gene PH01004795G0030
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01004795:45179 - 50109(- stand)   Name
Alternate name Locus tag PH01004795G0030
Length of gene 4931  bp Length of CDS 2199  bp
Product information
Feature type
CDS
Product name
OsWAK11 - OsWAK receptor-like protein kinase
Alternate name
Molecular weight
(predicted)
80981.9438200001  kDa
Isoeletric point
(predicted)
5.85692977905273
Length
732  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_133796 19
Please click OG5_133796 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G21270.1
wall-associated kinase 2
cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase.
wall-associated kinase 2 (WAK2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, calcium ion binding, ATP binding; INVOLVED IN: cellular water homeostasis, protein amino acid phosphorylation, oligosaccharide metabolic proc
7E-166
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g02120.1 OsWAK11 - OsWAK receptor-like protein kinase, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
Detailed signature matches
    1. PF13947 (GUB_WAK_bind)
    1. SM00181 (EGF)
    1. SM00179 (EGF_CA)
    2. PF07645 (EGF_CA)
    1. SSF56112 (Protein k...)
    1. PF00069 (Pkinase)
    2. PS50011 (PROTEIN_KI...)
    1. SM00220 (S_TKc)
    1. PS01187 (EGF_CA)
    1. PS00107 (PROTEIN_KI...)
    1. PS00108 (PROTEIN_KI...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24420 (FAMILY N...)
  2. SSF57196 (EGF/Laminin)
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0004674 protein serine/threonine kinase activity
GO:0005509 calcium ion binding
GO:0005515 protein binding
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups
GO:0030247 polysaccharide binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173623 420 608 7.92E-52 cd00180 PKc cl09925 -
superfamily 245201 420 608 7.92E-52 cl09925 PKc_like superfamily - -
specific 238011 289 319 0.000280403 cd00054 EGF_CA cl09941 C
superfamily 245213 289 319 0.000280403 cl09941 EGF_CA superfamily - C
non-specific 173624 418 684 2.30E-50 cd00192 PTKc cl09925 -
non-specific 173659 414 674 1.55E-38 cd05122 PKc_STE cl09925 -
non-specific 173724 418 612 1.77E-37 cd06606 STKc_MAPKKK cl09925 C
non-specific 173755 418 679 4.40E-35 cd08215 STKc_Nek cl09925 -
specific 222467 29 129 7.84E-33 pfam13947 GUB_WAK_bind cl16494 -
superfamily 222467 29 129 7.84E-33 cl16494 GUB_WAK_bind superfamily - -
non-specific 173771 413 674 3.81E-32 cd08529 STKc_FA2-like cl09925 -
non-specific 173731 419 610 5.65E-32 cd06627 STKc_Cdc7_like cl09925 C
non-specific 133248 408 686 1.40E-30 cd05148 PTKc_Srm_Brk cl09925 -
non-specific 173672 412 610 2.18E-30 cd05581 STKc_PDK1 cl09925 C
non-specific 173629 418 684 9.56E-30 cd05041 PTKc_Fes_like cl09925 -
non-specific 133243 417 674 5.69E-29 cd05112 PTKc_Itk cl09925 -
non-specific 173636 400 610 1.34E-28 cd05057 PTKc_EGFR_like cl09925 C
non-specific 133180 418 684 1.74E-28 cd05049 PTKc_Trk cl09925 -
non-specific 173628 417 687 2.13E-28 cd05038 PTKc_Jak_rpt2 cl09925 -
non-specific 173633 419 686 2.29E-28 cd05052 PTKc_Abl cl09925 -
non-specific 133171 420 608 3.58E-28 cd05039 PTKc_Csk_like cl09925 C
non-specific 133189 418 689 4.95E-28 cd05058 PTKc_Met_Ron cl09925 -
non-specific 133191 418 686 6.40E-28 cd05060 PTKc_Syk_like cl09925 -
non-specific 173625 418 684 7.92E-28 cd05032 PTKc_InsR_like cl09925 -
non-specific 173726 419 640 1.10E-27 cd06610 STKc_OSR1_SPAK cl09925 -
non-specific 173728 411 609 1.65E-27 cd06614 STKc_PAK cl09925 C
non-specific 173772 413 622 2.05E-27 cd08530 STKc_CNK2-like cl09925 -
non-specific 173660 420 610 4.63E-27 cd05123 STKc_AGC cl09925 C
non-specific 173626 418 674 1.26E-26 cd05034 PTKc_Src_like cl09925 -
non-specific 133216 420 683 2.17E-26 cd05085 PTKc_Fer cl09925 -
non-specific 133179 417 685 2.29E-26 cd05048 PTKc_Ror cl09925 -
non-specific 173757 419 612 4.49E-26 cd08217 STKc_Nek2 cl09925 C
