gene PH01003119G0210
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003119:119146 - 138391(- stand)   Name
Alternate name Locus tag PH01003119G0210
Length of gene 19246  bp Length of CDS 7587  bp
Product information
Feature type
CDS
Product name
heat shock protein DnaJ
Alternate name
Molecular weight
(predicted)
276322.362520004  kDa
Isoeletric point
(predicted)
5.94163131713867
Length
2528  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_129678 4
Please click OG5_129678 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 500 1000 1500 2000 2528
Detailed signature matches
    1. PF14237 (DUF4339)
    1. PF00226 (DnaJ)
    2. PS50076 (DNAJ_2)
    3. SM00271 (DnaJ)
    4. SSF46565 (Chaperone...)
    1. SSF48371 (ARM repeat)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005488 binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 99751 1460 1500 6.76E-12 cd06257 DnaJ cl02542 -
superfamily 243077 1460 1500 6.76E-12 cl02542 DnaJ superfamily - -
non-specific 197617 1460 1501 4.00E-12 smart00271 DnaJ cl02542 -
non-specific 215804 1460 1500 5.90E-12 pfam00226 DnaJ cl02542 -
specific 206405 1093 1138 2.22E-08 pfam14237 DUF4339 cl16735 -
superfamily 206405 1093 1138 2.22E-08 cl16735 DUF4339 superfamily - -
multi-dom 236757 1461 1500 4.81E-10 PRK10767 PRK10767 - C
multi-dom 233829 1463 1500 1.35E-09 TIGR02349 DnaJ_bact - C
multi-dom 223560 1461 1500 1.37E-09 COG0484 DnaJ - C
multi-dom 237657 1463 1500 6.66E-08 PRK14281 PRK14281 - C
multi-dom 237664 1464 1500 1.73E-07 PRK14294 PRK14294 - C
multi-dom 237658 1465 1538 2.97E-07 PRK14284 PRK14284 - C
multi-dom 237653 1461 1509 6.58E-07 PRK14276 PRK14276 - C
multi-dom 184611 1464 1500 7.22E-07 PRK14297 PRK14297 - C
multi-dom 172774 1463 1528 8.74E-07 PRK14286 PRK14286 - C
multi-dom 184599 1461 1500 9.37E-07 PRK14277 PRK14277 - C
multi-dom 237661 1461 1500 1.14E-06 PRK14291 PRK14291 - C
multi-dom 237663 1461 1500 1.92E-06 PRK14293 PRK14293 - C
multi-dom 237668 1461 1501 2.55E-06 PRK14301 PRK14301 - C
multi-dom 225124 1461 1500 5.06E-06 COG2214 CbpA - C
multi-dom 237660 1465 1500 6.87E-06 PRK14289 PRK14289 - C
multi-dom 184612 1465 1500 1.75E-05 PRK14298 PRK14298 - C
multi-dom 184604 1461 1497 1.89E-05 PRK14283 PRK14283 - C
multi-dom 237656 1465 1500 2.67E-05 PRK14280 PRK14280 - C
multi-dom 240236 1460 1500 2.73E-05 PTZ00037 PTZ00037 - C
multi-dom 184603 1461 1500 2.90E-05 PRK14282 PRK14282 - C
multi-dom 172776 1463 1497 4.88E-05 PRK14288 PRK14288 - C
multi-dom 237654 1464 1500 5.02E-05 PRK14278 PRK14278 - C
multi-dom 237667 1460 1527 5.22E-05 PRK14299 PRK14299 - C
multi-dom 172778 1461 1500 5.77E-05 PRK14290 PRK14290 - C
multi-dom 237662 1463 1500 0.000101313 PRK14292 PRK14292 - C
multi-dom 227694 1464 1512 0.000215671 COG5407 SEC63 - C
multi-dom 237659 1460 1500 0.000239285 PRK14287 PRK14287 - C
multi-dom 172773 1464 1500 0.000365065 PRK14285 PRK14285 - C
multi-dom 211601 1462 1504 0.000480255 TIGR00714 hscB - C
multi-dom 237666 1464 1500 0.000644035 PRK14296 PRK14296 - C
multi-dom 237655 1463 1500 0.00107074 PRK14279 PRK14279 - C
multi-dom 234368 1463 1500 0.00139871 TIGR03835 termin_org_DnaJ - C
multi-dom 182347 1463 1504 0.00404528 PRK10266 PRK10266 - C
multi-dom 237665 1464 1530 0.00438289 PRK14295 PRK14295 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific HSP70 interaction site H1479,P1480,D1481,R1487,F1490,V1491,Q1494,K1495 8 8 99751
 
DNA sequence
Upstream 1000 bp region from PH01003119G0210 gene.
