binding
GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Genetic Information Processing Translation RNA transport  
Genetic Information Processing Translation mRNA surveillance pathway  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K14327 regulator of nonsense transcripts 2
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 217253 358 559 5.61E-39 pfam02854 MIF4G cl02652 -
superfamily 243128 358 559 5.61E-39 cl02652 MIF4G superfamily - -
specific 217861 659 811 7.51E-39 pfam04050 Upf2 cl04380 -
superfamily 217861 659 811 7.51E-39 cl04380 Upf2 superfamily - -
non-specific 214713 358 559 2.81E-38 smart00543 MIF4G cl02652 -
specific 214713 158 343 3.81E-36 smart00543 MIF4G cl02652 -
superfamily 243128 158 343 3.81E-36 cl02652 MIF4G superfamily - -
non-specific 217253 156 343 2.03E-34 pfam02854 MIF4G cl02652 -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01005083G0060 gene.
GGGTCGGACGCTCTTGTATGTGGATGATATGATCATTACTGGCGATGACTCTTGGTTTATTGCCTTTGTGAAGGAGCGTCTCAGTGAGTAGTTCTTGATGTTCGATTTGGGTCCTCTTCATTTCTTCCTTGGGATTGAGATCATTTTTACGCCTGAGGGCTATTATATCTCCTAGGAGAAGAACATTCAGGATATCTTTACTCGTGCTTGTCTCACTGAACAGCGCATGGTGGATACTCCTATGGAATTTGGTGTTCACCTTCTGCTCATTGATGGTGAGCCTCTTGAGGACCCCACTCACTACCGTCATCTTGTCGGGAGCTTCGTCTCTCTTGGGACCACTCGACTTGATATTTCTCGCCCAGTTCACATCCTGAGTCAGTTCGTTTCTGCTCCCACTCAGTTCCACTACAGTCACCTTCGTGTTCCGAGATATCTTCGCGGGACCATCACTCGTCGTTTTTTCTTTCCTCGCTCTAGTTCTCTGCAGCTTCAGGCGTACTCTGATATAACCTGGGCTAGCGATCATTATGATCGCCGTTCTCTTTCTACTTATTATGTTTTCCTTGGTTCCTCTTTGATTGCCTGGAAGACCAAGAAGTAGACTGCCGTTTCCTGTTCGAGTGCTGAGGCCGAGTTGAGAACCATGGCGTTGTTGACAGCTGAGATTACCTGGCTTTGGTGGCTACTTGAGGATTTCAGTGTTTCAGTTTCTGTACCGACTCCTCTTTTATTAGACAATACTGGTGCGATCAGCATTGCTTGAGATCCAGTGAAACATGAACTCACCAAGCACATTGGAGTAGATGCTTCGTACATGAGATCGCAGGTGCAAGACCAAGTTATTGCTCTTCCGTATGTGCCTTCGAAGCTTCAGTTAGCAGATTTATTCACTAAAGCACACACTAGAGCTCAACACAGTTTCTACCTCTCCAAACTTAGTGTTGTTGATCTACCATGAGTTTGATGGAGGGGGGAGTTTGATGGAGGGGGTGTTACAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCAGCCTCCAGTGATGCCAGATGATGGAAGTACAACAAGGGTCACTACAGGAACCAATGTCACCCCCTCTTCTGGAAAAGAGCCATCTGGACTGGAGCCTATTTGGGATGATGACGATACCAAGGCATTTTATGAATCCTTACCTGATCTCAGAGCATTTGTGCCCGCTGTGTTATTGGGAGAGGCCGAACCAAAGTTGAATGAGCAGCACACTAAGGGCCGTGAACAATCCAGTGAATCCGGCACAGAACAAGAGACTGAAGTACATGATAATACTCAAACTTCTAATGCCACTGAACATCAGCTGGAAGGAAAGGCAGACGATGGAGCCAAGGATAGTGAAGACAAAGACAAAGACAAGGGAAAAGATGTAGAAAAAGAAAAATACAAAGAGAAGGATCTAGACAGAAAAACTGAAAGAGAAAAAGAGAAAGTAAGAGCCTTGGATGGTGCAAGTTTGGATAACCTGCTACAGAGGCTGCCAGGACTTGTTAGCCGCGATCTTATTGATCAATTGACGGTTGAGTTTTGCTACCTAAATTCCAAAGCAAGTCGAAAGAAACTTGTGCGGGCCTTGTTCAATGTTCCAAGGACTTCACTGGAACTTTTACCTTACTATTCTCGGTTGGTTGCCACACTGTCAACATGTATGAAAGATGTCCCAAGCATGCTTCTCTCTATGCTTGAAGAGGAGTTCAACTTTCTAATAAATAAGAAGGATCAGATCAACATTGAAACAAAAACAAAAAACATAAGATTTATTGGGGAGTTGTGCAAATTCAAAATTGCACCTGCAACTCTTGTTTTTAGCTGTTTGAAGGCCTGCCTAGATGATTTCAGTCATCATAACATTGATGTGGCCTGCAACCTTCTCGAGACTTGCGGACGCTTTTTGTATCGGTCACCTGAAACCACAATTCGTATGGCTAACATGTTGGAGATACTGATGCGATTGAAAAATGTCAAGAATTTGGATCCACGCCACAGTACACTTGTAGAAAATGCCTACTATCTTTGTAAACCGCCAGAAAGATCTGCCCGAGTTTCAAAAGTTCGGTCACCTCTGCATCAATACATAAGGAAGTTGCTTTTCTCAGATCTTGATAAATCAAGTGCTGAACATGTTCTTCGCCAATTACGCAAGCTACCTTGGGCAGAGTGTCAGCAATACCTTATAAAGTGCTTTCTAAAGGTTCACAAGGGAAAGTACAGCCAAGTTCATCTTATTGCACTTCTCACTGCTGGGCTTAGTCGCTATCATGATGACTTTGCTGTCGCAGTGGTAGATGAGGTTTTAGAAGAGATAAGGGTTGGGCTGGAGTTGAATGACTATGGAATGCAACGAAGGCGCCTTGCCCACATGCGATTCCTTGGAGAGCTATACAGCTACAAGCATATTGATTCATCAGTTGTATTTGAGACACTGTACCTTATCATTGTGTTCGGTCATGGAACTCCTGAACAAGATGTGTTGGATCCACTAGAAGATTGCTTCAGGATCAGGTTGATCATTACACTTTTGCAGACTTGTGGCCACTATTTTAATAGAGGCTCTTCGAAAAGAAAGCTCGACAAGTTTTTGCTACATTTTCAAAGATATATTATCAGTAAAGGGCCCTTACCACTTGACATAGAGTTTGACATTCAGGATTTGTTTGCTGAGCTACGACCCAACATGACTAGGTATTCATCAATAGAAGAACTAAATGATGCAATAGTTGAGCTCGAAGAAAACGAGCGTGCAGCCTCAGTAGAGAAGCCTGATACTGAAAGACACTCAGACAGCGAATCTCAGAAAAAGCAGCCACATGATGCTGCCTTTTCTGTGAATGGCGGGGGCTCAACAAATGGAGCTGAGGAAAATGGTAAGGATCATGAGGAAGCAGCAGACAGTGAGAGCTATTCAGATAGTGGCAGTCTTGATGGTCACGAAGATGAGGAAGATCTTTTGTCTGAGGAGAAATCAAATGATGCATCAGAGAATGAAGGTGACGATGAAGATGATGGCATGCCTGTTGGTTCTGATGAAGATGAAAGTGTTGAGGTTAGACAGAAGGTCGTGCAAGTTGATCCTAAGGAGCAAGAAGACTTTGACCGGGAGCTGAAAGCCCTTCTACAGGAGAGCTTGGAATCACGTAAATCGGAGGTGCGTCCCAGGGCCACTTTGAACATGATGGTACCAATGAATGTCCTTGAGGGTTCAAAGGACCCAAGGGCTACGGAGTCCGAGAGTGGAGAGGAAACTGTGGATGAAGAGGGTGGTAATGCTGGGGGTGGCAGCAAGGTGCGTGTTAAGGTGCTAATGAAGAAAGGACACAAACAGCAGACAAAGCAGATGTTCATTCCTGGTGACTGCTCACTTGTGCAGAGCACAAAGCAGCAAGAAGCTGCTGAGCTTGAGGAGAAGCAGAGCATCAAGCGAAGGATCCTTGAATACAACGAAAGGGAGGAGGAAGAAATGAATGGTGGATCATTGCAAATGGGGAATTGGGGTCAAGGAGGAAGCAACACGGGCGGCAGCATTAGATCAGGTGGACGGGGCAGTTGGGATGGTTCAACGAGGGGAGGCACACGGCAATGGCACCACATTTCTGGTGGTTTCTACCATAGTTATGGCAGAAGAAGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01005083G0060 gene.