non-specific 143345 418 613 1.03E-25 cd07840 STKc_CDK9_like cl09925 C
non-specific 133199 418 610 1.16E-25 cd05068 PTKc_Frk_like cl09925 C
non-specific 133172 419 610 3.93E-25 cd05040 PTKc_Ack_like cl09925 C
non-specific 173764 411 620 7.36E-25 cd08224 STKc_Nek6_Nek7 cl09925 C
non-specific 132954 412 612 8.55E-25 cd06623 PKc_MAPKK_plant_like cl09925 C
non-specific 132957 420 612 1.20E-24 cd06626 STKc_MEKK4 cl09925 C
non-specific 173733 420 612 1.86E-24 cd07829 STKc_CDK_like cl09925 C
non-specific 173637 418 683 6.10E-24 cd05059 PTKc_Tec_like cl09925 -
non-specific 132943 414 674 1.17E-23 cd06612 STKc_MST1_2 cl09925 -
non-specific 133211 418 686 1.21E-23 cd05080 PTKc_Tyk2_rpt2 cl09925 -
non-specific 133165 418 683 3.44E-23 cd05033 PTKc_EphR cl09925 -
non-specific 133194 420 642 4.32E-23 cd05063 PTKc_EphR_A2 cl09925 -
non-specific 133246 419 685 4.53E-23 cd05115 PTKc_Zap-70 cl09925 -
non-specific 173655 399 610 7.94E-23 cd05110 PTKc_HER4 cl09925 C
non-specific 173760 413 679 1.17E-22 cd08220 STKc_Nek8 cl09925 -
non-specific 173761 413 683 1.27E-22 cd08221 STKc_Nek9 cl09925 -
non-specific 133212 420 687 1.34E-22 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 -
non-specific 173649 412 660 1.66E-22 cd05093 PTKc_TrkB cl09925 -
non-specific 173650 418 610 1.68E-22 cd05094 PTKc_TrkC cl09925 C
non-specific 173640 418 674 2.07E-22 cd05067 PTKc_Lck_Blk cl09925 -
non-specific 133187 417 611 2.38E-22 cd05056 PTKc_FAK cl09925 C
non-specific 173730 406 681 2.44E-22 cd06624 STKc_ASK cl09925 -
non-specific 133193 408 684 4.26E-22 cd05062 PTKc_IGF-1R cl09925 -
non-specific 173658 418 619 6.33E-22 cd05114 PTKc_Tec_Rlk cl09925 -
non-specific 133247 419 684 8.59E-22 cd05116 PTKc_Syk cl09925 -
non-specific 173670 420 610 1.23E-21 cd05579 STKc_MAST_like cl09925 C
non-specific 132940 418 610 1.39E-21 cd06609 STKc_MST3_like cl09925 C
non-specific 133167 418 686 1.77E-21 cd05035 PTKc_Axl_like cl09925 -
non-specific 173641 418 674 2.65E-21 cd05072 PTKc_Lyn cl09925 -
non-specific 133181 408 679 3.35E-21 cd05050 PTKc_Musk cl09925 -
non-specific 132938 397 674 3.60E-21 cd06607 STKc_TAO cl09925 -
non-specific 173657 418 610 4.65E-21 cd05113 PTKc_Btk_Bmx cl09925 C
non-specific 173770 420 683 5.00E-21 cd08528 STKc_Nek10 cl09925 -
non-specific 133214 420 684 6.88E-21 cd05083 PTKc_Chk cl09925 -
non-specific 133202 419 674 8.15E-21 cd05071 PTKc_Src cl09925 -
non-specific 133201 418 674 8.21E-21 cd05070 PTKc_Fyn_Yrk cl09925 -
non-specific 133192 418 684 8.31E-21 cd05061 PTKc_InsR cl09925 -
non-specific 173648 419 610 9.80E-21 cd05092 PTKc_TrkA cl09925 C
non-specific 133213 420 608 9.82E-21 cd05082 PTKc_Csk cl09925 C
non-specific 132963 420 612 1.44E-20 cd06632 STKc_MEKK1_plant cl09925 C
non-specific 173736 420 609 1.72E-20 cd07832 STKc_CCRK cl09925 C
non-specific 132962 420 612 2.11E-20 cd06631 STKc_YSK4 cl09925 C
non-specific 173768 413 618 7.87E-20 cd08228 STKc_Nek6 cl09925 C
non-specific 173645 419 685 1.07E-19 cd05084 PTKc_Fes cl09925 -
non-specific 173727 414 608 1.09E-19 cd06613 STKc_MAP4K3_like cl09925 C
non-specific 133178 420 683 1.15E-19 cd05046 PTK_CCK4 cl09925 -
non-specific 132991 420 610 1.32E-19 cd06917 STKc_NAK1_like cl09925 C
non-specific 173769 413 684 1.61E-19 cd08229 STKc_Nek7 cl09925 -
non-specific 173725 407 608 1.80E-19 cd06608 STKc_myosinIII_like cl09925 C
non-specific 173632 452 610 2.56E-19 cd05051 PTKc_DDR cl09925 NC
non-specific 132978 419 609 2.87E-19 cd06647 STKc_PAK_I cl09925 C
non-specific 173639 418 610 3.16E-19 cd05066 PTKc_EphR_A cl09925 C
non-specific 133228 438 610 4.44E-19 cd05097 PTKc_DDR_like cl09925 C
non-specific 132973 414 689 4.99E-19 cd06642 STKc_STK25-YSK1 cl09925 -
non-specific 173638 420 610 5.85E-19 cd05065 PTKc_EphR_B cl09925 C
non-specific 143333 418 612 7.13E-19 cd05118 STKc_CMGC cl09925 C
non-specific 133200 419 616 7.56E-19 cd05069 PTKc_Yes cl09925 C
non-specific 173669 413 644 8.28E-19 cd05578 STKc_Yank1 cl09925 -