CAGGAAACAGAAATTGCGGCGCATGTCGGCCGACCGGTTAGTAGCGACAAAGAAAGATATTGCCAAGGTACTGAAGGCGGGGGTCATTCGCGAGATTAAACACTCGGAGTGGCTAGCCAACCTTGTCCTCGTACAGAAAGAAACAGGCAAATGACGCATGTGCGTCGACTTCACCGACCTCAACAAGGCATACCCCAAGGACGATTTTCCCCTACCCCGCATCGACCAACTGGTGGACGCCACTTCGGGCTGTGAGCAGATGAGCTTCCTAGACGCCTACTCCGGGTACTATCAAGTACTCATAGCCAAAGAAGAACCAAAGACCGTGTTCATCACCCCCATAGGCACATATTGCTACACCCGCATGCCCTTCAGCCTGAAAAATGCGGGTGTGACGCGACCTTCACCCGCCTCATCATAAAGGTGCTAGCCAGCCAGCTCGGCCGCAATGTGGAATCGTGTGTGGACGACATAGTAATCAAGAGCAAGTTTGCAGGGCCACATACGAAGGACCTGCAAGAAACCTTCGCTACCCTTCGGGCGGAGGGAATCAATCTCAACCCCGAGAAATGCGCCTTCAGCGTAAAGGCGGGCAAGCTCCTAGGGTTCCTCGTATCCGAGAGGGGTATCGAGGCCAACCCCGAAAAAATTAAGGTCATCCAGGAAATGAAGCCCCCTCATAGCGCCCGCGAGGTGCAAAAGCTGACAGGGCGCCTCACCACCCTCAGTCGATTCCTGTCCCGCTCGGCAGAAAGGGCCTTGCCATTTTTCAAAACACTCCAAGGAACTGAGCCGTTTTGATGGACGGACGACTGCCAGAAGTCATTCTAAGAGCTTAAACAATATCTCGCCTAGCTACCAAGCCTAACCAGCCCGAAGCAAGGGGCAGACCTCCTACTGTACCTCGTCGCCTCTTCCTCGGCTATAATACCCCGTTGGATGTAAATAGTTAAACAAGAAATAGAATGTGATTAAAAAGAAAAGTTTTGGTGAGGAGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGACTTCGCCAGCCGCCACGCCGCCGCCGCGCCCCCGCCGCCGCCCGCCGAGGCCTCGCCCTCCTCCCCCCGAGGTGTTGCCGCCGCTGTCGCCGAGGAGCCCGTCAAGCACTCGTGGCGGGGGAGGTACAGGCGGATCCTCTGCATCGCCGCCTCGGGCCTCGTCACGCTCGACCCCGCCGCCCTCACCGTCACCAACTCCTACGACCTCGCCGCCGACTTCGACCGCGCCGCGCCCGACACCAACGCCGCCGAGTTCACGCTCAGCGTCCGCACTGACGGCCGCGGCAAGTTCAAGGCCGTCCGCTTCTCCTCGCCGCTCCGCGCAGGGATCCTCACCGAGCTCCACCGCCTGCGCCCCGTCCACCCGGTCGTCGAGTTCCCCGTCCTCCACCTCCGCCGCCGCACCCACGAGTGGGCCCCCTTCAAACTTAAGGTCACTTCGGTGGGTGTTGAGCTCCTTGAAGGACATTCTGGTGACCTGCGCTGGTGCTTGGACTTTAGAGACATGGATTCTCCTGCTATTGTGCTCTTGGGAGAAAGCTATGGGAAGAGGACTGCTGAAGGTGGAGGGTTTGTGCTATGCCCCCTTTATGGAAGGAAGTCAAAAGCATTTATGGCTGCTTCAGGCAGTACAAACACTGTGATTATATCTTATTTGGCAAAAACTGCCAAGTCAACGATTGGATTATCACTATCTGTGGAGAACTCACAGTCAATGACAGCTGCTGACTTTATAGCAAAGAGAGTTAAATGGGTAGCTGCTGCCTTTTCTTTTACGAGAAAGAAACTTAAGGTCACTTCGGTGGGTGTTGAGCTCCTTGAAGGACATTCTGGTGACCTGCGCTGGTGCTTGGACTTTAGAGATATGGATTCTCCTTCTATCGTGCTCTTGGGAGATAGCTATGGGAAGAGGACCGCTGAAGGTGGAGGATTTGTGCTATGCCCTCTTTATGGAAGGAAGTCAAAAGCATTTATGGCTGCTTCAGGCAGTACAAACACTGTGATTATATCTTATTTGGCAAAAACTGCCAAGTCAACGATTGGATTATCACTATCTGTGGAGAACTCACAGTCAATGACAGCTGCTGACTTTATAGCAAAGAGAGCTAATGAGGCAGTTGGAGCTGCTGAAACTCGACATGGAGAATGGTCAGTAACAAGATTACGTCCCGCTTCACATGGCACTGCTAGCATTGAGAGCTTGAGTTTGGGTATTGGGCCAAGGGGAGGACTTGGAGAGGGTGATTCTGTTTCTCGGCAGCTTGTTCTTACAAACACTTCACTCGTCGAAAGACGCCCCGAGAATTACGAGGCTATCATTGTCCGACCTCTCTCAGCAGTAAGTGCCCTTGTCCGATTTGCAGAAGAGCCACAAATGTTTGCATTTGAATTCAATGATGGCTGTCCGATTCATGTATATGCAAGTACGTCCCGTGATAGTTTACTCGCAACAGTTCTTGATATTTTACAAACTCAGTTACATCTAAGAGGTTGTATGAAGAGTACAGTTTCTTCAAATAGGCAGTGTGCAATTCCAGTGCTGTCAAGGTTGACTATGCCTGGTCATCGCATAGATCCACCTTGTGGGGTCGCCCATCTTCAGATACCACATCATGCTACTGTTGATATGGATGCTGCTAACATGCACATAAAACATTTAGCTGCGGTTGCTAAAGAGGCTGTAGTTTCATCTGACACTGTTCCTGGAGCAAAAATCAGATTATGGCGTAGAATAAGGGAGTTTAATGCATGCATACCCTATACCGGAGTGCCCATCAATATTGAAGTGCCTGAGGAAGATGCAATAGCAGCAGAGTCCATGCGTGATGCTGCCTTGAAGGATGGTGCACTTCTGAGGCATTTGCTAAATGCTTTCTTCTTCCCTGCTGGTGAGCGACGTGATGTTAGTCAGCAGCTTGTTGCTCTTTGGGCTGATTCCTATCAACCTGCACTGGATTTGCTGTCGAGAATACTTCCTCCTGGACTTGTTGCTTATCTTCATACACGTTCAAATGAAGATTCTCAGAACCAGCATGACGAAGTACCGTTAAGCAGAAGGCAGAAATGGATACTTCAGCAGAGGAGGGCCCGTGGTGGTAAGAGTATGGCAGCACCAGAACAAGGGGTGCCCCCCAGTAGTGTTGATGATCGGGATTTCTTCAGGCACGCCGGTGTGGGGCCTTATGGAGGAGCAGATGTCCATCAGAGGCATCCCAGTCAGTACCCAACTGCCCACACCCCTTCTGGTATGAGTATTGATCCTTCTCATGCAGTACCACATGGTGCTTTACCTGAAGCGGCTTCTGAAAATAATAATGAAATTGGAGCACCACAGCTGGATTCACATGCTTATTCCGTGGACTCCAATGCCAATGGTGATCTTGTTAGCTCCTCACATTCAGATTTCTCAGTCCCTGCACAGGTTGTGGTGGAAAACACTCCTGTGGGATCTGGCAGGCTACTGTGCAATTGGTATGGATTTTGGAGAGCGTTCAGTCTAGATCACAATAGAGCAGATTTGATATGGAACGAACGCACAAGACAAGAATTAAGGGAAGCATTGCAAACTGAAGTTCATAACCTTGATGTTGAGAAAGAAAGAACCGATGACATTGTCCCTGGAAGTTCGGTCGGTGAGGATGCTGGGGGTAGTGACACTTTACCACAAATTTCATGGAATTATGTTGAATTTTCAGTGAGCTACCCTAGCTTGTCCAAAGAAGTCTGTGTGGGGCAATACTATTTGCGGTTGCTGCTTGAAAGTGGAAGCAACTACCAAGCACAGGATTTTCCACTGCGTGATCCTGTTGCCTTTTTTAGAGCTCTATACCATCGTTTCTTGTGTGATGCAGATATTGGTCTTACTGTGGATGGTGCAGTTCCTGATGTACTGGGTTCATCTGATGATTGGTGTGACATGGGAAGATTGGATGGCTTTGGCGGAGGTGGAGGTTCCTCTGTAAGAGAACTTTGTTCAAGGGCAATGGCTATAGTTTATGAACAACATTACAAAGTTATTGGGCCTTTTGATGGCACGTCACATATTACTGTTCTCTTAGACAGAACAGATGATAGGGCATTAAGGCATCGTTTGCTACTTCTGTTAAAGGCCTTGACGAATGACCTTTCAAATGTTGAAGCGTGTGTTTTGGTTGGAGGCTGTGTTTTAGCTGTCGATTTGCTTACTGTTGCTCATGAAGCATCTGAGCGGACAGCTATTCCTTTGCAATCTAACCTCATTGCGGCAACCGCATTTATGGAGCCTCCGAAAGAGTGGATGTATATTGACAAAGATGGTACACAAGTAGGTCCACTTGAAAAGGATGCTATCAGACGGCTGTGGTCAAAAAAGTCAATTGATTGGACAACCAAATGTTGGGCTTCCGGTATGTCTGACTGGAAAAGATTACGTGATATCCGGGAGCTGCGTTGGGCACTTTCTATTAGAGTACCTGTTCTTACTCCTACTCAGATTGGGGATACTGCATTGTATATATTGCATAGTATGGCATCTGCACATTCTGATCTTGATGATGCGGGTGAGATAGTGACCCCAACTCCTAGGGTGAAACGTATATTGTCAAGTCCAAGATGCCTTCCTCATGTTGCTCAGGCTATGCTTACTGGGGAACCAAGCATTGTTGAAGCAGCTGCCTCCTTGCTTAAGGCTATTGTCACAAGAAACCCCAAAGCTATGATTCGACTATATAGTACTGGTGCCTTTTACTTTGCATTGGCATATCATGGTTCAAATCTCCTATCAATTGCACATCTCTTTTCGGCCACACATACTCATCAAGCTTTTCATGGCGGTGAAGAGGCAGCAGTATCTTTGTCATTGCCTTTGGCAAAGCGTAGTGTACTAGGTGGACTGCTCCCAGAATCATTGTTGTATGTCTTAGAACGCAGTGGTCCTTCCGCTTTTGCTGCCGCCATGGTGTCTGATTCTGACACACCAGAAATTATTTGGACCCACAAGATGAGGGCAGAAAATCTTATTCGTCAGGTTCTGCAGCATCTCGGTGATTTTCCTCAGAAATTGGCTCAACATTGCCATTCATTGTATGATTATGCTCCTATGCCACCTGTGACCTACCCAAATCTGAAAGATGAAATGTGGTGCCATCGTTACTACCTTCGGAACCTATGTGATGAGATTAGGTTTCCTAACTGGCCTATTGTTGAACACGTAGAGTTTTTGCAGTCGTTGTTGGCAATGTGGCGTGAAGAGTTAACTCGTCGTCCAATGGATTTGTCTGAAGAAGAAGCCTGCAAGATACTGGAGATTTCTCTTGATGATCTTGTGCTTGGTGAGAATGGCAGTAGCAAGCAGTCATCCGAGTTAAATCCGGCCAATTTGGCAAACAATATTGAAAACATTGATGAAGAGAAGCTTAAGCGCCAATACCGGAAGCTGGCAATAAAATACCATCCAGACAAAAACCCTGAAGGAAGAGAAAAGTTTGTTGCTGTGCAAAAGGCTTACGAGCGATTGCAGGTTTGGCAAGTGGATGAAGCATATTCCCTATCACTCCCATCCAAGCTGTGGAGCCCCATACCGGCCTTCGGCGCTGGCGCTATCTTCGCACTCTGTGGCATGGGCACTCTGTGGCGTAGCCGGTGGAAGCTGTTCTCCCGCCCGCTCGCCATGCTCACCGGCGGCTGGCCCCCGTGGAGTGTGCCGTGTGGGGCAAGTATGCAGGGATTGCAGGGACCACAAGTCTGGAGGCTGCTACTCTTACTCAAGGCACAGTGCATCTTGTACAAGAGATATGGACATGTCTTGGAACCATTCAAATATGCTGGCTATCCTATGTTGCTAAATGCAGTTACTATAGATAAGGATGACAGCAATTTTCTTTCATCTGATAGGGCCCCTCTTTTGATAGCCGCTTCAGAGCTAATTTGGCTTACATGTGCATCATCTTCATTAAATGGAGAAGAACTTATACGAGACAGTGGTATCCCATTGCTGGCAACACTTCTTTCACGTTGCATGTGCATTGTTCAGCCAACAACTCTGGCAAATGAACCAGCAGCAAGAATAGTCACCAACATAATGCACACATTCTCAGTTCTCAGCCAGTTTGAGTCAGGAACAGTTGAGATTCGTAAGTTTGGTGGCCTTGTTGATGACATTGTGCACTGCACAGAACTTGAATTTGTTCCCTCAGCTGTGGATGCTGCTCTGCAGACAGCCGCTAACGTTTCAGTGTCATCTGAATTGCAAATTGCTCTTCTAGAGGCTGGCTTTTTATGGTATGTGTTGCCCCTACTGCTTCAATACGATTCAACAGCAGAAGAGAACGAGACAAATGAAGGACATGGTGTTGGGGCAAGGGTACAGATTGCTAAAAATCTGCATGCTGTACGTGCAACTCAGGCTTTGTCAAGGCTTTGTGGTATTGGTGTTGACGGAATGTCAAGCCCATCTAATCAACCTGCTTTCAATACACTAAGAGCACTTCTTACTCCCAAGCTTGCTGATATGCTGAGAAACCACCCACCCAAAGAGCTATTATCAAATCTAAATTCAAACTTGGAGTCACCAGAGATCATATGGAATTCTTCCACCAGAGGGGAGCTCCTCAAATTTGTAGACCAGCAGCGTGCTAGTCAAGGCCCTGACGGTTCATACAATTTGACGGAATCAGAGTCTTTCACCTATCAAGCTTTGTCAAAAGAATTGAGTGTTGGTAATGTATACTTGAGAGTTTACAACAATCAGCCGGATTATGAAATAAGTGATCAGGAAGGCTTTTGCATTTCTCTGCTTAAATTTATAGCAGGGTTAGTACAAAAGTGGAATTCCATAAATTTGGAGGAAAATATGATGCATCAACATGGTTCAGTTATTGACACATCTACTACTGAAAATGGTGAATTCAGTGATTCAACCAAAGAAGGTAAAGAAGACAATTCATTTGAAAAAGACAGTAAAGAAGTAGCCAATGGAGATTGTGAAGTCATTATGAACCTCCAAATTGGGTTAGCATCACTTCAGAATCTTCTGACAAGTAATCCAGGCTTGGCTGCTGTTTTTGCTTCCAAGGAACGGTTGACACCTCTTTTTGAATGCCTTGCTCTGCCTGTTCCTCCTGAAAGCAACATCCCACAGATTTGTCTAAGCGTTCTTTCTCTCTTGACAAAGCATGCTCCTTGTTTGGAGGCCATGGTTGCAGAAAGGACGAGTCTCATTTTGCTATTTCAGATACTCCACTGCAATCCTCCTTGCAGGGACGGGGCACTTGCTGTCCTTTATTCTTTAGCAAGCACACCAGAGCTGGCCTGGGCAGCTGCCAAGCATGGTGGTGTAGTGTACATTCTTGAACTTATGTTACCACTTCAAGCTTCTCTTTCTGCACAGCTGTCAACCATGGCATCAGACCTCTACCAAGAGCAGATGAAAGGACGTGTTGTTGATTGGGATGTGCCTGAACAAGCATCTGGCCAACATGTAATGAAGGATGAACCACAGGTTGGTGGAATTTATGTAAGACTCTTCCTAAAGGATCCCAAGTTTCCACTGAGAAATCCTAAAAGATTCCTTGAAGGACTCCTAGATCAGTATGTCTCTTCAGTTGCTGCTACACACTACGAAGCAAATGCTGTCGATCCAGAACTTCCTTTGCTGCTTTCCGCTGCATTGGTTTCCTTGTTGCGTGTTCATCCGGCACTTGCAGACCATGTTGGTTACCTAGGTTATGTTCCGAAGTTGGTTGCAGCTATGGCCTATGAGGGAAGAAGGGATACTATGGCATCTGGACAGGGCACAAGTAGATTGCAAGCAGAACATATTGAGCACGACAACTCTGATGGTCTCTCTGAGACCACCGTGCAGACTCCACAAGAGCGTGTTCGCCTTAGTTGTTTGCGAGTTGTTCCACTGCTGATGAAAGCAATTGGATGGCAAGGTGGAAGTATACTGGCATTAGAGACACTAAAGCGTGTTGTTGGCGCTGGTAATCGGGCTAGAGATGCGCTTGTTGCACAGGGGTTAAAGGTTGGTCTTGTTGATGTTCTCCTTGGCATTCTCGATTGGCGAGCTGGTGGAAGACAGGGACTCTGTAACCAGATGAAGTGGAATGAATCGGAGGCTTCAATTGGGCGTGTATTGGCAGTGGAGGTCCCTTCAGACCCTTCGGGCCCCTTCGGCAATACTCGGAGGGGTGGGGACGCTTGCGGTGTTCTCCTGGTCGTGGGGACCGGGGAAGCTGGAGAGCCTCGCAAAGGTGAGAACTCCTTGCGGAAGGTGGGCAAGCGCCAGATCTGGACGAGCTTGCCGATGGTGACGACGATGAGCTCGCCGTCGGGGCTGAAGCGGACGGCGGAGGGCGGCCTTGAAGGAGACGCGGTGGAGGAGCGCTCGGGCGAGCCGGGCATAGGCCGGTGTGGGTGCGCGAGCCGAGTAGCGGCGGCGCAGGATGGAGGGCCGAGGGCAGTACCAGGGGGAGACGACGGCGGCCAAGAGCCAAGAGAGGGTGGCACCAATGTCAATAGGGGGCGGCGGCTGGAAGGAGAAAAGGGGAGTGAGTTTGGGGTTCCTGGTGAGTGGTGGCTGGGAGAGGAGGAAGTAGCGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003119G0210 gene.
