gene PH01003111G0150
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003111:99837 - 110107(+ stand)   Name
Alternate name Locus tag PH01003111G0150
Length of gene 10271  bp Length of CDS 1986  bp
Product information
Feature type
CDS
Product name
CAS1 domain-containing protein 1 precursor
Alternate name
Molecular weight
(predicted)
77314.8548200003  kDa
Isoeletric point
(predicted)
6.47857284545898
Length
661  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_130242 4
Please click OG5_130242 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G34410.2
O-acetyltransferase family protein
O-acetyltransferase family protein; FUNCTIONS IN: O-acetyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Cas1p-like (InterPro:IPR012419); BEST Arabid
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g50510.1 CAS1 domain-containing protein 1 precursor, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 600 661
Detailed signature matches
    1. PF07779 (Cas1_AcylT)
    1. SSF50978 (WD40 repe...)
    1. SM00320 (WD40)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 219571 220 536 2.57E-65 pfam07779 Cas1_AcylT cl06695 N
superfamily 219571 220 536 2.57E-65 cl06695 Cas1_AcylT superfamily - N
non-specific 238121 541 637 0.000177351 cd00200 WD40 cl02567 C
superfamily 243092 541 637 0.000177351 cl02567 WD40 superfamily - C
non-specific 238121 547 637 0.000194684 cd00200 WD40 cl02567 N
non-specific 238121 541 614 0.00114368 cd00200 WD40 cl02567 N
multi-dom 225201 452 614 8.36E-05 COG2319 COG2319 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic structural tetrad V558,D563,F569,D570,E585,H586,S605,D609,L615,S616,A628,H629 40 12 238121
 
DNA sequence
Upstream 1000 bp region from PH01003111G0150 gene.
GCCTCTTTCTGTCGATTTTTTATATATTAATTAACCCTTTTTAAAATTTTGTTTTAAAGTTAACCACTCACAAATTTTATTTTCTATTCTGACCCATTTGGTCACGCCACCACCTATGACGTGACAAAATAACACTGTCACGTCAGCCCGTATCTTATCAAACTTTTATCACGCCACCACCAGTGGCGTGATAAAAAATGTGTTTTCAGCAGACTTATCCTATAGCGTGACAATATTATTTTGTCACGCTATCGCCCGTGGCGTGAGTCACGCCACCACCAGTGGCGTGATAAAAAGTGTGTTTTCAGCAGATTTATCCTATAGCGTGACAATATTATTTTGTCACGCTATCGCCCGTGGCGTGACCAAAGATGTCAGAATTAGAAATAAAGTTCGTCAGAGATTAACTTTAAAATAAAATTTTAAAAATAATTAATTAATAAAAAAGTTCCTGTCTCTCACAGTACCGGACTGCGGCAACCCATTCTGTCATGGGTGGGGAGAGTAGCCCGTCCTGCCATGGGCGGGGAGCGTGACAGAAACGTGATGTGGTTTTGATATACGATAAGAGATACGTGTATCTAGCCTACGACGGCAATTGGACTATATTTATTATTTAGTTTAAAAAAGGTTAAATGAGAAAAAAAAACTCGGAGAAAAAAAAAGAGAAGAACACGAGTACACGACGACGGGGTCTCAAGTCTCAAAACTCGCAAAGTCTACCAACTAAGATAAACTAAATAAAAAGGCGTAGAAAAGGGAGCACCAAACGCAACTACCCCCAACCCGTCAACCAACCAACCGCTGCTGCGCTCCTGCTGCTGCCTTTTCCCATCGTTTCGTTCCACTTCTCCCTATCCTCCCCGTCCGTCCGGCCCGACCTCCCGACCGCGACCAGCCACCGTCCCGCGGTTGCTTCAGATCTCCTCTTCCCCCCGGCGCCAACTCCACCTCCCTCCCTCCCGATACGATTCTCTAACCCCTCCCGCCATTACACGCAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAGGTCTTCGGCCCCGTCACGCCCGGCCAGGTGTCGTTTTTGCTTGGTCTTTTCCCTGTCCTCATTGCATGGATCTATTCCGAAATCCTGGAATACAGGAAATCTTTATCCCATGGGAAAGTCCACTCAGATGCTAATTTGGAGAATGAAACTACCAAGGAAGATGATAAGGCTGTATTACTTGAAGGAGGCCAGTCGAAATCACCATCTACAAAGTTCCGGAACATGTCTACGAAAGCAAATTTGATACGGTTTATAACAATGGATGACTCTTTTCTGCTTGAAAACCGTGCTGTACTGAGAGCCATGGCCGAATTCGGCGTTGTTCTGGTTTATTTTTACATTTGTGACCGGACAAACATATTTCCAGAAAGCAAGAAGAGCTATAACCGTGACCTGTTTCTATTTCTGTACATTCTTCTCATCATAGCATCGGCACTCACTTCACTTAAGAAGCACCATGAAAAATCAGCATTTTCTGGAAAGTCCATACTCTATCTTAATCGCCACCAAACTGAAGAATGGAAAGGGTGGATGCAGAGCTATAACCGTGACCTGTTTCTATTTCTGTACATTCTTCTCATCATAGCATCGGCACTCACTTCACTTAAGAAGCACCATGAAAAATCAGCATTTTCTGGAAAGTCCATACTCTATCTTAATCGCCACCAAACTGAAGAATGGAAAGGGTGGATGCAGGTCTTATTTCTGATGTACCACTATTTCGCTGCCTCAGAGATGTACAATGCAATTCGTGTGTTCATTGCTGCCTATGTCTGGATGACTGGATTTGGGAATTTCTCGTATTATTATATCAAGAAAGATTTTAGCATTGCAAGATTTGCTCAGATGATGTGGAGGCTAAATTTATTTGTGGCCTTCTGTTGCATTGTCCTTGACAATGATTACGTGCTGTATTATATCTGTCCAATGCACACCTTATTTACTCTTATGGTATACGGGTCACTTGGTCTGTTTAACAAGTACAACGAGATACCATCAATCATGGCTATAAAGATTGCCTGCTGCTTCTTGACTGTCATTTTTATATGGGAAATTCCTGGGGTATTTGAACTTCTGTGGGCCCCCTTTACGTTTCTGCTAGGCTATAAAGATCCAGAGCCTTCAAAGTCAAACTTATCCCTATTACATGAGTGGCATTTCCGATCTGGCCTTGATCGATACGTATGGATTATTGGAATGATTTATGCTTACTTCCACCCTAATGTTGAAAGATGGATGGAGAAGCTGGAAGAATCTGAGACTAAGGTTAGATTGTCGATCAAGGGAACCATTGTGACTATTTCCTTGATGGCTGGTTATCTATGGTATGAATATATCTACAAGCTAGACAAAATTACATATAACAAGTACCATCCCTACACGTCATGGATTCCTATCACTTGGCTTGGCAAGATCACACTAGAGACTTATATTTCTCAGATCCACATTTGGCTCAGGTCTAGCATGCCAAATGGGCAGCCAAAATGGCTTCTTTCTTTCATACCGGATTATCCACTGCTTAACTTCATGCTTACTACAGCAATCTATCTTTTTGTAGACAATTTCATTTCCAGGGATGAAGAATTGGCAACCCCACTCTTCTCCTTCCCCACCTCCGACGCGCTCTTCGACTGCGCTTGGTCCGAGTCCCATGACTCCCTTTGCGTCGCCACCTCCGGGGATGGCTCCGTTCGCCTCTTCGACACCGCGCCGCCGCCCGTGCAGAACCCCGTCTGCCACCTCCGCGAGCACGCGTGGGAGGTCCACGGCATCGACTGGAACCCTGTCCGCCGCGACGCCTCCCTCTCCACCTCCTGGGACAACACGCTCAAGTTCTTGTCTCCCGACCGCCCCGCCTCCGTCCGCACCTTCTGCGCCCACGAGTATTGCGTGTCAAGTGTCGACGAGATGGAGGAGAATTGGATCAAGAAGATGAAGCGATTGGGGGATTTTGAGCTCCCAGACTTCTTTAGTTTGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003111G0150 gene.
TTAAAACTGCACGGAGACAACGGCACCCTGCGACTGGCAGGATGTAGGACCACCCAGTTGAAAATTCAGACCCAGGGCTAAAACAAAATCACAATGGAAGAACAAAAATGAAATCTCAAGAGACACAAGAATTTTGGCGTTGCAGTTGCTTGCAGTCTTTTTGTGTTTTTGCTTTCTTATATAGACAAATGAATACACACTGTTACCGAAACGACAATCTTCAGAAAACGAAACTGATTTAGAGTAAGTTTCATAGTTGGACTCTGGACTAAGTTTCAGGGTCGGACTCTAGACTAAGTTTTTGTCTCTGTTTTCCTAAACCGAAAACAGAACTTGACTCTCTTTACAGTTTCGGAATTGTAACAAATCGACAATCCAAAACAACTATCAAAACAGAAAATGAATAAGTCTGGGAGCTCAAAATCAAAGAGCTTTAAGGCTACAAACTGAAGAAGTCTGGAAGCTCAAAATCCCCCAATCGCTTCATCTTCTTGATCCAATTCTCCTCCATCTCGTCGACACTCGACACGCAGTACTCGTGGTCGCGGAAGGTGCGGACGGAGGCGGGGCGGTTGGGGGAAAAGAGCTTGAGCGTGTTGTCCCAGGAGGCGGAGAGGAAGGCGTCGCGGCGGACAGGGTTCCAGTCGATGCCGTGGACCTCTCGCGCGTGCTCGCGGAGGTGGCAGACGGGGTTCTGCACGGGCGGCGGCGCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003111 Download
Protein sequence
Protein sequence
MEVFGPVTPGQVSFLLGLFPVLIAWIYSEILEYRKSLSHGKVHSDANLENETTKEDDKAVLLEGGQSKSPSTKFRNMSTKANLIRFITMDDSFLLENRAVLRAMAEFGVVLVYFYICDRTNIFPESKKSYNRDLFLFLYILLIIASALTSLKKHHEKSAFSGKSILYLNRHQTEEWKGWMQSYNRDLFLFLYILLIIASALTSLKKHHEKSAFSGKSILYLNRHQTEEWKGWMQVLFLMYHYFAASEMYNAIRVFIAAYVWMTGFGNFSYYYIKKDFSIARFAQMMWRLNLFVAFCCIVLDNDYVLYYICPMHTLFTLMVYGSLGLFNKYNEIPSIMAIKIACCFLTVIFIWEIPGVFELLWAPFTFLLGYKDPEPSKSNLSLLHEWHFRSGLDRYVWIIGMIYAYFHPNVERWMEKLEESETKVRLSIKGTIVTISLMAGYLWYEYIYKLDKITYNKYHPYTSWIPITWLGKITLETYISQIHIWLRSSMPNGQPKWLLSFIPDYPLLNFMLTTAIYLFVDNFISRDEELATPLFSFPTSDALFDCAWSESHDSLCVATSGDGSVRLFDTAPPPVQNPVCHLREHAWEVHGIDWNPVRRDASLSTSWDNTLKFLSPDRPASVRTFCAHEYCVSSVDEMEENWIKKMKRLGDFELPDFFSL
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above