gene PH01003025G0200
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01003025:146977 - 165978(+ stand)   Name
Alternate name Locus tag PH01003025G0200
Length of gene 19002  bp Length of CDS 11661  bp
Product information
Feature type
CDS
Product name
ubiquitin-protein ligase 1
Alternate name
HUWE1, MULE, ARF-BP1
Molecular weight
(predicted)
427038.72912001  kDa
Isoeletric point
(predicted)
4.91821670532226
Length
3886  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127551 4
Please click OG5_127551 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G55860.1
ubiquitin-protein ligase 1
encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis.
ubiquitin-protein ligase 1 (UPL1); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination, ubiquitin-dependent protein catabolic process; LOCATED IN: cytosol, mitochondrion, ubiquitin ligase complex, membrane; EXPRESSED IN: g
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os09g07900.1 ubiquitin-protein ligase 1, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 500 1000 1500 2000 2500 3000 3500 3886
Detailed signature matches
    1. PF06012 (DUF908)
    1. SSF48371 (ARM repeat)
    1. PF06025 (DUF913)
    1. SSF46934 (UBA-like)
    1. PF00627 (UBA)
    1. PS50030 (UBA)
    2. SM00165 (UBA)
    1. PF14377 (DUF4414)
    1. SSF56204 (Hect, E3 ...)
    2. SM00119 (HECTc)
    3. PS50237 (HECT)
    4. PF00632 (HECT)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

GO:0006464 cellular protein modification process

Molecular Function

GO:0004842 ubiquitin-protein ligase activity
GO:0005488 binding
GO:0005515 protein binding

Cellular Component

GO:0005622 intracellular

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Genetic Information Processing Folding, sorting and degradation Ubiquitin mediated proteolysis  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K10592 E3 ubiquitin-protein ligase HUWE1 EC:6.3.2.19
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238033 3357 3734 2.55E-143 cd00078 HECTc cl00077 -
superfamily 241594 3357 3734 2.55E-143 cl00077 HECTc superfamily - -
specific 238116 1282 1320 8.66E-09 cd00194 UBA cl00153 -
superfamily 241643 1282 1320 8.66E-09 cl00153 UBA superfamily - -
specific 218859 416 783 5.77E-129 pfam06025 DUF913 cl15653 -
superfamily 218859 416 783 5.77E-129 cl15653 DUF913 superfamily - -
non-specific 216035 3407 3737 2.86E-104 pfam00632 HECT cl00077 -
specific 222719 2635 2730 1.77E-35 pfam14377 DUF4414 cl16839 -
superfamily 222719 2635 2730 1.77E-35 cl16839 DUF4414 superfamily - -
non-specific 197551 1282 1319 1.28E-06 smart00165 UBA cl00153 -
non-specific 201355 1282 1318 1.85E-06 pfam00627 UBA cl00153 -