non-specific 133221 419 616 8.46E-19 cd05090 PTKc_Ror1 cl09925 C
non-specific 173656 400 610 8.96E-19 cd05111 PTK_HER3 cl09925 C
non-specific 132971 414 608 1.98E-18 cd06640 STKc_MST4 cl09925 C
non-specific 173765 413 619 2.01E-18 cd08225 STKc_Nek5 cl09925 C
non-specific 133174 418 683 2.18E-18 cd05042 PTKc_Aatyk cl09925 -
non-specific 173753 408 612 2.59E-18 cd07864 STKc_CDK12 cl09925 C
non-specific 133240 399 616 3.05E-18 cd05109 PTKc_HER2 cl09925 C
non-specific 132972 414 608 3.13E-18 cd06641 STKc_MST3 cl09925 C
non-specific 133186 396 644 3.31E-18 cd05055 PTKc_PDGFR cl09925 -
non-specific 173671 412 609 4.07E-18 cd05580 STKc_PKA cl09925 C
non-specific 173654 414 610 4.44E-18 cd05108 PTKc_EGFR cl09925 C
non-specific 133168 418 608 4.68E-18 cd05036 PTKc_ALK_LTK cl09925 C
non-specific 173631 420 686 5.31E-18 cd05045 PTKc_RET cl09925 -
non-specific 132966 394 687 5.38E-18 cd06635 STKc_TAO1 cl09925 -
non-specific 132960 420 681 5.45E-18 cd06629 STKc_MAPKKK_Bck1_like cl09925 -
non-specific 133204 406 674 8.56E-18 cd05073 PTKc_Hck cl09925 -
non-specific 143338 412 610 8.65E-18 cd07833 STKc_CDKL cl09925 C
non-specific 132987 419 609 9.19E-18 cd06656 STKc_PAK3 cl09925 C
non-specific 132956 412 640 1.34E-17 cd06625 STKc_MEKK3_like cl09925 -
non-specific 143346 420 619 1.49E-17 cd07841 STKc_CDK7 cl09925 C
non-specific 132965 397 620 3.09E-17 cd06634 STKc_TAO2 cl09925 C
non-specific 132952 412 674 3.36E-17 cd06621 PKc_MAPKK_Pek1_like cl09925 -
non-specific 132979 413 609 3.64E-17 cd06648 STKc_PAK_II cl09925 C
non-specific 173642 418 686 3.67E-17 cd05075 PTKc_Axl cl09925 -
non-specific 173663 420 610 3.76E-17 cd05572 STKc_cGK_PKG cl09925 C
non-specific 173758 418 614 4.57E-17 cd08218 STKc_Nek1 cl09925 C
non-specific 173630 420 610 5.26E-17 cd05044 PTKc_c-ros cl09925 C
non-specific 133220 420 683 5.59E-17 cd05089 PTKc_Tie1 cl09925 -
non-specific 132964 394 679 7.89E-17 cd06633 STKc_TAO3 cl09925 -
non-specific 143371 410 612 8.89E-17 cd07866 STKc_BUR1 cl09925 C
non-specific 132986 419 609 9.12E-17 cd06655 STKc_PAK2 cl09925 C
non-specific 132985 419 609 9.33E-17 cd06654 STKc_PAK1 cl09925 C
non-specific 173732 420 612 1.09E-16 cd06628 STKc_MAPKKK_Byr2_like cl09925 C
non-specific 173739 419 612 1.27E-16 cd07838 STKc_CDK4_6_like cl09925 C
non-specific 133219 420 679 1.30E-16 cd05088 PTKc_Tie2 cl09925 -
non-specific 88330 420 683 1.42E-16 cd05047 PTKc_Tie cl09925 -
non-specific 132942 419 608 4.18E-16 cd06611 STKc_SLK_like cl09925 C
non-specific 173737 418 612 6.23E-16 cd07834 STKc_MAPK cl09925 C
non-specific 173723 412 610 7.19E-16 cd06605 PKc_MAPKK cl09925 C
non-specific 173734 418 610 9.74E-16 cd07830 STKc_MAK_like cl09925 C
non-specific 173651 452 610 1.09E-15 cd05095 PTKc_DDR2 cl09925 NC
non-specific 133205 414 687 1.10E-15 cd05074 PTKc_Tyro3 cl09925 -
non-specific 132990 414 619 1.67E-15 cd06659 STKc_PAK6 cl09925 C
non-specific 133209 420 608 1.81E-15 cd05078 PTK_Jak2_Jak3_rpt1 cl09925 C
non-specific 173743 420 674 1.84E-15 cd07846 STKc_CDKL2_3 cl09925 -
non-specific 173634 420 610 2.87E-15 cd05053 PTKc_FGFR cl09925 C
non-specific 173644 418 686 4.08E-15 cd05079 PTKc_Jak1_rpt2 cl09925 -
non-specific 132988 414 609 4.56E-15 cd06657 STKc_PAK4 cl09925 C
non-specific 133175 423 674 7.45E-15 cd05043 PTK_Ryk cl09925 -
non-specific 173742 413 612 9.60E-15 cd07845 STKc_CDK10 cl09925 C
non-specific 132975 419 608 1.66E-14 cd06644 STKc_STK10_LOK cl09925 C
non-specific 173762 418 608 2.14E-14 cd08222 STKc_Nek11 cl09925 C
non-specific 133227 452 609 2.15E-14 cd05096 PTKc_DDR1 cl09925 NC
non-specific 173702 418 610 2.46E-14 cd05611 STKc_Rim15_like cl09925 C
non-specific 173647 419 685 3.30E-14 cd05091 PTKc_Ror2 cl09925 -
non-specific 132976 413 683 5.03E-14 cd06645 STKc_MAP4K3 cl09925 -
non-specific 132967 414 608 5.31E-14 cd06636 STKc_MAP4K4_6 cl09925 C
non-specific 132989 414 609 6.58E-14 cd06658 STKc_PAK5 cl09925 C
non-specific 173703 413 619 6.70E-14 cd05612 STKc_PRKX_like cl09925 C
