gene PH01003187G0090
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003187:56147 - 61507(+ stand)   Name
Alternate name Locus tag PH01003187G0090
Length of gene 5361  bp Length of CDS 2043  bp
Product information
Feature type
CDS
Product name
expressed_protein
Alternate name
Molecular weight
(predicted)
73441.9072200001  kDa
Isoeletric point
(predicted)
8.6362190246582
Length
680  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_169962 3
Please click OG5_169962 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os07g44320.1 expressed protein 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 600 680
Detailed signature matches
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 199896 8 151 2.40E-63 cd10910 limkain_b1_N_like cl10034 -
superfamily 245240 8 151 2.40E-63 cl10034 LabA_like/DUF88 superfamily - -
non-specific 216797 8 147 6.08E-30 pfam01936 NYN cl10034 -
non-specific 199895 50 143 1.84E-06 cd06167 LabA_like cl10034 N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative metal binding site D14,N17,D84,S108,D110,D112 6 6 199896
 
DNA sequence
Upstream 1000 bp region from PH01003187G0090 gene.
GCAAATCATGTGCAAGTGCAACATATCAAAAATTTCATAATCCAAACAAACATTAGGAAAAAATACACGTTAAAAAAATCTTGTAACATCACCGTAAACCAGTTTGCGATATTTTTTTTGGACAGTCGCAACATTTTTTTTCAACAAAGCATAACATTTTTTTCAATGGATCACAACATCTTAAAGAATAGTATACAACATTTTTTTCAACGGGCCGCAACATCTCAAAGAACAGTATGCAATATTTTTGTCAACGCGTCGTAAATTTTTTTTCGACGGGCCGCAACATCAGAACAATTCACAAGTTTGCAAACAAAAATCAGAAGAAAAGGAAGGGGAAATGGGATCAAGCGGAGCCAGTGGAAGGTACATGAAGCTCATCTTGCAACACTCCTTTCGCTTCTCTTGACGTCGGAAATTTGGAACCCCACCGGCGTGGAGCAGCGAAGCCCCAGTCAGATCGAACCAGCGAGATGGAGGGAACGCAAGCCGAAGCAGGAGGACGGTGGAGGCCAGCGCCGCTGTGGACGTCTCTGGTCGGAGCAGGCAACGACAGTGGAGGATGACAGAGAGGTAACCAGCCAGCCTCTGCTTCCTACTTCCTGCCGAATTTTTGGCTTTCCCCTTTGTTTAGTAGTTCTTGAGTTGGATACGAAGGAGAGTGAGATAAGTGAAAGAGGAATAGGGAAGGAGGTAGACTCTGGAGGAGAAAATACCGGTGGGTGGATGTGTTCATTCAAAGGAGGTAAGTTCGATACGTCGAACGCCCGAACAGTAGTATTTCCCGTAGAATATATATATATACACGCCTACTGCCCTTCCTAAATCAACCTTCTTAACCAAATAGCAAAAAAAAAAAACGAAAGGAAACTACCGTGCCCTTGTCCCTTGTCCCTTGATCACTTCCCTCCACTTGCAGCAAACTTGTACAAAAAAAAGTTTTAAACAAAAAATAACGTCCTCGCGAGTCGACCTCGACGACGCCGCCGTCGTCGTCTCAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGGGAGTACGCGGCGGCGAAGACGTCGGTGTGGTGGGACATCGAGAACTGCATGGTCCCCCGCAGCTGCGACCCCCACCTCATCGCCCAGAACATGAGCTCCGCCCTCGCCACCGCCGGCTACACCGGCCCCATCTCCATCTCCGCATACGGCGACACCAACCGCATCGCCCACCCCGTCCAGCACGCCCTCTCCAGCACCGGCGTCTCCCTCAACCACGTCCCCGCCGGCATTAAAGATGCAAGTGATAAGAAGATCTTAGTTGATATGCTATTCTGGGCTATTGACAACCCTCCGCCAGCAAATTATTTGCTAATCTCCGGCGATCGGGATTTCTCTAACGCCCTTCATAAGCTTGTGATGAGGCGATACAATATTCTATTAGCACAACCTCCAAATGTGTCTCAAGCACTTACTGCTGCAGCAAAGAATGTTTGGCTGTGGAAAAGCCTTGCGGCTGGAGAACCACCATTAGCAGAGTCACCGTACATAAGCAGCACATCAAATAGCAATATGGATGATGTGGATACGACAAAGAACATAGTTTCAGATTCTTCAGACACGACTCCACATGCCAACCCTCAAGTGCAGAATAGTTTTCAGTTTGATCATCAAAAGGGTGGAAGCACTGCTAACCAGCCAAGTCAGTCTTCTATGCCGTCATCAACTTCATTAAGTTCTGAATCTCAGGATGGGGCAAAGGTGAGCCAGTCAAGCACACCAAAAGTTCAGCCCTTTTCCCTGTCTAAAAAGCCTGCAAAATCTGCTCATTCCCATCAAAAGTGTGGTCCCCACGACCATTTCAATAGTAAGAAGCCTGGTGTGTCAACCGAGTCTGCACTGAAAAATGGTGCTCCTGATTTTGGCGTTGGTAGTGGCCATTATCATCCAAAACACCAGAAACCCCAATCCTCTCAGCCGCCAAGACCCCAAAATCCAGTGACTCGTCCTCACAGTGGATCAGCTGGCAATTTTCACGCATCAAATTCACATAGAAGCAACTCGTGTCCACCACCAGCTGGCCATAATGGCATTCTTACTGCACCGTTGCAATCCTGGCCAAGTGGCTCTCCCTATGATGGCCCGCCTATTAATTATCCTGATATGAGTCGGACTAATATTTCTGGATACCCCAGAGGAATTCATGACAACCAAGGTTTGAACATCAACTATCATCCAAACCATTCTGGTGCTCCTCATATTGTTCAACCTGCTTACAATGATTATAGTTACAGACCTCCAACTCCACCTAATATGTCCAGCAGCATGCAAAACGCTGGACAATGGGGAGCCAACCCAGTATGTCCACAGCCATCTTTTGACTCTCAAAGCCTTTTAAGAAATATATTAGGTGCTTTAGAAGTATTGAAGAGCGAGAAGATTCCACCAACAGAACAGAATATATCAGACTGTATACGTTATGGAGACGCTAATCTACCAAATTTTGATGTTAAGAAGGCTCTTGAAATTGCCATTCAGCATCAAGCCATCGTCATTAAGAAGTTAGCACCTATGTCATACTTTCTGGGGAAAAATGAAAATATCTGGAAATGCGTGAATATAATGGATACAAATGCAAAATACCCAAATGAGACGTTAGATGCTGTTCATAGGTTCATATCTTCTGCCCTTGGCTGTTCTGCGATAAAGAGTTCTCAATCCAGGTATCAAGCTGCAACTATCTTAAAGAAAACATGCTTGAAACGTCTTTCCCTTGGTGAATGGGAATCAAGCTGTCATTATGCTACTGGTTTTGTTCCTAGTACTCTGACGGGAGCAGCTCAGGTTGTGGTTATTGTTATGAGATTGCTACTTCAGTTGGGATACGGGAGGACTATAACAGTGCCCGGCATTGGAGGTTATGATCTGCTCTCATTTTACCCAGTTGGCCCAAAAGGCATTCTCGAAATATCAGGAGTTAATTTCAAGGAAATCTGTCAAGTGGCAACAGAAACAGCTGCTATTAAGCTGTTCAATGAAGTACCGACATTGAAGCCCCTTTGTTCGCAAATACTCACCAACACATGGATGGATGGCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003187G0090 gene.
ATAAAACTATACTGAGCTGAGTTACAGAAAAAAAGCAACCACCATTCCTTCTAGGAAAAAAAACTAACATTTAACTGCGCTCCTTGCTTAACAATTAGAATAGCAACCTTGACCAACGGTTCTTCAGTATAGAACCTCGAGTCATATTTGGTGTTACCATTTTCAGCCGGCAGGCCCATCTAAAAGATATGTTAATTTCTGAAGTCAACACATAATACCACCAAAGATGAACACATGACAGCATTAAAAACATAATTGAACTTACACATCGATCTCATGTATATCAATGAGCTAGTATTCAGTACGATTCATGTACATAAGCTCTATCATAACCTAAGAAAATATAGTAATTGATCAATGTAGCAGCTGAAATTGCAGATTGTTTTTCACCATTTTAACTGTCAAACCAAAGAATTTGGAGTACTGGCTTAACTGATAGGCAATGATTAACAAACCTAACCTAGCATTACCCACAAAGGTCTCACAATGGCTATGACAATTCATCAAGTTATATTACCTGAGATGAAGGGGACAAAAAAAATGCTCATCAAAACTGAAGGAAGCCTATCAAAACGTTGGCAACAAAACTAAACCAAAACTAAGATGTAATCTAAAAACCTAACCATGTAGACTACCGATTTTTTTAAAATAATATTTTTAAAATATAATTACAAAAATAAATAGTCGTCTAAAAAAATTACAAAAATGTGTTCCTGTCACCAGTTCAACTGGCGACAGGGACCCTTTTCCCCCCTGTCGTCGGTCCAACCACCTATCACCAGTTCAACCGGTGACAAAAAAACTCCTGTCGCCAGTTGAACTGGCGACAGATACCTATCGCCAATTGAACTGGCGATAGATTCCTCAAACCCTAATCTAGTTTTTGTACTTTTGATTTTCATAAATTTTGAACGGTACGAAATCTATTAGTCGCGCAATAGCATTTTGTGATCATCGTATGTTGCTCTAGTGCGGTGAATTTCTGTAGAATTTTGCGATTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003187 Download
Protein sequence
Protein sequence
MGEYAAAKTSVWWDIENCMVPRSCDPHLIAQNMSSALATAGYTGPISISAYGDTNRIAHPVQHALSSTGVSLNHVPAGIKDASDKKILVDMLFWAIDNPPPANYLLISGDRDFSNALHKLVMRRYNILLAQPPNVSQALTAAAKNVWLWKSLAAGEPPLAESPYISSTSNSNMDDVDTTKNIVSDSSDTTPHANPQVQNSFQFDHQKGGSTANQPSQSSMPSSTSLSSESQDGAKVSQSSTPKVQPFSLSKKPAKSAHSHQKCGPHDHFNSKKPGVSTESALKNGAPDFGVGSGHYHPKHQKPQSSQPPRPQNPVTRPHSGSAGNFHASNSHRSNSCPPPAGHNGILTAPLQSWPSGSPYDGPPINYPDMSRTNISGYPRGIHDNQGLNINYHPNHSGAPHIVQPAYNDYSYRPPTPPNMSSSMQNAGQWGANPVCPQPSFDSQSLLRNILGALEVLKSEKIPPTEQNISDCIRYGDANLPNFDVKKALEIAIQHQAIVIKKLAPMSYFLGKNENIWKCVNIMDTNAKYPNETLDAVHRFISSALGCSAIKSSQSRYQAATILKKTCLKRLSLGEWESSCHYATGFVPSTLTGAAQVVVIVMRLLLQLGYGRTITVPGIGGYDLLSFYPVGPKGILEISGVNFKEICQVATETAAIKLFNEVPTLKPLCSQILTNTWMDG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above