multi-dom 214523 3381 3735 7.60E-132 smart00119 HECTc - -
multi-dom 218854 80 360 3.76E-52 pfam06012 DUF908 - -
multi-dom 227354 3334 3734 2.42E-126 COG5021 HUL4 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific E2 interaction site Y3492,N3495,L3496,W3498,M3499,N3502,P3508,L3510,M3514,D3515,D3517,V3529,L3534,Y3551,V3555 15 15 238033
specific catalytic cleft R3363,E3393,E3404,D3464,F3644,L3703,P3704,H3707,T3708,C3709,F3710,N3711,A3731 14 13 238033
specific GFP-loop G1293,F1294,S1295 3 3 238116
specific putative protein-protein interaction site M1292,G1293,F1294,F1319 4 4 238116
 
DNA sequence
Upstream 1000 bp region from PH01003025G0200 gene.
TTGCACTGACACTTCTACTAGCTGGTGTGTCTCGTGTCTGTCAAATATCAGCACCATTTCTTCCGTTACATATCTCATACATGTATAGGATTTTCAAACCATCAGTGTCATGTGCATGTTGGGTCAATGCCATGTGCACAGTGTTTGTCGGAAGCACAAGTCAATCCAGATATGCATTGTCTTTTGTTGATGTGCATTTTCTTGTCGCATGGAACACTGACTTTGTTTTGTTTGTGTTGAATTTATGTTCCCAACATGTGCTATGAATATTTAACTTACAGGAACATATATCATACCCTAATACCCTATGTCCTGTTCATACCCTAATACCCTATGTCCTGTTCCACAATACATTTGGAGAAATACTGTGTTGACATGTGTATGTCATGTAGTGTCAGTGTCATGTGCATGTTGTGTCAATGCCATGTGCACTGTGTTTGTTGGAACTTGGAAGCACAAGTGAATCCAGATATGCATTCTCTTTTGTTGATTTGCATTTTTTGTTGCATGGAACACTGACTTTGTTTTGTTTGTGTTGAATTTATGTTTCCAACACGTGCTATGAATATTTAACTTACAGGAACATACATCATACCCTATGTCCTGTTCCACAATACATTTGGAGAAATACTGTGTTGACATGTGTATGTCATGTAGTGTTCAGTGTCCATGTCCTTGCAACCTATGTATGAACAAGTTATCTTAAAGACAAAACGCAATTGCAAAATTCAATGTGCACTTGCATAATAACGAAATGAGTTTTGAGTAGTTACTATTTGTTCTTGTCAACATTCTAAATACTTTGACCAGTGTGCAGGGCTAAGAAATTGTTATAACTTATAAACTTTATAGGACAAAGTATAAGATATGCTCTCACACTGTTTGATTCAAATTGGATTAGTAGAATCTGCCTTGCTAACATTATTTTTTATTGCAATCTGGCATATCTAGTCTAAATTCAAATGCAATCTATCTTCTATGCTCTATCAAGATTTGAATTC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCATTGTTTTATTTGCAGCCTCCAAATATAAAATCTTTCATCGACAGTGTCACTACCACTCCTCTCAAGAATGTAGAGTTGCCATTGAAAGATTTTGTATGGGAATTTGACAAGGGGGATTTTCATCACTGGGTGGACCTTTTCAATCACTTCGATTCATTTTTTGAGAGTTTTATCAGACCAAGGAAAGATTTACAACTTGAAGACAATTTTCTTGATGTGGATCCCCCATTTCCTAGAGAAGCAATACTTCAAATTCTTCGAGTATCAGGAATAATCTTGGAAAATTGCACAAATAGGCACTTCTACAGTTTCTTTGAGCAGCATCTGTCTGCTCTTCTAGCATCTACAGATGCAGATATTGTTGAAGCAAGCTTGCTGACATTGATGGCATTTGTAAACAAGTCAGTTGGGAAAAGCTCTATCCGTAGTGCTTCCCTCACTTCAAAGTTATTTGCCTTTTCTCAAGGTTGGGGTGGAAAAGAAGGAGGCCTTGGATTAATAGAATGTTCTCTACCCAATGGATGTGATCCAGTTGCCGCTGAGATTGGCTCCACTCTCCATTTTGAGTTCTATCGAGGTGCTGATAAATCAGACAAGTCCCAATCTGTAGACAACGAGCACAGGTTGGAAGTCATTCATTTACCAAATATCAATAGCTACAAGGAGAATAATCTTGAAATATTGGACAAGTTGGTCAAGGATTACAGTGTGCCGTCAACTCTAAGGTTCTCTCTTCTTACAAGATTGAGATTTGCAAGGGCCTTTGACTCTATGACATGTCGACGCCAATACATCTGTATTCGCCTGTATGCTTTTATTGTTCTTGTGCAAGCGATCCATGATTCTGAAGGTCTATCAGTGTTTTTGAACAATGAACCAGAATTCATAGATGAATTGTTATCATTACTAAGCTATGAAGACGAGATACCAGAAAAAAATAGGATATTGGGTATCCGTTCGTTGGTTGCTTTGTGCCAAGATCGATCCCACCAGCCTACTGTATTGTCCTCAGTAACTTCTGGTGGTCATCGTGGTATCCTGCCTAGTCTCATGCAGAAGGCAGTGGATTCTATAATCAATGGTTCTACAAAATCGTCCATAATATTTGCTGAAGAACTTCTCTCACTTGTGTCCATGTTGGTATCATCGACTCCAGGTTCTTTAGCCCTTCAAGAAGCAGGCTTTATACCCACCATTTTACCTCTCCTCAAAGACAAAAACACACAGCATCTACACCTAGTTGATACTGCGGTACATGTCATTGAGGGCTTCTTGGATTATCATAATCCTTCTTCGGCATTGTTCAGAGATCTAGGTGGTCTAGATGATACTATAGCACGCCTTAAAATAGAAGTGGCACAGGTTGAGATTGGTTCGAAGAAATCAGAAGAGTCTCACTCTATTAATAAAGGTAAAGAAGTTGAAAGTAGTTCGCCTGCACCAGATGTGCAGTCTGTTCATTCTGAAGCCTTGATTTCGTATAATCGGAGGAACTTAATGAAAGCTCTACTGCGTACTATATCTTTGGCAACGTATGTGCCTGGTAGCTCTGCCCGTGTTGATGGTTCAGAAGAGACTGTATTGCCCCCTTGTTTATGTACCATTTTTAGGAGAGGCAAGGACTTCGGTGGTGGTGTGTTCTCACTTGCTGCAAATGTCATGAGTGATCTCATACACAAAGATCCAACTTGCTTCACTGTCCTTGATGCAGCTGGTTTGCCGCAAGCATTTCTTGATGCCATCGTGGGTGGTGTTCTTTACAATTCTGATGCTGTCACATGTATACCACAGTGTTTGGATGCATTATGTTTAAACAACAGCGGGCTTCAATTGGTAAAGGACTGCAATGCTTTAAGATGCTTTGTGAAAATCTTTACTTCCAGATCATATTTGAAAGCTCTCGGTGGGGACACAACAGGGGCCTTATCAAGTGGTCTGGATGAATTAATGCGTCATCAATCTTCGCTACGTTCCTCTGGAGTTGACATGCTTATTGAAATCTTGAACTCCATTTCAAAAGTTGGGTGTGGCGGAGAGTCTAGTTCATGTATGGAATCTGATAACCCCTCTACACCAGTTCCCATGGATACTGATGTGGAGGGAGGTACTAAAAGGAGTGAGATTGGAACTTCTGAGGTGGGAAATTCAGGGCAGATGGTTGATGCTTCTCTAGATGTGATGTCATCGTCCTTCGAGTCATTTCTTCCTGAGTGCATATGCAATGTCGCTCGTCTCCTTGAAACTGTTCTGCAAAATTCTGACACATGCAGGCTGTTCATTGAGAAAAAAGGCATTGAAGCCGTTCTTCAACTGTTCAAATTGCCATTAATGCCTGTATCTGTTTCGATTGGACAGAGTATTTCTGTTGCATTTAAAAATTTCTCACCTCAGCATTCTGTTTCTCTTGCTAGAGCAGTTTGCTCATTTTTTAGAGATCATCTTAAGCTGACCAATGAACTGCTGGGTTCAGTGTCTGGAACTAAACTGGTTGATAGTGAACCTGCAAAGGAATCACCTCTCCTGAAAGAACTTTCTAGCCTTGAAGGGCTTTTGTCTCTCGCCAATTTTCTTCTGAAGGGAACTACCATTATGGTGTCAGAACTGGCTTTTGCTGATGCTGAGATATTGAAGGAATTGGGAAAGGTGTATATTGAAGTCACATGGCAGATATCTTTACTTAGTGATTCCAAGGTGGAGAAGCAAGATGCTGAGCAAGATGATGTGCCTGGAGATGCTTTAATCTTGAATACATCTGAAAGGGATAGTGATGATGACACAAATGCAGCACCAGTTGCAAGATATATGAATCCTGTTTCAGTAAGGACTTCTTCTGTATCACCATGGAATATGGAACAAGATTTTGTATCAGCAGTGCGATCTGCTGCCAGCATGCATCGCCATGGTCAGCACACGCTATCAAGGATACGTGGGCGCCTAAGTGGAGCATTGGATGCAACAAATGCAGACATGGAGGGCCCTTTATCTCCAGCAGATAGTTCACGGAGTCATGATACTGTAAAAAAGAGTCCTGATGTTGTTGTTTCTGAACTCCTGACGAAACTTGGATATACAATGTGTTCCTTCCTTTCTACCCTTGTCAAAGGATTGCTGGCTCGCCGTCGTGCTGACTCTAATCTGAGTCCAGCCTCTAGAAGTCTCGTGACTGCGCTTGCACAACTTTTTCTTTCTGCTCTTTGTTACTCTGGACATTCTACTGCGGGATTTGAGATGTCATTATCTGTGAAATGCCGATACCTTGGAAAGGTTGTGGAAGACATGGCTGCACTTACCTTTGACAACAGGCGTCGCTCATGCAGTTCTGCACTAGTTCATAGTTTTTATGTGAATGGAACATTCAAGGAGGTTCTTACTACCTTTGAAGCTACCAGTCAGTTACTATGGACACTTCCTTTCTCTATTCCGACTGCTGGCACAGATCAAGCTTCCTCTATCAGCGAGAAGGTGTCCCACAATTCCTGGCTGCTGGATACGTTACAAAGTTACTGCAAATTGCTGGAATATTACGTGAACTCTACATATTTATTGTCTCCATCCTCTTCTCATAATCAGCTTCTTGTTCAGCCTATTGTCACTGAGCTGTCCATTAATCTATTCCCTGTGCCCTCAGAGCCTGAATCATTCGCTCGTATGCTCCAGTCTCAAGTTCTGGAAGCAGTTCTTCCTGTTTGGAATCATACAATGTTTCCTAGGTGTAGCCCAGATCTGATTACCTCCTTGGTCTCCGTTATAAACCATATATGCTCTGGTGTTGGTGATCTAAAGCAAAGCCGCAGTGGTGTCGGAGCTGCCAACCAACGTCTTACTAGCCCCCCTCTTGATGAGTCTGCTATTGCTACAATTGTTGAGATGGGATTTTCACGAGCTAGGGCAGAAGAAGCCCTGAGAAGTGTCAGAACTAACAGTGTTGAGATGGCGACAGATTGGTTGTTTAGCCATCCAGAAGAATTTGTTCAAGAAGATGTGCAGCTTGCACAGGCGCTAGCTTTGTCACTTGGAAACACCATTGAGACACCCAAGGAGGATGGCAGCAATAAGAATTGTCCAAGTGTAGTGGAAGAGAAAGGTTTGGTTGTGCTCCCTTTGGAGGACATTCTTACTGTATCAACAAAGCTCTTCTGCTCTAGCGATTCCATGGCTTTCCCATTGACTGACCTTCTAGTGACACTGTGCAACCGTCATAAGGGAGAAGACCGTCAGCAGGTAGTACTATATCTTTTTGAGCAATTGAAATGTTTTCCATCAGATTCCTCAATTGATACAGATGCACAATACTCCTTTGCCCGGTTGTTGGCTTTACTTCTGAGTGAAGACAGTAGCGTACGTGAAATTGGTGCAGAAAATGGTGTTATCCCTCATGTTCTTAATATATTGGAAAACTTTAAATCAAGGGCAGAGCAGACCGATCAGATTTGGAATTCTATCAGTGCTTTGTTGCTTATATTAGATAACATGCTCCAGTTTACTCCAAGGCTCAGTATGGAATCGCCGGAAGGGACTTCTAAATCGTCTTCTGATGCATCCAGTGCAGATACCAAGGTAAATCCGTCACCGGCTGCTGAGAAGAGAACTGAAACTGTTGATTCAGCAAAAGATGTAAGTGCTAATGTGTTTGAAAAGATTTTGGGAAAATCCACTGGCTATTTGTCCGACCAGGAGAGTCAAAAGGCACTGACTTTGTGCTGTGAATTCATCAAGCAACATGTGCCGGCAATTGTTATGCAAGCTGTTCTGCAACTCTGTGCCCGCTTGACGAAAACACATATGCTTGCTGCCCAGTTCTTTGAAAATGGTGGCCTTGCATCTCTCTTCAGTCTTCCAAAGACTTGCATCTTTCCTGGATTTGAGACCTTAGCATCTGCCATTGTGCGTCACCTCATTGAGGACCCTCAGACCCTGCAGAGTGCTATGGAACTGGAGATACGGCAGTCATTAAGTCACCGCAGCAGCCGTACCCCACGCTTGTTTCTGACAAATATGTCACCACTGATATCTAGAGATCCTGTCGTCTTCATGAGGGCTGTAACTTCAGTTTGCCAATTAGATTCCTCAGGTGGTAGAATGAATGTAATCCTGTTGAAGGATAAGGAGAAAGAGAAGGATAAACAGAAAGTTTTTTCAACTGAAAGTGGCACACCGTGTAATGAGCCTGTTCGGGTGACTGCTGATATCAAGTCAGTTGATACACCAAACAGGTGTTCACGGAACCATAAAAAGATTCCTACTAGTCTTTCTCAAGTGATTGATCAGCTTCTGGAGATCATTATGAGCTACCCATCCCCAAAGAAAGAACAGGGCTTTGATGGTTCCTCTATGTTGATCCCTATGGATGTTGATGAGCCAAACACAAAGGGAAAGTCGAAAGTTGATGATGGACGTAATCTACATGGTGATGCCCTCTCTGAGAGATCTGCCATGCTGTCAAAATTGGCATTTGTCCTTAAGTTGATGAGTGAGATACTCCTCACGTATATGCATGCAGTAGGGATAATACTGAGACGAGATACAGAGATATCACAGTTACGAGGTGGCGATCAAGGAGCTGGACACAATGGGTTACTGAATCATATATTTCATCTGTTGCTGCCATTATCTTCTGACAAATCTGCTGATGTCTCAGACTATTGGATGGGAAAGTTGTCTGAAAGAACCTCGTGGTTCTTGGTAGCTTTATGTTGCAGATCTGCTGAAGGCCGTAGAAGGGTAATTTCTGAAATTGTAAAGGCATTTTGTTATTTCATAGATTCAGCAAGCAGCACCTCCAGAGGGTCTTTGATACCCGACAAAAAAGTTTTAGCTTTCTCTGAGCTGGTAAATTCAATACTGTCCCAAAATAGTCAGAACAACTTGCCTGTTCTTGGTTGCTCACCTGATATTGCAAAACCTATGATAGATGGTGGAATGGTGCAGTCTCTTTCTGGTTTGCTCAAAGTGATTGACCTGGACCACCCGGATGCTCCAAAGGTTGTCAACCTTATATTGAAGGCTTTGGATAGCCTCACAAGGACTGCAAATGCAAGTGATCAAGTCCTTAAGTCGGATCTGTATACTAAGAATAGAATATCAGGGTCACATGAACAAACACATGAAGCTGATGAAACTGTAATCCATGAACAAAGTACAGACACCAGACATGATACTAATGATACCGTCCAATCTACAAGGCAGGAAGTCGAAGAGCTTTCTCATGTTGATGGGACCAATAACACCACACAAGACCAGCCTGTTGAGCAGGAGATGAGAGTAGATTTGATTGAGAGTATTGCCGGTAACCCTTCAATGGATGGCACGGGGTTCATGCGAGAGGAAATCATTGAAGGTAATGTAATGGCTAGTACCAGTGATGTTGGTTTGGCTTTCCCAGCACAACGTCAAGCTGATGATGAAATGGGTGAGGAGGATGAGGATCTAGGGGAGGATGGTGAGGATGAAGATGATGAGGATGAGGACGAGGAAATAGCAGAAGAGGGAACTGGTTTGATGTCAACAGCTGACACAGATATCGAGGACCAGGAGAACACTGTCATTGGTGATGAATACAACGATGACATGATGGATGAAGAAGATGACGATTTTCTTGAGAACCGTGTTATAGAAGTGAGATGGAGGGAAAGCTTAACTGGAATGGATCATCATCTGAGAGTTTCCAGGGGCCGTGCAGACACAAGTGGTTTTATAGATATCTCTGCGGAAGCATTTCAAGGTATGGGGACTGATGATTCGTTTAATCTGCATCGTCCGTTTGGTCTTGAGCGGCGTCGCCAAAGTGGAAGTAGGCCTTTTCTTGATCGACCAAGGTCTGATGGAAATGCTTTTCAGCATCCACTGCTTGTCAGGCCAGCGCAATCTAGAGAGGGGACTGGTTCAGTATGGCCTTCTAGTGGAACCTCCTCCAGAGATTTGCACACATTGTCTTTTGGGAATGCAGATATCCCCTTGTACATGCTAGATGCTGGGTTTCCACCTGAAACTGCCCCAGTGTTTGGTGAGCGTGTTGTAAGTACTGCACCACCTCCTTTGATAGATTTCTCACTTGGTATGGAATCTCTCCGAATTAGGCGGGGCCCTGGAGACAATCTATGGACTGATGATGGTCAACCTCAGGCTGGTAATCATGCAGCTGCTGTTGCCCAGGCAGTGGAGGATCAATTTGTGTCGCAATTGAATGTTGATAGTTTTTCAAATAATCCTCCTCAGATGCAACCTGAACAGACTGGCAATGATGTAAATGCACAATTACCATCACAAGATACTGACATACCAGAACCTATTGCCACTGATTCCCCTGCTCTACCTATTGGTTGTTCTCAACTATTTGGTACAATCAACCAAGAAGCTGCCCCTGCAAATGATGGTATTTGTCCTATTAATGGACTACCAAGTGTACAGTCACTTGATGTTGCTGATGATCATGTCGAAGAAGAGATTCATCAAACAGCAACTGATGACCTGAATGCTGTACCTCAGAGTAATGAAATAATGTCTACTGCTGACAGACAACCGGATCCTGAAAGGGACTCATTGTCTGGTAATCTACAAAGTTACGATCATATTATGCAGGATGAGGTAGAAGCACCTCAACAGGCACAGATTAGTAATGATCCTAGGGAAACCCCATCTGATTTGGAGTCAAGTTGTCATGCTTGTCTCACTTCCGCAAGTGCAGCACCTGAGCTGAGTGATGCTCATATTGATTCTGCCATAGAGAATACTGATGTTGACATGAATGTCATTGATATTGATGGCAACCAAGTTGAGAACTCGGCTCCTGGTTTGGATGGCAATGATTTGTCAGTAACGCGAGATGAAGGAACTCCTCAAGAGGCTGTTCAACCTGACCAATTGAATGCTAACAATGAGGCATCTAGTACAAATGAAATTGATCCAACATTTCTTGAAGCATTGCCTGAGGATCTCCGTGCAGAAGTCCTTGCTTCTCAGCATAATCGTTCTGCGCCAACTGCTTCCTATACTCGACCAGCTGCGGAAGAAATAGATCCTGAATTTTTGGCTGCTCTTCCACTAGACATACAAGCTGAGGTTTTGGCTCAGCAGCGAGCACAAAGGATTGCTCACTCCCAACCTGTTGGACAGCCAGTTGACATGGATAATGCTTCAATTATAGCAACTTTTCCTCCTGATCTACGTGAAGAGGTGCTTTTGACCTCATCGGAAGCAGTTTTGTCTGCCCTACCTTCAGCTTTACTTGCTGAAGCTCAAATGCTTCGGGACAGAGAATTGAGTCGTTACCGTGCTAGGGGAAGCCTTTTTGGAGGAAGCTACAGGCTTGGAGGAAGGAGGTTACCTGCTGATAATCAGACAGTTATGGACAGGGGTGTCGGTGTGACTGTTGGTAGAAGGGTTATTTCTTCTGCATCAGGTAGCACAAAGAGTAAAGATGTAGAAGGGACCTCACTTTTGGATTCAGATGCCCTAAGAGCGCTTATTCGCCTTCTGCAGCTGGCTCCGCCACTCAGCAAAGGCCTTCTTCAAAGGCTTATGTTCAACCTATGTGTACAGAGTGTTACACGTGTTACCTTGGTTGGCCATTTACTCAACATGATTAAACCTGAAACTGAGGGGCTTAATAGATCGGATTGCATGACTCCATATAGATTACATGGATGCCAGTGGAACATTGTTTATGCACAACCACAATCTGCAAATGGTCTGCCTCCACTTGTGACACGGCGGCTTCTTGAAATTCTGACATACCTTGCTTCAAACCATCCATCTGTTGCGGGCCTTTTGGTTTACTTCAATCCTTCAGCAAGTTCAAACTGTTTGACACTGAAGCATGTTAAAGAGACATCTCAAGAAAGTTCATCATCGGACATGATGCAACCATCTTCAGAGGGTTATACACCTATCCTATTATTCCTTAAGCTCCTAAACAAACCCTTACTTCTACGGAGTCGAGTATATCTTGAGCAGGTGATGTGTTTGCTTGAAGTAGTTGTCAACAATGCTGCCTCCAAAGTCGATTATCCACCTCGTTCAGGGCAAATTGCTAATAATTCTGATGTTGAATTGGTTAATGGGGCACCGACTGAAACGCAGGGGGAACCATCTACTCTGGAGCATGTTCCTACCCAGGAAAATATGCAAATGAAAGATGTTGAGGTGCCAGTCTCGGGTGCCCGTGAGTCTATTAATGTGCATGACATTCTTATTCAGCTTCCCGACTCAGAATTACACAACCTGTGCAATATTCTTGCACTTGAGGGTCTTCCAGATAAAGTGTATTCACTTGCTGCGGAGGTGGTAAAAAAACTTGCTGGTGTTGCGGCATCCCATCGAAAATTCTTCTCTATCGAGCTAGCTGGTGCTGCTCAGAGCTTAAGTTCATCGGCTGTAGAAGAGCTTGTGACATTGAAGAACACACAAATGCTTGGACTCAATTCTTGTTCTATGGCTGGAGCTTCCATCCTGCGTGTATTGCAAGTCCTGTCTACATTGACTTCAGATGTGATTGATATTAGTGGAGATCAAGATGCGGGACAGGAGGAGCAATCTATGTTGTGGAATCTTAATGTAGCACTTGAGCCTTTGTGGCAAGAATTAAGCAACTGTATAAGCACTACAGAGGCGAAACTTGTACACAATTCAACTTTCACTTCTCCTGCCCCTTTGATTGATGCTTTAGAAGTTGGTGCCTCTTCCTCTGCATCCCCACCTCTTCCTCCAGGCACACAACGTCTGTTACCATTTATAGAATCTTTTTTTGTTTTATGCGAAAAGCTTCAAACAAGTCAAGCAGTTATGCAATCAGATTCCAATGTGACTGCTACAGAAGTGAAAGAACTTGGTGCGAGTTCATCGTCACCATCACTAAAGACTGGTGGAATGTGCAATATTACTTTTGTCAGGGTGGCAGAAAGACATCGGCGCCTTCTCAATGTGTTCATTCGACAAAACCCAAGCTTGCTAGAGAAGTCACTTTCTATGATGTTGAAAGTACCAAGGCTGATAGATTTTGACAATAAACGTGCTTACTTCAGATCGCGCATTAGACAGCAACATGATCAGCATCTTTCAGCTCCTTTGCGCATTAGTGTTCGCCGGGCGTATGTTTTGGAGGATTCATACAATCAGTTGAGATTACGTTGTAGCCAGGATCTTAAGGGACGCTTGACTGTACAGTTTCAAGGAGAAGAGGGGATTGATGCTGGAGGACTAACTAGGGAGTGGTACCAACTGCTCTCAAGAGTTACTTTTGACAAAGGAGCTCTGCTCTTCACCACAGTTGGGAATAATGCAACTTTCCAGCCTAACCCCAACTCTGTTTACCAAACAGAGCACCTTTCTTATTTCAAGTTTGTTGGTCGAGTGGTTGCCAAAGCCTTATTTGATGGCCAGTTGTTGGATGTCCACTTTACCCGTTCATTTTACAAACACATCCTTGGTATTAAAGTAACTTATCATGATATAGAGGCTGTCGATCCTGATTACTACAAAAATTTGAAGTGGATGCTGGAGAATGACGTAAGTGATATTCCTGACTTAACATTCAGCATGGACCCCGATGAGGAAAAACATATCCTTTATGAGAAAAACGAGGTTACTGATTATGAGCTCAAACCTGGTGGAAGAAACATCAGGGTCACTGAAGAAACAAAGCATGAATATGTTGACCTTGTGGCTGAGCATATATTGACCACAGCAATTCGTCCTCAAATTAATGCTTTCCTAGAAGGTTTCACAGAACTAGTTCCCAGGGAGCTAATCTCCCTATTTAATGATAAAGAACTTGAACTATTGATCAGTGGTCTTCCTGAAATTGACCTTGATGATCTGAAAGCAAATGCTGAGTATATCGGATATTCTGCTGCATCTCCTGTCATCCAATGGTTTTGGGAAGTAGTTAAAGGATTCAGCAAGGAGGATATGGCAAGATTGCTACAATTTGTGACCGGAACATCAAAAATGTTTTTTTTGTTATTCTTGCCACACCTCACATTGCTTGAGGGGAAAACAGTAGGAAATGATCCTACTGTACCCTTAGAGGGTTTCAAAGCGCTACAAGGTATTTCTGGTCCTCAGAGATTCCAGATTCACAAGGCGTATGGAGCTCCAGAGAGGCTTCCATCTGCCCACACCTGCTTTAACCAACTGGACTTACCAGAGTATTCCTCAAAGGAGCAATTAGAAGAGCGCTTGCTTCTTGCCATCCATGAGGCTAGTGAAGCAAGCACCTCCCGAGATCACCCTCGAACTCCGCCTGCCGCCTCTGCTCCCGTCGGGCCCCTGAGCTCCGCCCCCGAGCCTCTGCTCAGCGCGGCCCGAGCTTCACCCCTGGGGCTCTTTGCTCCTTGCTGCCGGTACCGGAATGGAATTGATAAACTTGGTTTTGATAGGGTGGTACTCTATGACATAGTTTACCAGAAACGCGGACCCATCAAGGATGGTAGGCATTATCTGATGGGTGTTGCTTTAGGACCCATCAAGGATGCTATGGTCCTCTTTAGTGAAATCCACCTCCCATCTCCAAATCAGCGTCATCCATTAAGTCAAGAGTGTCATATTTTGAAGGCAATTGAGACGATGGTAACAGATGCTACACATTACATAGATCAGGCCAAAGAACTTTTAGAGAATGCTCTGGATGAACTTCAGAATCCAAAATTTTTGGAATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01003025G0200 gene.