ATAAAGCGATCGATGATGAGTACGTGGATTCTGCCTTGTTTGGGGGCAAGTGCATGTTGGCGCTTTCTGCTTCTACTCCCTCTACTGCTAGCTAGTCTAGTTTCCTAGTTGGATAAAGATGCATTTCCCTCTCACCTTGATGTGGAAAAGCAAAGGTTCTAGTGCCTTTCTTCGTGTGCAAGCTATCGTCAGTCGCTTTTAACTACCTCTTATGTCTTCTCTACCATAGTACAAAAAACCGAATAAGATCGGCGGTTTAACCGGAACAAAACCAGGACTGGTGCCAGATCCGGTCTAGTTCGTAAGATAGATCGGCTAAGTATAAAACCGGTGAGAAAAAAAAATTAAACACCTTGCTGCGGCAGAGATTGAACCCACCCCTGCTTCTACGCGGAAGGCCTTACCAACCCACCTAGCCAGCTTCAAGTGACTAACAAGCAGAGTGGATCATATATTAGTGTATTTCTACTAGAAGTTGGTATATACTCTACATATTATTAAAATTTAAAATCAACAAAACATATTAAAATGTAGTATTTTTGAACCGGCGGTCGAGCCAGCGAACCTTGAACCAGTGACTTGTCCGGTTCACTAGCCAGTCCAGTTTTTCATACTATGCTCTCTACACGTGGGTTGCACCGACAAGCACGATTGCAATAGGGCTAAATCTTGCACCTTACATGATATATGCAGGCTGCTAGATCTGTAGATACTACCTGCTATATATATAATCATCTAATTTGGTGTGAAAAATTAATGGTGTGAACCATGAACATGTGAAAANNNNNNNNNNCGGGTCCGGTTGGGAGCTCCGAGCTCGTGAGTCGTGACCGACTGAGAGAGAGAGAGAGAGAGAGAGTGAATTTGGAAGGGAAGGGAGACCGAGTGAGGATGAGATGAGGGTTTGGCATTTTGGGCATTTTGGGCGGGGTCTGAAGCGGAGCTCGGCGGGATGCCAAAAAATTCGGATACGGTCGGTAATATCCGATTATAACGCCGGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01005083 Download
Protein sequence
Protein sequence
MQPPVMPDDGSTTRVTTGTNVTPSSGKEPSGLEPIWDDDDTKAFYESLPDLRAFVPAVLLGEAEPKLNEQHTKGREQSSESGTEQETEVHDNTQTSNATEHQLEGKADDGAKDSEDKDKDKGKDVEKEKYKEKDLDRKTEREKEKVRALDGASLDNLLQRLPGLVSRDLIDQLTVEFCYLNSKASRKKLVRALFNVPRTSLELLPYYSRLVATLSTCMKDVPSMLLSMLEEEFNFLINKKDQINIETKTKNIRFIGELCKFKIAPATLVFSCLKACLDDFSHHNIDVACNLLETCGRFLYRSPETTIRMANMLEILMRLKNVKNLDPRHSTLVENAYYLCKPPERSARVSKVRSPLHQYIRKLLFSDLDKSSAEHVLRQLRKLPWAECQQYLIKCFLKVHKGKYSQVHLIALLTAGLSRYHDDFAVAVVDEVLEEIRVGLELNDYGMQRRRLAHMRFLGELYSYKHIDSSVVFETLYLIIVFGHGTPEQDVLDPLEDCFRIRLIITLLQTCGHYFNRGSSKRKLDKFLLHFQRYIISKGPLPLDIEFDIQDLFAELRPNMTRYSSIEELNDAIVELEENERAASVEKPDTERHSDSESQKKQPHDAAFSVNGGGSTNGAEENGKDHEEAADSESYSDSGSLDGHEDEEDLLSEEKSNDASENEGDDEDDGMPVGSDEDESVEVRQKVVQVDPKEQEDFDRELKALLQESLESRKSEVRPRATLNMMVPMNVLEGSKDPRATESESGEETVDEEGGNAGGGSKVRVKVLMKKGHKQQTKQMFIPGDCSLVQSTKQQEAAELEEKQSIKRRILEYNEREEEEMNGGSLQMGNWGQGGSNTGGSIRSGGRGSWDGSTRGGTRQWHHISGGFYHSYGRRR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above