non-specific 173754 412 611 9.35E-14 cd07865 STKc_CDK9 cl09925 C
non-specific 132974 419 608 1.24E-13 cd06643 STKc_SLK cl09925 C
non-specific 132961 420 679 1.31E-13 cd06630 STKc_MEKK1 cl09925 -
non-specific 132951 418 660 1.41E-13 cd06620 PKc_MAPKK_Byr1_like cl09925 C
non-specific 132984 413 640 1.45E-13 cd06653 STKc_MEKK3_like_1 cl09925 -
non-specific 143368 419 623 1.80E-13 cd07863 STKc_CDK4 cl09925 C
non-specific 173751 413 619 1.98E-13 cd07860 STKc_CDK2_3 cl09925 C
non-specific 173738 420 619 2.16E-13 cd07835 STKc_CDK1_like cl09925 C
non-specific 132968 414 608 2.45E-13 cd06637 STKc_TNIK cl09925 C
non-specific 143356 402 612 3.52E-13 cd07851 STKc_p38 cl09925 C
non-specific 173627 418 674 3.91E-13 cd05037 PTK_Jak_rpt1 cl09925 -
non-specific 132980 408 645 4.50E-13 cd06649 PKc_MEK2 cl09925 C
non-specific 133195 418 640 6.14E-13 cd05064 PTKc_EphR_A10 cl09925 -
non-specific 133229 418 693 6.22E-13 cd05098 PTKc_FGFR1 cl09925 -
non-specific 173635 420 683 6.23E-13 cd05054 PTKc_VEGFR cl09925 -
non-specific 132977 412 608 6.65E-13 cd06646 STKc_MAP4K5 cl09925 C
non-specific 173673 420 665 6.84E-13 cd05582 STKc_RSK_N cl09925 C
non-specific 132982 458 640 8.77E-13 cd06651 STKc_MEKK3 cl09925 -
non-specific 173752 419 619 9.43E-13 cd07861 STKc_CDK1_euk cl09925 C
non-specific 132983 413 640 1.24E-12 cd06652 STKc_MEKK2 cl09925 -
non-specific 173691 412 610 1.24E-12 cd05600 STKc_Sid2p_Dbf2p cl09925 C
non-specific 173700 412 622 1.30E-12 cd05609 STKc_MAST cl09925 C
non-specific 132970 405 608 1.36E-12 cd06639 STKc_myosinIIIB cl09925 C
non-specific 132946 413 630 1.40E-12 cd06615 PKc_MEK cl09925 C
non-specific 173744 420 610 2.13E-12 cd07847 STKc_CDKL1_4 cl09925 C
non-specific 143344 413 608 4.91E-12 cd07839 STKc_CDK5 cl09925 C
non-specific 132947 419 612 7.59E-12 cd06616 PKc_MKK4 cl09925 C
non-specific 133232 418 610 8.18E-12 cd05101 PTKc_FGFR2 cl09925 C
non-specific 143367 419 612 8.27E-12 cd07862 STKc_CDK6 cl09925 C
non-specific 173741 423 612 8.57E-12 cd07843 STKc_CDC2L1 cl09925 C
non-specific 173681 418 609 1.61E-11 cd05590 STKc_nPKC_eta cl09925 C
non-specific 173643 420 675 1.64E-11 cd05077 PTK_Jak1_rpt1 cl09925 -
non-specific 173763 418 674 2.08E-11 cd08223 STKc_Nek4 cl09925 -
non-specific 173704 413 683 2.54E-11 cd05613 STKc_MSK1_N cl09925 -
non-specific 173740 414 625 2.56E-11 cd07842 STKc_CDK8_like cl09925 C
non-specific 173687 406 619 3.23E-11 cd05596 STKc_ROCK cl09925 C
non-specific 132950 420 608 4.24E-11 cd06619 PKc_MKK5 cl09925 C
non-specific 173695 420 621 4.29E-11 cd05604 STKc_SGK3 cl09925 C
non-specific 133230 418 610 4.52E-11 cd05099 PTKc_FGFR4 cl09925 C
non-specific 173646 418 608 4.75E-11 cd05087 PTKc_Aatyk1_Aatyk3 cl09925 C
non-specific 173747 414 641 5.12E-11 cd07852 STKc_MAPK15 cl09925 C
non-specific 173652 418 610 5.63E-11 cd05100 PTKc_FGFR3 cl09925 C
non-specific 132969 420 608 6.70E-11 cd06638 STKc_myosinIIIA cl09925 C
non-specific 173666 420 621 8.56E-11 cd05575 STKc_SGK cl09925 C
non-specific 173748 418 613 1.31E-10 cd07853 STKc_NLK cl09925 C
non-specific 132953 419 608 1.38E-10 cd06622 PKc_MAPKK_PBS2_like cl09925 C
non-specific 173664 412 609 1.55E-10 cd05573 STKc_ROCK_NDR_like cl09925 C
non-specific 173694 420 617 2.07E-10 cd05603 STKc_SGK2 cl09925 C
non-specific 173750 413 612 2.13E-10 cd07857 STKc_MPK1 cl09925 C
non-specific 173729 418 681 2.74E-10 cd06617 PKc_MKK3_6 cl09925 -
non-specific 173756 415 608 3.08E-10 cd08216 PK_STRAD cl09925 C
non-specific 132949 412 610 3.59E-10 cd06618 PKc_MKK7 cl09925 C
non-specific 173712 406 619 4.34E-10 cd05622 STKc_ROCK1 cl09925 C
non-specific 173711 407 619 4.48E-10 cd05621 STKc_ROCK2 cl09925 C
non-specific 132981 408 622 4.67E-10 cd06650 PKc_MEK1 cl09925 C
non-specific 133233 418 683 4.75E-10 cd05102 PTKc_VEGFR3 cl09925 -
non-specific 173759 457 619 4.84E-10 cd08219 STKc_Nek3 cl09925 C
non-specific 173662 420 621 4.96E-10 cd05571 STKc_PKB cl09925 C
non-specific 133234 418 683 5.60E-10 cd05103 PTKc_VEGFR2 cl09925 -
