gene PH01003057G0020
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003057:8404 - 26961(+ stand)   Name
Alternate name Locus tag PH01003057G0020
Length of gene 18558  bp Length of CDS 4065  bp
Product information
Feature type
CDS
Product name
PX domain containing protein
Alternate name
Molecular weight
(predicted)
149635.26532  kDa
Isoeletric point
(predicted)
9.13871383666992
Length
1354  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_142717 3
Please click OG5_142717 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g50660.1 PX domain containing protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 200 400 600 800 1000 1200 1354
Detailed signature matches
    1. PF02194 (PXA)
    2. PS51207 (PXA)
    1. SM00313 (PXA)
    1. PF08628 (Nexin_C)
    1. PF04844 (Ovate)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 216925 112 290 3.40E-36 pfam02194 PXA cl02564 -
superfamily 243089 112 290 3.40E-36 cl02564 PXA superfamily - -
specific 191110 1294 1353 3.07E-26 pfam04844 Ovate cl04796 -
superfamily 194970 1294 1353 3.07E-26 cl04796 Ovate superfamily - -
specific 149621 782 914 2.48E-20 pfam08628 Nexin_C cl07303 -
superfamily 149621 782 914 2.48E-20 cl07303 Nexin_C superfamily - -
non-specific 130631 1292 1351 3.03E-13 TIGR01568 A_thal_3678 cl04796 -
non-specific 214611 135 290 4.21E-07 smart00313 PXA cl02564 -
non-specific 132782 704 726 0.000411934 cd06872 PX_SNX19_like_plant cl02563 C
superfamily 243088 704 726 0.000411934 cl02563 PX_domain superfamily - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic phosphoinositide binding site 6 0 132782
 
DNA sequence
Upstream 1000 bp region from PH01003057G0020 gene.
TGGTGGAGTACTTATCCATCGCCAAGTTTAGTGACCAGTTAAGATCAAGGTTGAACTAACCGGGCTCTGATACCACTTGTTGGACCGAAAAGGCGACTAGAGGGGGGGTGAATAGGAGCACGATCTCTTTTTCACCTTGATCGAATTCAATACTAATTTCACTCCAATAACTACGAAAGCTATGAAGATCAATATACAAGTATAGCGGAAGACTTGTATTGAATCCAAACAATACCCCGAAGCAAATAGACCTAAGTTACCAAAAACTTAGAGTTAGATGGTCTGACCTCTCACCATAGGCACTCTGACCGATCACCATGGGCGGTCTAACCTCCAAGCCAATGAACAGTAAAACCAGCTCGAACTCAACATCACAAAAGGTCTAACTTTTGATTCGTCACTCCAAACCTTACCAAACTTGAGACATACCTTCTCTAGGATGTTAGGAACTTATTCCAATCAAGGATCATGAAGATCCATGCCAAAGTTCCGACCTTTTTCCGTTTGAGTGAAGGTTGCTCCAAAACTGAGTCAAAACCAAAATATGATCTAGAAACTTGCTCGTGGATGATTGATGATCAAGATGATCCTAGATGTATTCCCACATGTCACAGCAAGCTAAATCTAGGCCAGAAGCCAAAGGAAAACTCGCGGATCAAAGAAAGCCTCAAAATCACAAAATAGAGAGCAAGAACACAAAGAGACTCATCTTGAGAAATCTTTCCTTGGATTGATTTGATATGATGTTGGTTTACAGCTACTCCATCCAGGAGAACAAAGACTCAACACATGGGCACAAAATCAAATCCAACTCTCTAGAACCCTAACCTTCCACTTTCCTCTCTAAGCCCTAAAAACAAACTAGGGTTTTGCTTAGCCAAAGGGTTAAGGGGGTGCAGCCACCACCCTTCTCTATTTATAGTAGAGGCAAACCTTTTAGAAGAGTTTCCTTAATGGGCTCCCATTAAGCCCACACACAAACGGGTTTCACTCACGCACGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGACGACGGGTGGCGCACCGAGGGCGCATACGGTCCGCGACCTAGCAGAGGAAGGGAAGAAGCGGGCCATGCTGCTCCTCGTCTTCGCCTTCGGGCTCGCCTTCCTCATGTCCCTGACAAGCTCTTCAGTTTGGATTAACTTGCCATTTGCCACAGCTTTGATAGTTTTATTTCGCTACATATCACTTGACTACAACTTCCGTAGAAAGAGCACAACTACCACATATGACTATCTCAGTCGTCCACTTGTCAAAACAAAAAGTGTTGAATTAAATAAAATCCCCCCTACTCAAAAGGATGGAGAGTCAGATTGGAGGAGTAGGGTGAATTCGCCTCCAGTTGAAGCTGCATTTGAACAGTTCACAAGGCACCTTGTCACAGAGTGGGTAACAGATTTGTGGTACTCCCGTGTAACACCTGACAAGGAAGGTCCAGAGGATCTCATTAACGTAGTTAATACTGTCCTTGGAGAGATTTCAGTTCGGGCAAGAAGCGTTAACCTTATCACTCTGCTAACCAGGGATCTGATTGATCTTATATGCAATAATTTGGAGCTTTATCATTTCTGTCAAGCCAAGATTGGAAAAGAGAAGTTTGTTAACCTTTCGACAGAGTGTCGTGATGCTGAACTGAAACTGACCCTTATAGCCGAAAACAAGTTGCATCCAGCTCTATTTTCAGCCAGTGCTGAATACAAGGTCTTGCAAAGTCTTGCTGATGGGTTGATCTCAATCACAGTACAGCCTCAGAACCGACAGTGCTCTTTCTTCCGATGTACTGCTCGAGAACTTCTTGCATGTGCAGTTATGAGACCTGTCATGAACTTAGCAAATCCAAGGTTTATAAATGAAAGGATCGAATCTTTGGCTCTTTCTCGTGCCGATAAGGCAGAGAAAGGAGTTGCAGAATCCTTGGAGGATGCTACAATGGTTAAGCAAAAGGAACCTCCTATGCCCTCTGTAGATGAAATTTCTGCACTAATAGATCGCTCAAGTCCAGGGGTTGAACTTGTGCGATTTAGTCAGGGTCAGTACAAAACTGCATCAGATATGCAACTCAGTAAAACTAAAAATCCATCTAGTCTCAAACCAAAACCCCCTAATACCTTTTTGATCAATAGTTCACATCCGCTTGAGTCAAGCAATCTATCTTCCACTTCCCACATGCATTCGGATACTGGTGTTTCATTACACCCCCAAAATAGTGGTAGGACAACTACAGAGAGTCATGGAGGAGAGTGGGCACAGACCTTGGATATCAGCTCCCAACGAAAACATCAAGCTCTAGCACCTGAGCACCTTGAGAATATGTGGACAAAAGGGAAGAATTACAAATTAGAAAAGAAAGTACCTGCCAGATCTTCTTGTCTAGGCACCACTTCTTCAGTGCAGCAGTCAGTTCCCTACAGCACTTCAATTCGGCATCATCCTAGTGTTCCACAAAGGCAAACAGCTTTGTCTCATTCTGAGAACCAGCATTTGATAAAACGGTCAACTACACCTGCATATTCAAATGGCACTAATCACCTGCCAAAAAGTTTATCCGGAGAAATGGCAGAGCATGCCAGCCAAGAAGACGTTGGAATGGACAGTGAGAGTTCATATGCCACTGAGGATGATGAAAATAACAACGTGACTGGCCTTGATTCGCCGGTAACGAGAGTTTGGGATAGCAAAAGTAAAGGAAATGCCACCTCGTCACATATACATCATCCACTTGAATCTTCTGGTCTCCATAAAGCAAAGAAGAATAGAAGTCATGTGGGAAAGTTGAAAATGTCGAGAACTTCAGGAAGAAAGAGGTCAAAGTCAAATGCTCAAAAGACTCCCGTCTGGCAAGAGTTTGAGAGATCATCTTACTTGGAGGATGATGATTTAGACATACTACATACATCAGCAAATGATACAAGGATGGATGGCCTATATGATGATACCGAGGTGGAAACTATGGCTATGATGTTTAGTGGTGTAAATGCTTTGTCTTTATCACTGGCATCAACTGGCCCTTCTTATTCATCAAATTATTCTAGCACTAACGTGTTGGAAGACTCTTATTTGAAGTTAAGATCTGAGGTATCATATTTTCCTGAATTTACTTTGATCCTGGTGGTAGGAGCTAGCATTGTCAAAAGTGGATCTGGCATGTTTGCTGTGTATTCTGTTTCCGTGACCGATGCCAATGGAAATCCTAAGAAAAGGTTGTCAAGTGAAACTGATTACACATATCAAAATTTGGAATCTGATGGACACTCGGTAACTCCTAATGAATGGATGGCCCCAAATCTTAGTGTCCCCTTATTTCATCTGGTTGATGTGGTTTTTCAGCTCCAAGATGGAGACTGGATCAGGCGTCAAGCATTTTGGGTAGCAAAGCAAATACTGCAATTGGGAATGGGAGACACATTTGATGACTGGCTTGTTGAGAAAATCCAGTTACTTAGAAAGGGGAGGATAATTGCTTTTGCAGTTAAGCGTGTTGAACAAATACTCTGGCCAGATGGAATTTTCATGACAAAGCATCCTAAGAGAAAAGCAGTGGCACCGTCGCCTGGTGCCCAGAATAATGGCATGACCAACTATCTGACTGATGAACAACGCCTAGAAGCAGCTCATCGTGCAAATTTTGTCCGTGAATTAATAATAGATAAAGCACCACCTGCACTAGTGAGTCTGGTTGGTCGAAAGGAGTACAAAAGATGTGCTCAGGATATCTACTTCTTTCTTCAGAACAAACAACTCACCGACTGGGAGAAGGCCGAAGGGGAATCGAGGAGTGGCAAGTGGCGACGTAGCAGGGGCATCGGCAACAGGGGGTGGTCGGAGCTGGCGACGAAGAAGGGAGAAGGCGTCGGGGCTGCAGGCGGGAACTGTAGGCTCTCACCTGTTGGCTGTTGCTTTCTTGGTGTTAGTTTCCGCTTGCTTGGATTTAGCTCTGGATCAATGCGCATGAACATGTTTTGGCCTGTAACTGCGCAAGGTGAGGTGCTTCTTCTTCTACTAGTACTCACTACGACGCTGCAAACCCACGCTCGCGAGGAAAACACACATTTGCACACTGTCTTCATGGACAAGCACAGATGCCACGTCAAGGGACGCGACGGAGTCGGCGGGGGCGGCCGGCTAAAGCAGCGACTCGCGCAGATCTTTCTCCACTCCTCCTGCACCACCACCTCGGTCGCCGCCGTAGTCAGCCTCGCCAAGACCAATGCCGCGCCCGAGAATGCGGCCAGCTCGCGCCAAGAACCACCTCCCGCCGCCGGCCCCTGTTCCCACGAACCGAGGCCCAAGATCGACGGCAGCCGTCAGCGTCGGCGCCGGCGCAGCTCTCGGGCTCTTGTGCACATCTCCATCGACTGTTCTGGCACCGGCGCCGCCGACACCACCAGTGCCCGCCGCTCCGCCCGCTCAGTCAGCGCCGCGCTCCTGCCTTCGCCGACGCCAGTCAAGGACGTCAAGGCAGTCAAGATCAAGGCTCGCAATGGAAATGGCAATAAGCCGCTCTCGCCGTCGTACAGCTGCTCGTCCTCCACCGTCACCGACGACGAGCTCGCTACGTTCAGCAGCGACGGGGATAGGGGCGAGGAGGAGGAGGACGAGACGAGGTCGACGCTCTTCTCCTCCCTCGGCTTCTCCTCCGACTCCACCTCGGACTTCTACAACACCACCGGCCACAAGAGCACCAGGTCAAAGCAACACAAGAACCCGCCACGCCGCGTGCCGAGGCGCGCGCCGCCGAGAGGCGCCAAGTCCGCCGACACGTTCCGGCCGGTGGTGTCTTCGCGGGCGACGCCTAAGCACGACAAGGCCGACGCAAACAAGACTGACAAGGACGGCGGCGTCGTGGGCGCGGCGGGCAGCATGGCGGTGGTGAAGCGGTCGCACAACCCGTACGCGGACTTCCGGAGCTCGATGGTGGAGATGGTCGTCGAGCGGCGCATCTGCAGCGCCGACGCCATGGGCGAGCTCCTGGTGTCGTACATGTCCCTCAACTCGCCGCGCCACCACCCGGCCATCCTCGCCGCCTTCGAGGACGTCTGGGAAGCCGTCTTCTTCAGCAAGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003057G0020 gene.
