gene PH01004839G0040
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01004839:38896 - 45191(+ stand)   Name
Alternate name Locus tag PH01004839G0040
Length of gene 6296  bp Length of CDS 897  bp
Product information
Feature type
CDS
Product name
peroxidase precursor
Alternate name
Molecular weight
(predicted)
31891.5634199999  kDa
Isoeletric point
(predicted)
5.67930221557617
Length
298  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_164439 5
Please click OG5_164439 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G71695.1
Peroxidase superfamily protein
Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress, oxidation reduction; LOCATED IN: cell wall, vacuole, membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED D
4E-85
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g73170.1 peroxidase precursor, putative, expressed 2E-107
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
1 50 100 150 200 250 298
Detailed signature matches
    1. SSF48113 (Heme-depe...)
    1. PR00461 (PLPEROXIDASE)
    1. PS50873 (PEROXIDASE_4)
    2. PF00141 (peroxidase)
    3. PR00458 (PEROXIDASE)
    1. PS00435 (PEROXIDASE_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31537 (FAMILY N...)
  2. PTHR31537:SF0 (SUBF...)
GO term prediction

Biological Process

GO:0006979 response to oxidative stress
GO:0055114 oxidation-reduction process

Molecular Function

GO:0004601 peroxidase activity
GO:0020037 heme binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173827 69 280 2.89E-96 cd00693 secretory_peroxidase cl00196 -
superfamily 241676 69 280 2.89E-96 cl00196 plant_peroxidase_like superfamily - -
non-specific 215745 38 260 1.08E-48 pfam00141 peroxidase cl00196 -
non-specific 215545 69 288 2.57E-36 PLN03030 PLN03030 cl00196 N
non-specific 173827 3 68 2.32E-27 cd00693 secretory_peroxidase cl00196 C
superfamily 241676 3 68 2.32E-27 cl00196 plant_peroxidase_like superfamily - C
non-specific 173823 32 277 7.13E-23 cd00314 plant_peroxidase_like cl00196 -
non-specific 215745 1 137 4.64E-21 pfam00141 peroxidase cl00196 -
non-specific 178467 116 277 4.14E-11 PLN02879 PLN02879 cl00196 N
non-specific 173825 117 275 3.23E-10 cd00691 ascorbate_peroxidase cl00196 N
non-specific 166005 117 277 4.88E-07 PLN02364 PLN02364 cl00196 N
non-specific 173826 59 284 0.00193948 cd00692 ligninase cl00196 -
non-specific 173829 118 218 0.00759058 cd08201 plant_peroxidase_like_1 cl00196 NC
multi-dom 178218 117 287 1.12E-09 PLN02608 PLN02608 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific heme binding site N91,T93,R95,P162,P163,P164,L171,L175,L185,L188,S189,G191,H192,V194,G195,I196,A197,H198,S201,F238,S240,M272 29 22 173827
specific active site T93,R95,P162,P163,P164,T165,L171,L175,L185,L188,S189,G191,H192,V194,G195,I196,A197,H198,T200,S201,F238,S240,M272 31 23 173827
specific substrate binding site P89,P90,P162,P163,P164,T165,H198,T200,S201 10 9 173827
specific calcium binding sites D71,S73,T193 9 3 173827
generic heme binding site 23 0 173827
 