non-specific 173661 418 609 6.92E-10 cd05570 STKc_PKC cl09925 C
non-specific 173676 420 622 9.80E-10 cd05585 STKc_YPK1_like cl09925 C
non-specific 173674 413 684 1.01E-09 cd05583 STKc_MSK_N cl09925 -
non-specific 133217 418 618 1.04E-09 cd05086 PTKc_Aatyk2 cl09925 C
non-specific 143354 413 612 1.10E-09 cd07849 STKc_ERK1_2_like cl09925 C
non-specific 173677 420 622 1.16E-09 cd05586 STKc_Sck1_like cl09925 C
non-specific 143363 420 612 1.34E-09 cd07858 STKc_TEY_MAPK_plant cl09925 C
non-specific 88519 418 609 3.16E-09 cd05618 STKc_aPKC_iota cl09925 C
non-specific 173705 413 666 4.89E-09 cd05614 STKc_MSK2_N cl09925 C
non-specific 173693 420 622 5.23E-09 cd05602 STKc_SGK1 cl09925 C
non-specific 143341 413 610 6.42E-09 cd07836 STKc_Pho85 cl09925 C
non-specific 173684 485 622 7.73E-09 cd05593 STKc_PKB_gamma cl09925 NC
non-specific 173686 485 621 8.16E-09 cd05595 STKc_PKB_beta cl09925 NC
non-specific 143379 414 613 8.68E-09 cd07874 STKc_JNK3 cl09925 C
non-specific 173749 418 612 9.45E-09 cd07855 STKc_ERK5 cl09925 C
non-specific 173746 418 609 1.13E-08 cd07850 STKc_JNK cl09925 C
non-specific 173685 485 660 1.41E-08 cd05594 STKc_PKB_alpha cl09925 NC
non-specific 143381 418 609 1.44E-08 cd07876 STKc_JNK2 cl09925 C
non-specific 143384 402 612 1.74E-08 cd07879 STKc_p38delta_MAPK13 cl09925 C
non-specific 173692 412 609 1.82E-08 cd05601 STKc_CRIK cl09925 C
non-specific 173682 420 622 3.62E-08 cd05591 STKc_nPKC_epsilon cl09925 C
non-specific 173679 418 609 4.65E-08 cd05588 STKc_aPKC cl09925 C
non-specific 173708 418 609 8.13E-08 cd05617 STKc_aPKC_zeta cl09925 C
non-specific 88524 413 622 9.09E-08 cd05623 STKc_MRCK_alpha cl09925 C
non-specific 173710 420 622 1.14E-07 cd05620 STKc_nPKC_delta cl09925 C
non-specific 143380 414 613 1.21E-07 cd07875 STKc_JNK1 cl09925 C
non-specific 133207 455 674 1.56E-07 cd05076 PTK_Tyk2_rpt1 cl09925 N
non-specific 173735 420 610 1.66E-07 cd07831 STKc_MOK cl09925 C
non-specific 143374 412 609 2.01E-07 cd07869 STKc_PFTAIRE1 cl09925 C
non-specific 173713 412 622 2.23E-07 cd05624 STKc_MRCK_beta cl09925 C
non-specific 173683 420 622 2.92E-07 cd05592 STKc_nPKC_theta_delta cl09925 C
non-specific 173690 412 622 3.44E-07 cd05599 STKc_NDR_like cl09925 C
non-specific 143361 411 612 3.51E-07 cd07856 STKc_Sty1_Hog1 cl09925 C
non-specific 173745 412 608 3.61E-07 cd07848 STKc_CDKL5 cl09925 C
non-specific 133237 508 680 4.48E-07 cd05106 PTKc_CSF-1R cl09925 N
non-specific 173709 420 622 5.39E-07 cd05619 STKc_nPKC_theta cl09925 C
non-specific 173701 422 575 5.70E-07 cd05610 STKc_MASTL cl09925 C
non-specific 173680 420 622 8.89E-07 cd05589 STKc_PKN cl09925 C
non-specific 173665 414 609 1.14E-06 cd05574 STKc_phototropin_like cl09925 C
non-specific 143342 412 619 1.44E-06 cd07837 STKc_CdkB_plant cl09925 C
non-specific 173688 412 622 1.46E-06 cd05597 STKc_DMPK_like cl09925 C
non-specific 173668 420 609 1.51E-06 cd05577 STKc_GRK cl09925 C
non-specific 173717 413 622 1.67E-06 cd05628 STKc_NDR1 cl09925 C
non-specific 173719 414 609 1.88E-06 cd05630 STKc_GRK6 cl09925 C
non-specific 173721 414 609 2.97E-06 cd05632 STKc_GRK5 cl09925 C
non-specific 173716 412 622 4.19E-06 cd05627 STKc_NDR2 cl09925 C
non-specific 143372 419 625 6.50E-06 cd07867 STKc_CDC2L6 cl09925 C
non-specific 143373 419 625 9.73E-06 cd07868 STKc_CDK8 cl09925 C
non-specific 143375 418 609 9.82E-06 cd07870 STKc_PFTAIRE2 cl09925 C
non-specific 133238 503 674 9.83E-06 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 143385 418 612 1.25E-05 cd07880 STKc_p38gamma_MAPK12 cl09925 C
non-specific 173675 485 610 1.25E-05 cd05584 STKc_p70S6K cl09925 NC
non-specific 173653 508 644 2.15E-05 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 143378 419 623 2.26E-05 cd07873 STKc_PCTAIRE1 cl09925 C
non-specific 143382 401 610 2.28E-05 cd07877 STKc_p38alpha_MAPK14 cl09925 C
non-specific 143349 420 562 2.48E-05 cd07844 STKc_PCTAIRE_like cl09925 C