ATAAATCTTTCCACCTTCCTATAGATTTCTTTAATCCTTTACAATATTTTTGTTGTAGTTGGATCCGAATCTCAAACTTCGTTCAGTCCAATCAAGCACCAGATAAATTCCCACCATTCCGCACCACCTTCCTTTAAGTCTCTTTTTGGTTTTATTTACTTGCTTGTTGTTCCCAGCTCATTTCTTGTCGAGCTAGTTTTTACTTGGTTTCTTTTTATTGCTTTGCTTCTCGTTAGGTCACGATCTTGACAATCAGACTCCAGAAGACACCGGACAAGACCAGTATCAACAGGACTTTGTGCAAGAAGGCAAGTTGCATTCCTTGAACATTTTGAACCCACATGTCATATATTTATATTGATACTTTCACTATTGTATTTGAGCCAATTACTGAAATAATACTTTTGAATGCCATGATAATTAGATAATTCCTATTACCCCACATACAAACCCACCCAGCACTTGTAGGCCATATTCACCTTGACAAGTTCACATAAAATATTATCTATATAAGTAGCCTTGTCACACAAATGTGTTTATCAATCAAAAGAGAGTATTGGCAGTTCGCCAATGGTTTTGATGGAGAGTTGAGGGTTGTGTCCAAGAAGTTGGACAACCCAATAGACTTGTGGTAAAAGTGAGTCATCGGTGAGATCTAAAGGTGGACAGTCACGAGTTGGTGCTGGGCCATTGCCTCACTGGATGACAAGTAAGGATAAGAACTTTGTGCCAAATAACAAACACAGAAAATCGCTCAACCACAAGCGTGGTCATTACTCCCTAGCTTAGTACACTGCTCATCCGATTGAATATCTACAAAGAAATATAACTGCTCTTGTGGGATAGAGTAGTTGCGGAACTGGGGTAGGACAGGAGTGGGACGGAAGTGGACACTCGGTAGTCTAAACAACGGTATGGTCCCGTCAGCATCGGGGTGCAAGATCCATAGCGGCAGCCGATGGAGTCTCCCGAGGGCTGTATGGGGTAAAACCTACCGCGTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003057 Download
Protein sequence
Protein sequence
MATTGGAPRAHTVRDLAEEGKKRAMLLLVFAFGLAFLMSLTSSSVWINLPFATALIVLFRYISLDYNFRRKSTTTTYDYLSRPLVKTKSVELNKIPPTQKDGESDWRSRVNSPPVEAAFEQFTRHLVTEWVTDLWYSRVTPDKEGPEDLINVVNTVLGEISVRARSVNLITLLTRDLIDLICNNLELYHFCQAKIGKEKFVNLSTECRDAELKLTLIAENKLHPALFSASAEYKVLQSLADGLISITVQPQNRQCSFFRCTARELLACAVMRPVMNLANPRFINERIESLALSRADKAEKGVAESLEDATMVKQKEPPMPSVDEISALIDRSSPGVELVRFSQGQYKTASDMQLSKTKNPSSLKPKPPNTFLINSSHPLESSNLSSTSHMHSDTGVSLHPQNSGRTTTESHGGEWAQTLDISSQRKHQALAPEHLENMWTKGKNYKLEKKVPARSSCLGTTSSVQQSVPYSTSIRHHPSVPQRQTALSHSENQHLIKRSTTPAYSNGTNHLPKSLSGEMAEHASQEDVGMDSESSYATEDDENNNVTGLDSPVTRVWDSKSKGNATSSHIHHPLESSGLHKAKKNRSHVGKLKMSRTSGRKRSKSNAQKTPVWQEFERSSYLEDDDLDILHTSANDTRMDGLYDDTEVETMAMMFSGVNALSLSLASTGPSYSSNYSSTNVLEDSYLKLRSEVSYFPEFTLILVVGASIVKSGSGMFAVYSVSVTDANGNPKKRLSSETDYTYQNLESDGHSVTPNEWMAPNLSVPLFHLVDVVFQLQDGDWIRRQAFWVAKQILQLGMGDTFDDWLVEKIQLLRKGRIIAFAVKRVEQILWPDGIFMTKHPKRKAVAPSPGAQNNGMTNYLTDEQRLEAAHRANFVRELIIDKAPPALVSLVGRKEYKRCAQDIYFFLQNKQLTDWEKAEGESRSGKWRRSRGIGNRGWSELATKKGEGVGAAGGNCRLSPVGCCFLGVSFRLLGFSSGSMRMNMFWPVTAQGEVLLLLLVLTTTLQTHAREENTHLHTVFMDKHRCHVKGRDGVGGGGRLKQRLAQIFLHSSCTTTSVAAVVSLAKTNAAPENAASSRQEPPPAAGPCSHEPRPKIDGSRQRRRRRSSRALVHISIDCSGTGAADTTSARRSARSVSAALLPSPTPVKDVKAVKIKARNGNGNKPLSPSYSCSSSTVTDDELATFSSDGDRGEEEEDETRSTLFSSLGFSSDSTSDFYNTTGHKSTRSKQHKNPPRRVPRRAPPRGAKSADTFRPVVSSRATPKHDKADANKTDKDGGVVGAAGSMAVVKRSHNPYADFRSSMVEMVVERRICSADAMGELLVSYMSLNSPRHHPAILAAFEDVWEAVFFSK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above