GCATATTGTTTTAAACATTGACATGGTTTTTAAAATACAACTTTCACTAATATCTACTGTAATATAGCTATGACACACAATAAATTTACGGTGTTATGAAGATAATTTTCGAGATAGATCTATACATATGATTTATATGTATCTGATCTGAATATTTTAAAAGGTGTCGATAGCCAATGCAGTAATTTTGATTGCACGTATCCCAATAGCTAAGTTTCCAAGACAGTTTGATTTGTCTGTATATACTACGACAATAAGAGAGTAAATCATCACGTATCGCCGGTAGCACTCGCTAAGTTATAAAAATAAAATGTCGCATTAGAAAATAATTTAGGTAAGATAATTAAATTAAGCAATACCGGCATAAAATCGATAAGGCATTGTTGATGCACGCGAAAATTGAATAGGCTTAGTTGTGCATAGGATTAGTATAGTATGTTATTTTCGCGTGATAAAACGCGAGTGTAGACAAAACCCGATCCTAGAGCCGATAGACTATAATAACAGTAGTTAGGGAGTGCTAACCTAACGGGGGCTTCGAAAAATGTTATTAAATAAAAATCTGCTAACAAAATGAACCAACTAATTAATGTATGTCTAGTAGCACCCAATTGTCGTTAAGTATTTATTTATTTATTATTCACGCTGCCATATAAATACAGAGGACGATCCAACGCAGATCGGAGTAGCTGATCTGGAATTCTTCGACATCGAACATTTCTACTACTACGAAGGCAAGCTTATCTCTTGAACATAAATATAGTTATATTAAATGTAAACTATATATTGCTGTATCATATATGTACATGCATCAAAACTATGTCTCAAAATCAAATCGGATTAGAGATGAAAATGAGAGAAAGATAAGAAACTAGAATGAGATGAGGAAAGAGTTAATATTATGGCTGGTAAAGGGGGCTCGGGCAGGGGAACACAAAGACGACTATGATGATGAGGGAAGAGGTGGGGCCCCTTTGTATATGATTAATATATAAGGACCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003119 Download
Protein sequence
Protein sequence
MDFASRHAAAAPPPPPAEASPSSPRGVAAAVAEEPVKHSWRGRYRRILCIAASGLVTLDPAALTVTNSYDLAADFDRAAPDTNAAEFTLSVRTDGRGKFKAVRFSSPLRAGILTELHRLRPVHPVVEFPVLHLRRRTHEWAPFKLKVTSVGVELLEGHSGDLRWCLDFRDMDSPAIVLLGESYGKRTAEGGGFVLCPLYGRKSKAFMAASGSTNTVIISYLAKTAKSTIGLSLSVENSQSMTAADFIAKRVKWVAAAFSFTRKKLKVTSVGVELLEGHSGDLRWCLDFRDMDSPSIVLLGDSYGKRTAEGGGFVLCPLYGRKSKAFMAASGSTNTVIISYLAKTAKSTIGLSLSVENSQSMTAADFIAKRANEAVGAAETRHGEWSVTRLRPASHGTASIESLSLGIGPRGGLGEGDSVSRQLVLTNTSLVERRPENYEAIIVRPLSAVSALVRFAEEPQMFAFEFNDGCPIHVYASTSRDSLLATVLDILQTQLHLRGCMKSTVSSNRQCAIPVLSRLTMPGHRIDPPCGVAHLQIPHHATVDMDAANMHIKHLAAVAKEAVVSSDTVPGAKIRLWRRIREFNACIPYTGVPINIEVPEEDAIAAESMRDAALKDGALLRHLLNAFFFPAGERRDVSQQLVALWADSYQPALDLLSRILPPGLVAYLHTRSNEDSQNQHDEVPLSRRQKWILQQRRARGGKSMAAPEQGVPPSSVDDRDFFRHAGVGPYGGADVHQRHPSQYPTAHTPSGMSIDPSHAVPHGALPEAASENNNEIGAPQLDSHAYSVDSNANGDLVSSSHSDFSVPAQVVVENTPVGSGRLLCNWYGFWRAFSLDHNRADLIWNERTRQELREALQTEVHNLDVEKERTDDIVPGSSVGEDAGGSDTLPQISWNYVEFSVSYPSLSKEVCVGQYYLRLLLESGSNYQAQDFPLRDPVAFFRALYHRFLCDADIGLTVDGAVPDVLGSSDDWCDMGRLDGFGGGGGSSVRELCSRAMAIVYEQHYKVIGPFDGTSHITVLLDRTDDRALRHRLLLLLKALTNDLSNVEACVLVGGCVLAVDLLTVAHEASERTAIPLQSNLIAATAFMEPPKEWMYIDKDGTQVGPLEKDAIRRLWSKKSIDWTTKCWASGMSDWKRLRDIRELRWALSIRVPVLTPTQIGDTALYILHSMASAHSDLDDAGEIVTPTPRVKRILSSPRCLPHVAQAMLTGEPSIVEAAASLLKAIVTRNPKAMIRLYSTGAFYFALAYHGSNLLSIAHLFSATHTHQAFHGGEEAAVSLSLPLAKRSVLGGLLPESLLYVLERSGPSAFAAAMVSDSDTPEIIWTHKMRAENLIRQVLQHLGDFPQKLAQHCHSLYDYAPMPPVTYPNLKDEMWCHRYYLRNLCDEIRFPNWPIVEHVEFLQSLLAMWREELTRRPMDLSEEEACKILEISLDDLVLGENGSSKQSSELNPANLANNIENIDEEKLKRQYRKLAIKYHPDKNPEGREKFVAVQKAYERLQVWQVDEAYSLSLPSKLWSPIPAFGAGAIFALCGMGTLWRSRWKLFSRPLAMLTGGWPPWSVPCGASMQGLQGPQVWRLLLLLKAQCILYKRYGHVLEPFKYAGYPMLLNAVTIDKDDSNFLSSDRAPLLIAASELIWLTCASSSLNGEELIRDSGIPLLATLLSRCMCIVQPTTLANEPAARIVTNIMHTFSVLSQFESGTVEIRKFGGLVDDIVHCTELEFVPSAVDAALQTAANVSVSSELQIALLEAGFLWYVLPLLLQYDSTAEENETNEGHGVGARVQIAKNLHAVRATQALSRLCGIGVDGMSSPSNQPAFNTLRALLTPKLADMLRNHPPKELLSNLNSNLESPEIIWNSSTRGELLKFVDQQRASQGPDGSYNLTESESFTYQALSKELSVGNVYLRVYNNQPDYEISDQEGFCISLLKFIAGLVQKWNSINLEENMMHQHGSVIDTSTTENGEFSDSTKEGKEDNSFEKDSKEVANGDCEVIMNLQIGLASLQNLLTSNPGLAAVFASKERLTPLFECLALPVPPESNIPQICLSVLSLLTKHAPCLEAMVAERTSLILLFQILHCNPPCRDGALAVLYSLASTPELAWAAAKHGGVVYILELMLPLQASLSAQLSTMASDLYQEQMKGRVVDWDVPEQASGQHVMKDEPQVGGIYVRLFLKDPKFPLRNPKRFLEGLLDQYVSSVAATHYEANAVDPELPLLLSAALVSLLRVHPALADHVGYLGYVPKLVAAMAYEGRRDTMASGQGTSRLQAEHIEHDNSDGLSETTVQTPQERVRLSCLRVVPLLMKAIGWQGGSILALETLKRVVGAGNRARDALVAQGLKVGLVDVLLGILDWRAGGRQGLCNQMKWNESEASIGRVLAVEVPSDPSGPFGNTRRGGDACGVLLVVGTGEAGEPRKGENSLRKVGKRQIWTSLPMVTTMSSPSGLKRTAEGGLEGDAVEERSGEPGIGRCGCASRVAAAQDGGPRAVPGGDDGGQEPREGGTNVNRGRRLEGEKGSEFGVPGEWWLGEEEVA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above