gene PH01003320G0120
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003320:81870 - 94724(- stand)   Name
Alternate name Locus tag PH01003320G0120
Length of gene 12855  bp Length of CDS 1917  bp
Product information
Feature type
CDS
Product name
ATBET9
Alternate name
Molecular weight
(predicted)
70803.8754200002  kDa
Isoeletric point
(predicted)
5.26247024536132
Length
638  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH02SNP00021780 PH01003320:88643 T T->C
PH02SNP00021790 PH01003320:88644 T T->G
PH02SNP00021800 PH01003320:88755 A A->C
PH02SNP00057630 PH01003320:88643 T T->C
PH02SNP00057640 PH01003320:88644 T T->G
PH02SNP00057650 PH01003320:88755 A A->C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_126719 13
Please click OG5_126719 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os08g03360.1 ATBET9, putative, expressed 4E-80
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 638
Detailed signature matches
    1. PR00503 (BROMODOMAIN)
    2. SM00297 (BROMO)
    3. SSF47370 (Bromodomain)
    4. PS50014 (BROMODOMAIN_2)
    5. PF00439 (Bromodomain)
    1. PS51525 (NET)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 99938 51 149 2.52E-54 cd05506 Bromo_plant1 cl02556 -
superfamily 243084 51 149 2.52E-54 cl02556 Bromodomain superfamily - -
non-specific 99930 52 149 2.35E-36 cd05498 Bromo_Brdt_II_like cl02556 -
non-specific 99931 52 149 1.55E-30 cd05499 Bromo_BDF1_2_II cl02556 -
non-specific 99922 53 149 1.67E-30 cd04369 Bromodomain cl02556 -
non-specific 197636 50 150 2.54E-29 smart00297 BROMO cl02556 -
non-specific 99932 53 146 2.60E-29 cd05500 Bromo_BDF1_2_I cl02556 -
non-specific 99941 51 154 5.12E-27 cd05509 Bromo_gcn5_like cl02556 -
non-specific 99927 58 148 5.51E-24 cd05495 Bromo_cbp_like cl02556 -
non-specific 99929 58 148 1.71E-23 cd05497 Bromo_Brdt_I_like cl02556 -
non-specific 215921 55 140 8.48E-22 pfam00439 Bromodomain cl02556 -
non-specific 99928 53 152 1.08E-21 cd05496 Bromo_WDR9_II cl02556 -
non-specific 99935 55 149 5.66E-21 cd05503 Bromo_BAZ2A_B_like cl02556 -
non-specific 99936 55 150 1.21E-20 cd05504 Bromo_Acf1_like cl02556 -
non-specific 99934 52 148 5.73E-20 cd05502 Bromo_tif1_like cl02556 -
non-specific 99942 50 128 1.08E-16 cd05510 Bromo_SPT7_like cl02556 C
non-specific 99943 67 141 5.54E-16 cd05511 Bromo_TFIID cl02556 C
non-specific 99957 58 129 2.75E-14 cd05528 Bromo_AAA cl02556 C