DNA sequence
Upstream 1000 bp region from PH01004839G0040 gene.
GCCTAAACAAATAGGGCCACAATAACGTAGAAACAAGGCCGCTTTTAATCGGTTGTACACACTTGATGTGAGCTGTACTCTGGTGATCGGACAGTACAGAAGAGACCTAATGCCACCTAATTGTGCTCCTCTGTCGTGGCTTGTTGCTTTGACAAAGGATCCGCTGCTTCCAGAGAATGACCAGTAGCTCGCCGAGCTCCTTGGTCAGGGATGGAGATAGGGAGACTAGTGGGAGCTCTGGTCTAGGAGCTCTGGTCTGTCAGGGACGGAGATAGGGGGACTAGTGGGAGCTCTGGTCTTCCTATGGCTGATGAAATCGTTTATATAGTTCTTTGTTTTCTCATGTAGAATAACAAAATATTTATATTTAACACCCCTCGATATTTAGTTATCACTATATAATCCTTGGTTAATTTTTTTTAAGTCCCTGTCTGTTTCCCCCTTCCACGTGAAGTCCCTGTCTGTTTTCCCCTTCCACGTGACGCGTCCCGATGGAAGAACTGGACTAAGCCATTTCTGTAACCATGGTGCACTGAATCATGCGAGGTACGTATCTACTGTATAATGCTTGGCTCACAGCACCGCACGTGTACAAGTAACCATATACGGAGAAAACCAACAGTGGCAGACGTGCAATGTGAACACCAATTCACACGTACCTAGCACACTGAGATATATTTTCTACATCCCTCCGATTAATGGAAGCTTTGACTGGCCACCAAGCTACTCTCTCGGTTCATAGAAATAAATAACTTATCGATATATTTTTAAATATTTAGATTAAATACATAAAAATTATATGTGTAGATTCGTCTCGAAAAATACTTTTATAATATTATAATTTTATTAGGCTTTACAAATATATTATAATAATAATTAATGATTAAAGTTGTACTTTAGTGATCAACCGACCGTGTTGATGTCGAAAACGATTTGTTTGTGCGAACTTAGTGAGTAAATCGAGCGCCCAGCTAGACACCGTCACTGTGGCGAATAAATGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCAGGGTTGCGATGGTTCCATCCTTCTGAGCAAGACGCCCGCCGGGGACAGCGAGCAGGAGGCTCCACCCAACCTGACGCTCCGCCCGTCGGCGTTCAAGGCCATCAACGACCTCCGAGCCCTCCTGCACAAGGCATGCGGCCTCGTCGTCTCCTGCGCCGACATCGTCACCCTCGCCGCCCGCGACTCCGTCCACCTGGGTTGCGATGGTTCCATCCTTCTGAGCAAGACGCCCGCCGGGGACAGCGAGCAGGAGGCTCCACCCAACTTGACGCTCCGCCCGTCGGCGTTCAAGGCCATCAACGACCTCCGAGCCCTCCTGCACAAGGCATGCGGCCTCGTCGTCTCCTGCGCCGACATCGTCACCCTCGCCGCCCGCGACTCCGTCCACCTGGCCGGCGGGCCGGAGTACAAGGTCCCCTTGGGCCGGCGTGACAGCCTCAAGTTCGCGACGAGGGATGAAGTCTTGGACGCCCTGCCGCCGCCGACCTCGCATGTTCCCGCCCTCCTAGACGCCCTGGCCAAGATCAACCTCGACGTCAACGACCTCGTGGCGCTCTCCGGCGGGCACACCGTCGGCATCGCGCACTGCACCTCCTTCGATGAACGCCTATACCCGCAGCAGGACCATACCATGAACAAGTGGTTCGCCGGCCACCTCAAGCTCACCTGCCCCGCCAAGGGCGTCGACAACACCACCGGGCTCTTCACCTCCGACCAGGACATGTACACGGACGCCAGGACCAAGCCCATCGTCACCATCTTCGCCGTGGACCAGTCGGCGTTCTTCGATCAGTTCGTCTTCTCCATGGTGAAGATGGGGCAGACCCAGGTGCGTAACGCCAGCAGCAACGAGCTCCCGTGGTCCGTCGTGGAGAGCATGGTGTTGTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01004839G0040 gene.
ATAAATATTTTCATACGAGCAATCCGAATATTCATAACGATATTATTTATTGGTCAGAGTGAAAATGGTAAATGATACCTTACAAACAGTGCAATTGACTTGTTCAGAAGCTCCCCTGAAGTAATCATCATGACCTAATCAGAATGGAGTCAAATTAATTACAGGCATGTACTGCTTTCATTCTCAATTTTTTTTTGGCCAAAATGACACTACTTGAANNNNNNNNNNNNNAATTCCCAATTTTTTTGTCTACCGAAATGATACTATTTGAAACGGCATTAGCAAAAATAGCATCCTCACAGCCGCAATTGCAAAAGTAACACTCTCGTCCGCACGGGCCACGGAACGACCGTGCAGACGAGAATGCTATTTTTGTAATTATAGCTGTAAGAACGTTATTTTTGTTAATCCCACTTCAAATAGTATCATTTCAGCCGATGATTCGTTCTCTGCCACAATCCGCTTCTAGTCTCCCATGAATGCAAGACAAGTTGGTACAGGTCCGGTCGGAGTAGCAGAACAACGAGCAGAGGTCGTTACTTGGAGGCAGTTTTTCATATACTCGAGGAAAAGCGGCACCCTTTCTTTTGTACTCGAGGAAAAGCAACACAAATTCGTACTTTTGATTAATGTATGCAGTCTATCATGTGATGCCGAAACCAGAGATGACAGAGATGCGTTCCGACCATTTCATGCCAATCTGAGAAACCATTACGCTGGCAAGGCACTTTGCGCCGACAAAGTAGTGTGGTGATTCAAAGTACGGAAGTGGTGGTACGCGCTTACAACACGCGTGTCCTTGGATCGTGAGGAAGCACAAACACACAGGGACACAGGAAGCATACACACACAGGATTTGCTCCGTCGTAACGCTATCGTATGATATTTACCGTTCGTATATCAGCTTAGCAGTATCGATCAATCGACAGATGAACAGCTAGCTAGCTTCCGCATGTGAACGCACAAGAAGAAGGTTACTGCAAGGTGCAGAGTGCTAGTCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01004839 Download
Protein sequence
Protein sequence
MAQGCDGSILLSKTPAGDSEQEAPPNLTLRPSAFKAINDLRALLHKACGLVVSCADIVTLAARDSVHLGCDGSILLSKTPAGDSEQEAPPNLTLRPSAFKAINDLRALLHKACGLVVSCADIVTLAARDSVHLAGGPEYKVPLGRRDSLKFATRDEVLDALPPPTSHVPALLDALAKINLDVNDLVALSGGHTVGIAHCTSFDERLYPQQDHTMNKWFAGHLKLTCPAKGVDNTTGLFTSDQDMYTDARTKPIVTIFAVDQSAFFDQFVFSMVKMGQTQVRNASSNELPWSVVESMVL
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above