non-specific 143383 402 612 2.72E-05 cd07878 STKc_p38beta_MAPK11 cl09925 C
non-specific 133235 507 610 2.95E-05 cd05104 PTKc_Kit cl09925 N
non-specific 143376 419 622 3.49E-05 cd07871 STKc_PCTAIRE3 cl09925 C
non-specific 173720 535 609 3.62E-05 cd05631 STKc_GRK4 cl09925 NC
non-specific 240159 482 565 4.43E-05 cd05120 APH_ChoK_like cl17270 N
superfamily 247824 482 565 4.43E-05 cl17270 APH_ChoK_like superfamily - N
non-specific 173678 420 609 6.92E-05 cd05587 STKc_cPKC cl09925 C
non-specific 173698 515 609 0.000106051 cd05607 STKc_GRK7 cl09925 NC
non-specific 173707 413 609 0.000166661 cd05616 STKc_cPKC_beta cl09925 C
non-specific 173696 517 609 0.000175124 cd05605 STKc_GRK4_like cl09925 NC
non-specific 173699 524 612 0.000201756 cd05608 STKc_GRK1 cl09925 NC
non-specific 214542 289 322 0.000328374 smart00179 EGF_CA cl09941 -
non-specific 173689 414 622 0.000374331 cd05598 STKc_LATS cl09925 C
non-specific 173706 413 609 0.000425562 cd05615 STKc_cPKC_alpha cl09925 C
non-specific 219496 289 319 0.000700542 pfam07645 EGF_CA cl09941 C
non-specific 214801 522 692 0.000755897 smart00750 KIND cl09925 -
non-specific 143377 419 608 0.000810872 cd07872 STKc_PCTAIRE2 cl09925 C
non-specific 237847 418 562 0.00128804 PRK14879 PRK14879 cl17178 C
superfamily 237847 418 562 0.00128804 cl17178 PRK14879 superfamily - C
non-specific 143364 420 612 0.00211359 cd07859 STKc_TDY_MAPK_plant cl09925 C
non-specific 173697 517 609 0.00286895 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173722 517 609 0.00290988 cd05633 STKc_GRK3 cl09925 NC
non-specific 173714 414 609 0.00573835 cd05625 STKc_LATS1 cl09925 C
non-specific 173718 412 578 0.00693269 cd05629 STKc_NDR_like_fungal cl09925 C
multi-dom 197581 417 683 4.28E-52 smart00219 TyrKc - -
multi-dom 214568 418 683 7.91E-52 smart00221 STYKc - -
multi-dom 219530 418 683 2.55E-51 pfam07714 Pkinase_Tyr - -
multi-dom 214567 418 612 1.19E-46 smart00220 S_TKc - C
multi-dom 215690 418 679 1.59E-41 pfam00069 Pkinase - -
multi-dom 223589 413 710 1.60E-35 COG0515 SPS1 - C
multi-dom 215061 420 691 3.70E-19 PLN00113 PLN00113 - N
multi-dom 165291 428 688 1.60E-16 PHA02988 PHA02988 - -
multi-dom 183880 414 610 3.23E-14 PRK13184 pknD - C
multi-dom 177557 413 618 5.90E-14 PHA03209 PHA03209 - C
multi-dom 234389 439 622 6.04E-14 TIGR03903 TOMM_kin_cyc - C
multi-dom 215036 405 607 8.02E-13 PLN00034 PLN00034 - NC
multi-dom 140289 413 619 2.10E-12 PTZ00263 PTZ00263 - C
multi-dom 177649 414 619 3.31E-11 PLN00009 PLN00009 - C
multi-dom 173616 413 609 4.13E-11 PTZ00426 PTZ00426 - C
multi-dom 240344 417 630 6.66E-11 PTZ00283 PTZ00283 - C
multi-dom 165473 458 635 2.70E-10 PHA03207 PHA03207 - NC
multi-dom 240233 420 612 4.72E-10 PTZ00024 PTZ00024 - C
multi-dom 223069 466 612 2.90E-08 PHA03390 pk1 - NC
multi-dom 173333 392 609 7.53E-08 PTZ00036 PTZ00036 - C
multi-dom 173502 408 674 4.17E-07 PTZ00266 PTZ00266 - C
multi-dom 140293 523 610 1.36E-06 PTZ00267 PTZ00267 - NC
multi-dom 165476 458 613 1.42E-06 PHA03210 PHA03210 - NC
multi-dom 165478 451 626 1.95E-06 PHA03212 PHA03212 - NC
multi-dom 234331 419 568 0.00120596 TIGR03724 arch_bud32 - C
multi-dom 236586 420 559 0.0017749 PRK09605 PRK09605 - N
multi-dom 223009 516 624 0.00222748 PHA03211 PHA03211 - N
multi-dom 226168 468 568 0.00803083 COG3642 COG3642 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific active site L420,G421,R422,G423,S424,V428,A440,K442,V471,Y487,E488,F489,I490,T494,F496,D539,K541,P543,N544,L546,D557,A560,G577,T578,L579,G580 26 26 173623
specific ATP binding site L420,G421,R422,G423,S424,V428,A440,K442,V471,Y487,E488,F489,I490,T494,D539,K541,P543,N544,L546,D557 20 20 173623
specific substrate binding site S424,T494,F496,D539,K541,P543,A560,G577,T578,L579,G580 11 11 173623
specific activation loop (A-loop) T556,D557,F558,G559,A560,S561,R562,G577,T578,L579,G580 11 11 173623
specific Ca2+ binding site D289,E292,N307 3 3 238011
 
DNA sequence
Upstream 1000 bp region from PH01004795G0030 gene.