non-specific 99937 52 140 9.31E-14 cd05505 Bromo_WSTF_like cl02556 -
non-specific 99944 71 128 4.88E-12 cd05512 Bromo_brd1_like cl02556 NC
non-specific 99946 83 143 2.73E-11 cd05515 Bromo_polybromo_V cl02556 N
non-specific 99940 54 143 2.76E-11 cd05508 Bromo_RACK7 cl02556 -
non-specific 99945 50 141 9.67E-11 cd05513 Bromo_brd7_like cl02556 -
non-specific 99939 58 139 2.28E-10 cd05507 Bromo_brd8_like cl02556 -
non-specific 99951 83 143 2.36E-10 cd05520 Bromo_polybromo_III cl02556 N
non-specific 99954 83 127 1.65E-09 cd05524 Bromo_polybromo_I cl02556 NC
non-specific 99958 69 142 3.63E-09 cd05529 Bromo_WDR9_I_like cl02556 N
non-specific 99948 79 148 1.18E-08 cd05517 Bromo_polybromo_II cl02556 N
non-specific 99950 83 146 1.20E-08 cd05519 Bromo_SNF2 cl02556 N
non-specific 99947 82 147 2.23E-08 cd05516 Bromo_SNF2L2 cl02556 N
non-specific 99949 83 143 2.34E-08 cd05518 Bromo_polybromo_IV cl02556 N
non-specific 99955 79 128 2.69E-08 cd05525 Bromo_ASH1 cl02556 NC
non-specific 99933 82 146 4.96E-08 cd05501 Bromo_SP100C_like cl02556 N
non-specific 99926 47 100 2.04E-07 cd05494 Bromodomain_1 cl02556 C
non-specific 99952 83 128 6.26E-07 cd05521 Bromo_Rsc1_2_I cl02556 NC
non-specific 99953 83 128 1.06E-06 cd05522 Bromo_Rsc1_2_II cl02556 NC
non-specific 99923 91 126 0.000263937 cd05491 Bromo_TBP7_like cl02556 N
non-specific 99924 79 143 0.00223871 cd05492 Bromo_ZMYND11 cl02556 N
multi-dom 227408 70 157 7.35E-15 COG5076 COG5076 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative acetyllysine binding site V75,I82,Y85,A124,N128,V134 6 6 99938
 
DNA sequence
Upstream 1000 bp region from PH01003320G0120 gene.
ATTACAGGCAGCAATGTGTGTAACTTGAGAGCTGATCAGAATCAATATCTTGTTTGTGCCAGCTTCCCTGCGTCATGTGGCTCGCAATCTACAAGCCGAAAAGATTCAGCCTCTCATGGTGCACCAACTGGGTAAGAAGAAGTTGCAAGCCTTTTCTCCTTCTTCCTGACTATCTGCAAGCAGACGTCTCTGCTTGATCTTTCATCCTAATTTTCTTTGTGTTTCCATCCTCTTCAGATCTGCATCATTCTTGGAGTACTGCTGATGATCCTGTCGCCCATCGGAGGACTCCGGCAGATCATCATGGACGCCAAGACATACAAATTCTACTCGTAGACGACTACCACTCATCATCGTCGTGTGGCTCGTGAACATGCAAGAAAATCAGTTACAGCGTCTACTACGATTTTTTTTGTCGTGCCAAAGGATAGAAAGATCACAGCAGCACAGCTTGTTATAGATGATGGGTTAATTGAACCAAATTGGTTTGTGTTGGGTGTTAGTCATACCATATATGTACGTATTTTTTCAACTATATTGTTGTAGTGTGCAGAAAAGAGAGTGGTTGTTTCTATACTTATCAATTCCATTTCAGTACNNNNNNNNNNGTGCAGAAAAGAGAGTGGTTGTTTCTATACTTATCAATTCCATTTCAGTACCGGCCAGAATGGCCGAAATCTTATACCAACCTCAATACTGATCAATACCGGTCATTCCAATTCATTCTGCTACTGAGCAAAATTGAAGTGAACACTCATTTGAATCAGTTCTAAAGGCTCAGTCCAATACTACTCCTTCGATAATTGAAATTATACTAAACTAGTATGCTGGACGATGGTAAAATATATGAAATTATGAACTCATACTGTATTATTTAACTACGTACGACCTTTGTAGTTATGAAGTTATTCAACTATGTATCATTTTTATTCTATGGTTATGCATTTGAAGTGAGATTCTAAGTGAAATTATGTGTATATATAATTAAATATATATACATA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAATGGTGGGGCTGCGTTGGCCCCCAGAAGTGATGTTGTCGCCAAGAAAAAGGACGGGAAGCTCAAGCGGAGTAATTCAGTGCAGTCTGGCAGAGGAATGCCGCCATCAATGCCCCCACCTGTGGTCAGCTCTACTAACTATGCAGCATTGTTTAAACAATGTGGCAACGTTCTGAAGTTTCTTATGACAAATCTCAATTCAGGCCCGTTTCTTTCCCCAGTTGATGTTGTAAAGTTGAACATCCCTGATTATTTTGAAATAATCAAGCACCCAATGGATTTGGGTACCATCCAGAAAAAGTTGAATGCAGGCATGTACTCTACACCTCGGGAGTTTGCTGCAGATGTGAGGCTTACTTTTAGCAATGCTATGACTTATAACCCAGTCAATAATGCTGTTCACCTAATGGCCAAAACTTTGAGCAAGGGTTTTGAATCTAGATGGAGGGTTATCGAAAAGAAGCTTCCTTGGCCAGAGGAGAAGCCCTCTGTGAGAGAGCCCTCAAAAAAAGGTGCAATTAAGAAAGACATCATTGAGAAAGAAGATCCTTCAGAGAAAAAGCCCTCAAAGAAAGGTGCAATTAAGAAAGACATCATTGAGAAAGAAGACCCTTCAGAGAAAAAGCCCTCAAAGAAAGTTGCACATAAGAAAGACATCTTTGAGAAAGAGGATGTTGTGGGCAAGCCAGTTTTGCAACGGAAGAAGAGAAAAGCCTCTCCTTTGGTTCAGGATGCTCCAGTAGCGCCAGTAGTACATACTGCTATGGTGGTTGAGGATGCTCCAGTGGTGCAGACTGCTACGGAGATGATGACGGACGAGCAAAAGGTTGATCTAAGCGTAAGACTACAGTCATATGGTGGATTGCTTCCAGATCATGTAGTTGAGTTCATAAGGAGTCACGTGTCTGATGATAACGAGGCCGATGAAGATGAGTTAGAGCTTGATATGAATGCTCTCACTGATGATACACTATTTGAATTACAGAAGCTTCTTGATGACTATGATAGGGTAAATAAGTCAGGAAACCCTACAAAACATGAGCCTCGTGAGGTTGAGTTCCAAAGTGAATATCGGCTCATCAACTCATCAGTGCATGATGAAGAAGTTGTTCCATTGAGAAAATGTGATAGTGCTAACCATGTTAGAAAAGATTCAGATTCAAGTAGCTCTTCCGAAAGTGATTTGGATGTCAAAGTTCCTCCACCAAACAGCAGGGCCAAGGAGAACACACTATCTGTGGTTAGCTTGGATCTGGAAAATGATTCATTGAGCACTTTGAATCTACCAGAACAAAATACTGGTCCTGTACCTATTTCTGCCGACGATGAGGGGGAGCATGCCCCTGACAAACAGGTCTCCCCTGGAAAGCAATACCGAGCCGCCCTTTTATTAGGCCGCTTTGCTGATACAATTCTTAAGGCTCGTGAGAAGGCTCTTGATCAGGTTGCAAAAAAGGATCCTGAGAAAGTTCGCCGCGAGAGGGAGGAGCTTGAAAGGTTACAAAGAGGAGAGAGAGCTCGGTTACAAGCTGAGGCTAAAGCTGCTGAGGATGTTCGCAAGAGGGCTGAAGCAGCTGCTACTGCTGAGGCTGCTGCGGAAGCTAAACGCCAAAGAGAACTTGAGAGAGAAGCGGCTCGTAAAGCCTTGCAACAGATGGAGAAAACCGTAGAAATCAATGAAGGTAGCCTCTTTTTGAAAGATCTTGAAATGCTCGGAACGGTCACAAGTGAACAGCTTCCCAGCTCGGTTGGTGAAACGAGTCCAACTCATACGCCTGAGGCTCTCGGGTTTCAACTGGGAAGCAACCCCCTGGAACAGCTTGGATTGTATATGAAAAATGACGATGAAGAGGATGAGGAAGGTGGGTCCGCAGATGAACCAACAGTTGATGTTGAGGAGGGCGAAATAGATTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003320G0120 gene.