CAGCAACAGAAGCATGGTTCACGCTTGAGTAATTAGGCAGCCACAGAATAAATTATTTTTTTGGATGCTGCTCAAGAGTGAAGAAACACACGCTGCTGTTCTACTACAGATGATATAGGCTAGTCATATGCTTATTTTTTTTTATTAGATTGGTATGATTATAGATGTCGTTACACCTAATCCTAACAGATGAACACAACAACTTTAGTGGTTAATGTCCTGGATGTACAATAATCCAATTTATGTTTGAAGTTGAGGAACTATTTATGATTTTTTTATTCATTGTACTGTCAAAAGCCTCGAGTGGCCATGGACAAGCTTCAAGTTATTATTTCATGAATTTGGTCTTACTAAAATTTATTTCTTGGAAGTTTTATGAATGTTATTTCTAGCTTGCTTTCTGAACGTTATTTTAGTCCAATCTATGTCTATGCATGGCAGAATAACGTACTACATGTATCGCAAGGTATGCGATCGTATATATTGTTGGCGACAAGCATGCCGCGGTAATGGTTGGTACCTATGTGCATGCTACAGGAGAGCCTCCTGCACAAAACTTATTTATGTTGGAAATTTTCTCTCCATAACAGATTCCTATGTTACACCCCAAACAACTTAATCTCATATTCCTAGTAATGCTCTAGGAATCTTAATCACCTGTACCAAACATAGGAATGTCATATTCCCTGCTATCTCATTCATATGGTTAGGACTTAGGATTACAGGGAATCATGAGATTCCCACCAATCTAGTTTTCTTGAAACCAAACGCACCCTCAAGGGTACAAACTAAATGCCTCTGTTTGCAACTGGTAATGTGCTCCTTTTCTTGTTTTGATTCCCTTGAAGCTCCTTTTAAATGCACCCAAGGCTGGAATTTTGATTTATCATGACTAGTTTGTTTTCATTTTCCCCTATCTTCTATCGCATATCATTATGTAGCCATCAACTGTTGGTGCAAAGAATCTCATATGACATATTATTACTGTAGAGTACTCTGGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCTGGAGTGTTACTATGGCTAATCTTTGCAGTCACCCTGCTGCTAGCAACCATCAAGATCGGCACGGCCTCCGGGATGGCAAAGCCTGGATGCAGAGAAACATGCGGCGGCCTCGATATTCCGTACCCCTTCGGCATCGGTCCTGGTTGCTACCACGGTGAAGGGTTTGAAGTTTCATGCGAGGATAACCATACTTTCATGCATAACAAAAGCAGCGGAATGGAGATCTACAACATTAGTCTGCTAGGAGGGCAGGCTCGAGTCAGCACCTTGATTGCCTCCAAGTGCAATTACAACACAGGTGGATGGGCCTCAGCATATACCGCTCGTTTGTTTACAATATCTAGCAAGGCGAACAAGTTAACAGCGGTTGGATGCAGCACACTTGCATTCCTGGGAGGCTATAACGAGCACAGGGCCGCAGCTGGATGTTTCTCAATGTGCCTGAACAAGCAAAGTGTGGACCATAGTGAGCAGTGCTCCGGCATGGGCTGTTGCCAGACATCCATCGCGCCAAACCTCACTTCCTTAAACATCACATTCGATGACAGGTATGACAATTCTGAGGTGCTTGACTTCAACCCATGCAGCTACGCCTTTGTAGCTGAGCAGGAATGGTTCAGGTTCAAGGCTTCTTATCTTGAGGGTAATAAGTTCACAGAGAAGTACAAGGATGGAGTCCCTACTGTGCTGGACTGGGTTGCTGGAAATGAATCCTGTTATGAAGCGGTGAAGAACGTGTCATCATATGCCTGCATTAGCAAGAATAGCCAGTGCTTCAAGTCACCAAATGCTACAGGGTATCTCTGCAGGTGCAATGATGGCTTTGCAGGCAACCCCTACCTGGAACAAGGGTGCCAAGATATCAACGAGTGCCAATTTCCCGGTCGGTATCCTTGCCATGGAATCTGCGGAAATACAATTGGGGACTACGATTGTACCTGCGCATCTGGGACTCACAGTATAGATCCAAAGAGAGAAACCTGCGATCCAATTGCGGCTTCAGAAAGAGCTAAACTAACAAAAATGTTTATAGGTATATTGGCATGTGCTATGCTTCTCCTTATCTGCATTTTTGCGCTACTGATTGAATGTCAGAAGAGAAAGCTGGTGAAAGAAAAGGAGATATTCTTCCAACAAAATGGGGGCCTGCTGTTATATGAGGAAATCAGGTCAAAGCAAGTAGATACAGTGAGAATATTCACGACAGAGGAACTAGAGAAGGCGACAAACAATTTTGACTCAAGCAGAGAACTAGGAAGAGGCAGCCATGGAACTGTTTACAAGGGAATTCTCAAAGACAACAGAGTAGTAGCTATAAAGCGCTCAAAGATTATGAACATGGTCCAGAAAAATGAATTTGTGCAAGAGATTATTATACTTTCACAGATCAACCACAGGAATGTGGTAAGGCTTCTAGGTTGTTGCTTAGAAGTGGAAGTTCCCATGTTGGTCTACGAATTCATCCCAAACGGCACTCTGTTCGAGCTAATACATGGTAAAAACAGAAGGTCGTCCATTTCATTGGATGCTCGTCTCAGGATAGCTCAGGAATCTGCAGAAGCATTAGCATATCTGCACTCATCAGCATCCCCTCCCATAGTTCATGGAGATGTAAAATCTCCAAACATTCTCCTAGGCGATAACTACACAGCAAAAGTGACTGACTTTGGAGCATCAAGAATGCTTCCCAAGGATGAAATACAATTTATGACAATAGTGCAGGGAACTCTAGGTTATCTGGACCCTGAATACCTACAAGAGCGTCAACTAACAGAGAAGAGTGATGTTTATAGTTTTGGAGTTGTGCTTCTAGAGCTAATTACGAGGAAGATGGCAATTTATTCTGACAGTGCTGAAGAAAAGAAAAGCCTTGCATCATCCTTCCTTTTAGCAATGAAAGAGAACAGCCCTCAGTCCATCATGGACAGGAATATATTGGGTGTGGGAACGGAGCTGCTCCAAGAAATTGCTCAACTGGCAAAGCATTGCTTGAGTATGAAGGGGGAAGAACGGCCATTAATGACCGAAGTCGCTGAGAGGTTGAAAACAATACGAAGCACCTGGCGAGAACAATTGATTGCGAATGCTAGTGAAGATACTGAATGTTTGCTTGAAAACTCATCGCACTATGACCCTTCTAGCACTGGGCGGCATGGAAGTCTGATGGCGCTAGATTTAGAAATTGGCAGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01004795G0030 gene.
GCTAAACATCTCTCTAAACACCTGCATTTTATATGCTCTTACTACGTCAACGTATTCCGTCTGGTCTAACTTGATGCGCGCGCGTGTGTTTTCACTGCATCTTTAGAAATAAACTTTATGAGGTAGACATTGATTCCCTTCCGTGATGCCGATTGGCAGGCGAGCACGTACGTACAAATGAAGTTTGGGAGGCTCCACACGGTCTTGGTTGCCTTGCAAACAGCAAAAGCAACCGGGGTAGAGTTGAGAGCACAAGGAGGATCACGTGAATCAAGTGCTTCGTTATGGTATTATTACTGCATACTCCGAGTATTGAAGAGTGGAGATAAAACACTAGCCACTAGCCAATGCTGATTAAGCTTGCTCTTGTGTCGCGGCTGTACAGAAGAGGTGCATTAGGTCTTATCCAGACCGTCCAATCACACTTAGATCAATAGCATGCAATATCAATGCTACAGTGATAAAAAACAGTAAAATCAGTACAGTATTCTAAACCGCCATTGCTTTTTTAACAGTATTTCGGTACGTTGTTGCTAAGAGTGCTATAGCTTAAAAAGTGTTACTACTGTAGAGTGTTATAACAACAGACTCGGATTATTGTTGCTACAGTGCGTCTGCGCAGCAGGGGAGTTTGCTATGCTCGGATTATTGTTGCTACAGTGCGTCTGGTCAGCGGAGGGTGACTGGCCCGAGAAGAGAAGGGACTCGGTGATGGGGTGAACGAAGACTGGTGGATGTGATGTATCGTGAATAGCTGCTGCAACTGCGATTGGGTCAAGTCGTGATGATGTGATGCCCGTCCGCGTTGATGGCAGAGAAAGACAAGTGACTAGTAATTGCGAATTGGTCGCCATTTACGACGCTTGGAATCTTAGCAACTGTAGGTGACCCTGATAGCCATTTGTCGGTAGCTGTTACAACGTACCTATATATATGTGAGGATGGTATATATGTGAGGATGGTGATACTCCGAGACAATCCGCGTTGAAATAGTGTGAAGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01004795 Download
Protein sequence
Protein sequence
MAGVLLWLIFAVTLLLATIKIGTASGMAKPGCRETCGGLDIPYPFGIGPGCYHGEGFEVSCEDNHTFMHNKSSGMEIYNISLLGGQARVSTLIASKCNYNTGGWASAYTARLFTISSKANKLTAVGCSTLAFLGGYNEHRAAAGCFSMCLNKQSVDHSEQCSGMGCCQTSIAPNLTSLNITFDDRYDNSEVLDFNPCSYAFVAEQEWFRFKASYLEGNKFTEKYKDGVPTVLDWVAGNESCYEAVKNVSSYACISKNSQCFKSPNATGYLCRCNDGFAGNPYLEQGCQDINECQFPGRYPCHGICGNTIGDYDCTCASGTHSIDPKRETCDPIAASERAKLTKMFIGILACAMLLLICIFALLIECQKRKLVKEKEIFFQQNGGLLLYEEIRSKQVDTVRIFTTEELEKATNNFDSSRELGRGSHGTVYKGILKDNRVVAIKRSKIMNMVQKNEFVQEIIILSQINHRNVVRLLGCCLEVEVPMLVYEFIPNGTLFELIHGKNRRSSISLDARLRIAQESAEALAYLHSSASPPIVHGDVKSPNILLGDNYTAKVTDFGASRMLPKDEIQFMTIVQGTLGYLDPEYLQERQLTEKSDVYSFGVVLLELITRKMAIYSDSAEEKKSLASSFLLAMKENSPQSIMDRNILGVGTELLQEIAQLAKHCLSMKGEERPLMTEVAERLKTIRSTWREQLIANASEDTECLLENSSHYDPSSTGRHGSLMALDLEIGR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above