GATGTGATGCTTCCTTGTCCAATTTTATGCTTTTGTTAGTGCAATTTTGATGCGTGATTGTATCACGATGAATTATTTTGATGAGAGTTATGCATTGTATTTTTCTTGTCTGAGAACCGGGAGGAACACCTCGAGCTTGGCTCGCGAGCCCGTTCGAGCCAGCTTGAGCTCAGTTCCGAGCCGAGCCAAGCCTCTCTCCCAGCTCGTCACCGAAACGAGCCGAACCGAGCTCACTGTTCATCCGAGCCCGAACGAGCCTAGCTTGGCTCGTTTCTACCCCTAGCCACTGTGGCGAACTTTGTTTTGTTTCATTGCAATATGGCGGAGAAGATGTATCATGTCTTGTAGGCCAAGACTTACTCCAGGCGCAGACCACGGGAGCCTCCAACCGGCAACAGCTTGACCGAGACGGATTGTAATATCGAAGCAATCCTAGACATATTAGTTTCTAAAGTTAGAAGTTTCTTACATGGTTATTAAGGCGGTAAGGTGACGCGAGGCGACGCCTTACATCATCCTAAGGCGCTACGGGCGGAGGAAAATCTGGAGCAACCGAGCAGTGTGGAAAAAGAGCAGAAGAAAAGAAGAAGAGAAAGCAAAAAAGAAAAAGAAAAAGACTAACCTGGCCAGTCCAGCAGCCCATCAGGCCCAACCGTCCAAGCTGTGCCTGTGACCGTGAGGACTTCTCAGTCTCAACCCTCAACCCTGCCTCCTCTCCTCTTCTCCTCTCTTTCCCGCCGCCGCCTCAACCCTGCCTCCTCTCCTGTCCTCTTCCCCTCTCTTCCCTACCCTTGTCCTCTCCCGTCCTCTTCCCCTTCCCTACCCTCATCATCTCCCGTCCTCTTCCCCTTCCCCTTCCCTACCCCAACAGCGCAGATCCGGAGCAACCGAGCGAGCTCTGGGCGGAGGAAGACACCCACGGGCGGCAGAGTACCCGGCGGCACAGATCCGGAGACAAAACGACACCCACAGGCGGCGGAGTACCCCGGCGGCGTAGATCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003320 Download
Protein sequence
Protein sequence
MNGGAALAPRSDVVAKKKDGKLKRSNSVQSGRGMPPSMPPPVVSSTNYAALFKQCGNVLKFLMTNLNSGPFLSPVDVVKLNIPDYFEIIKHPMDLGTIQKKLNAGMYSTPREFAADVRLTFSNAMTYNPVNNAVHLMAKTLSKGFESRWRVIEKKLPWPEEKPSVREPSKKGAIKKDIIEKEDPSEKKPSKKGAIKKDIIEKEDPSEKKPSKKVAHKKDIFEKEDVVGKPVLQRKKRKASPLVQDAPVAPVVHTAMVVEDAPVVQTATEMMTDEQKVDLSVRLQSYGGLLPDHVVEFIRSHVSDDNEADEDELELDMNALTDDTLFELQKLLDDYDRVNKSGNPTKHEPREVEFQSEYRLINSSVHDEEVVPLRKCDSANHVRKDSDSSSSSESDLDVKVPPPNSRAKENTLSVVSLDLENDSLSTLNLPEQNTGPVPISADDEGEHAPDKQVSPGKQYRAALLLGRFADTILKAREKALDQVAKKDPEKVRREREELERLQRGERARLQAEAKAAEDVRKRAEAAATAEAAAEAKRQRELEREAARKALQQMEKTVEINEGSLFLKDLEMLGTVTSEQLPSSVGETSPTHTPEALGFQLGSNPLEQLGLYMKNDDEEDEEGGSADEPTVDVEEGEID
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above