ATAAATAAGCTCTGGTTTCATGGCATTGCTTGTGGTTGTGGTTGTTTGTTTATCACGTGCTTTCTCGCAAATAGGTTCATGAGCCAAAACAATTTTTATAATGGTGCATGTGAACAGTGTACTGCTGTCGAATGTAGCGAGTAGCGACCGAACCGAGTTGTCTCAATTATCGCGTGCAGTTTGACAAATGTGATTAGATTACTATGTGGTTAGATTACTCTGGTGACTGATGTGTGGTTTCTGCAAATTAAGTATCATTTGGCAGCTTTACTGGATCAGAAACATGTGTATGTAATTTATGCACTTTGTCAGACTCAGGATTATCCTAAATCCTTTGTGTATTTTACGTTAGTCTTTAAAATAATAGATAGTGTACATAGTAAATAAATATGATAATATCTATAATTTGTACAATTTTATTAATAAATATCAGAATTTATTTTTAATTAAATTAATAAAACTAGTGTAAGCATCGACCTAATACTAACTTAAAAACAGGCACTAATCCGGAGCTTCAACACATAATTTTCTCATGTATACTGTCGGGACCTCGGATCCAGGACCCTTTGTGTATATCTGTACTATTCCTTAGATCAGTAGCTAGTGCACACAGTCGCAACATTGGGGTAATCAAAACCGTACACCAAACTATAGATGAAGCAGACAAATTAATATTTAATAGCAAAAGGACCTTATGGTCAAATTTTACGAAGGTTGCCACGCAGGGCTAAAGATAACAGAGTAAACTTGCAGCGGAAAATAAACAAACTCGTGGAAGCCATCCGACATGCCCACAGGTTATTGAGTGGAGAACGCATCCTAGTTCGCATGGTCTTCAGAGTATTCCTCATCCTAGATCCCTGTATTCCTTGGTTCTTCTTTAGCGACTGATCAACCAGAGGGCATAAAGCCGTGAGTACTTTGAATGTACTCAGCAAGTCATAGAGAAATGTATGCAAATAGTATTTATGCAATGTAAGACCCTCAAATATTGGAATGTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01003025 Download
Protein sequence
Protein sequence
MALFYLQPPNIKSFIDSVTTTPLKNVELPLKDFVWEFDKGDFHHWVDLFNHFDSFFESFIRPRKDLQLEDNFLDVDPPFPREAILQILRVSGIILENCTNRHFYSFFEQHLSALLASTDADIVEASLLTLMAFVNKSVGKSSIRSASLTSKLFAFSQGWGGKEGGLGLIECSLPNGCDPVAAEIGSTLHFEFYRGADKSDKSQSVDNEHRLEVIHLPNINSYKENNLEILDKLVKDYSVPSTLRFSLLTRLRFARAFDSMTCRRQYICIRLYAFIVLVQAIHDSEGLSVFLNNEPEFIDELLSLLSYEDEIPEKNRILGIRSLVALCQDRSHQPTVLSSVTSGGHRGILPSLMQKAVDSIINGSTKSSIIFAEELLSLVSMLVSSTPGSLALQEAGFIPTILPLLKDKNTQHLHLVDTAVHVIEGFLDYHNPSSALFRDLGGLDDTIARLKIEVAQVEIGSKKSEESHSINKGKEVESSSPAPDVQSVHSEALISYNRRNLMKALLRTISLATYVPGSSARVDGSEETVLPPCLCTIFRRGKDFGGGVFSLAANVMSDLIHKDPTCFTVLDAAGLPQAFLDAIVGGVLYNSDAVTCIPQCLDALCLNNSGLQLVKDCNALRCFVKIFTSRSYLKALGGDTTGALSSGLDELMRHQSSLRSSGVDMLIEILNSISKVGCGGESSSCMESDNPSTPVPMDTDVEGGTKRSEIGTSEVGNSGQMVDASLDVMSSSFESFLPECICNVARLLETVLQNSDTCRLFIEKKGIEAVLQLFKLPLMPVSVSIGQSISVAFKNFSPQHSVSLARAVCSFFRDHLKLTNELLGSVSGTKLVDSEPAKESPLLKELSSLEGLLSLANFLLKGTTIMVSELAFADAEILKELGKVYIEVTWQISLLSDSKVEKQDAEQDDVPGDALILNTSERDSDDDTNAAPVARYMNPVSVRTSSVSPWNMEQDFVSAVRSAASMHRHGQHTLSRIRGRLSGALDATNADMEGPLSPADSSRSHDTVKKSPDVVVSELLTKLGYTMCSFLSTLVKGLLARRRADSNLSPASRSLVTALAQLFLSALCYSGHSTAGFEMSLSVKCRYLGKVVEDMAALTFDNRRRSCSSALVHSFYVNGTFKEVLTTFEATSQLLWTLPFSIPTAGTDQASSISEKVSHNSWLLDTLQSYCKLLEYYVNSTYLLSPSSSHNQLLVQPIVTELSINLFPVPSEPESFARMLQSQVLEAVLPVWNHTMFPRCSPDLITSLVSVINHICSGVGDLKQSRSGVGAANQRLTSPPLDESAIATIVEMGFSRARAEEALRSVRTNSVEMATDWLFSHPEEFVQEDVQLAQALALSLGNTIETPKEDGSNKNCPSVVEEKGLVVLPLEDILTVSTKLFCSSDSMAFPLTDLLVTLCNRHKGEDRQQVVLYLFEQLKCFPSDSSIDTDAQYSFARLLALLLSEDSSVREIGAENGVIPHVLNILENFKSRAEQTDQIWNSISALLLILDNMLQFTPRLSMESPEGTSKSSSDASSADTKVNPSPAAEKRTETVDSAKDVSANVFEKILGKSTGYLSDQESQKALTLCCEFIKQHVPAIVMQAVLQLCARLTKTHMLAAQFFENGGLASLFSLPKTCIFPGFETLASAIVRHLIEDPQTLQSAMELEIRQSLSHRSSRTPRLFLTNMSPLISRDPVVFMRAVTSVCQLDSSGGRMNVILLKDKEKEKDKQKVFSTESGTPCNEPVRVTADIKSVDTPNRCSRNHKKIPTSLSQVIDQLLEIIMSYPSPKKEQGFDGSSMLIPMDVDEPNTKGKSKVDDGRNLHGDALSERSAMLSKLAFVLKLMSEILLTYMHAVGIILRRDTEISQLRGGDQGAGHNGLLNHIFHLLLPLSSDKSADVSDYWMGKLSERTSWFLVALCCRSAEGRRRVISEIVKAFCYFIDSASSTSRGSLIPDKKVLAFSELVNSILSQNSQNNLPVLGCSPDIAKPMIDGGMVQSLSGLLKVIDLDHPDAPKVVNLILKALDSLTRTANASDQVLKSDLYTKNRISGSHEQTHEADETVIHEQSTDTRHDTNDTVQSTRQEVEELSHVDGTNNTTQDQPVEQEMRVDLIESIAGNPSMDGTGFMREEIIEGNVMASTSDVGLAFPAQRQADDEMGEEDEDLGEDGEDEDDEDEDEEIAEEGTGLMSTADTDIEDQENTVIGDEYNDDMMDEEDDDFLENRVIEVRWRESLTGMDHHLRVSRGRADTSGFIDISAEAFQGMGTDDSFNLHRPFGLERRRQSGSRPFLDRPRSDGNAFQHPLLVRPAQSREGTGSVWPSSGTSSRDLHTLSFGNADIPLYMLDAGFPPETAPVFGERVVSTAPPPLIDFSLGMESLRIRRGPGDNLWTDDGQPQAGNHAAAVAQAVEDQFVSQLNVDSFSNNPPQMQPEQTGNDVNAQLPSQDTDIPEPIATDSPALPIGCSQLFGTINQEAAPANDGICPINGLPSVQSLDVADDHVEEEIHQTATDDLNAVPQSNEIMSTADRQPDPERDSLSGNLQSYDHIMQDEVEAPQQAQISNDPRETPSDLESSCHACLTSASAAPELSDAHIDSAIENTDVDMNVIDIDGNQVENSAPGLDGNDLSVTRDEGTPQEAVQPDQLNANNEASSTNEIDPTFLEALPEDLRAEVLASQHNRSAPTASYTRPAAEEIDPEFLAALPLDIQAEVLAQQRAQRIAHSQPVGQPVDMDNASIIATFPPDLREEVLLTSSEAVLSALPSALLAEAQMLRDRELSRYRARGSLFGGSYRLGGRRLPADNQTVMDRGVGVTVGRRVISSASGSTKSKDVEGTSLLDSDALRALIRLLQLAPPLSKGLLQRLMFNLCVQSVTRVTLVGHLLNMIKPETEGLNRSDCMTPYRLHGCQWNIVYAQPQSANGLPPLVTRRLLEILTYLASNHPSVAGLLVYFNPSASSNCLTLKHVKETSQESSSSDMMQPSSEGYTPILLFLKLLNKPLLLRSRVYLEQVMCLLEVVVNNAASKVDYPPRSGQIANNSDVELVNGAPTETQGEPSTLEHVPTQENMQMKDVEVPVSGARESINVHDILIQLPDSELHNLCNILALEGLPDKVYSLAAEVVKKLAGVAASHRKFFSIELAGAAQSLSSSAVEELVTLKNTQMLGLNSCSMAGASILRVLQVLSTLTSDVIDISGDQDAGQEEQSMLWNLNVALEPLWQELSNCISTTEAKLVHNSTFTSPAPLIDALEVGASSSASPPLPPGTQRLLPFIESFFVLCEKLQTSQAVMQSDSNVTATEVKELGASSSSPSLKTGGMCNITFVRVAERHRRLLNVFIRQNPSLLEKSLSMMLKVPRLIDFDNKRAYFRSRIRQQHDQHLSAPLRISVRRAYVLEDSYNQLRLRCSQDLKGRLTVQFQGEEGIDAGGLTREWYQLLSRVTFDKGALLFTTVGNNATFQPNPNSVYQTEHLSYFKFVGRVVAKALFDGQLLDVHFTRSFYKHILGIKVTYHDIEAVDPDYYKNLKWMLENDVSDIPDLTFSMDPDEEKHILYEKNEVTDYELKPGGRNIRVTEETKHEYVDLVAEHILTTAIRPQINAFLEGFTELVPRELISLFNDKELELLISGLPEIDLDDLKANAEYIGYSAASPVIQWFWEVVKGFSKEDMARLLQFVTGTSKMFFLLFLPHLTLLEGKTVGNDPTVPLEGFKALQGISGPQRFQIHKAYGAPERLPSAHTCFNQLDLPEYSSKEQLEERLLLAIHEASEASTSRDHPRTPPAASAPVGPLSSAPEPLLSAARASPLGLFAPCCRYRNGIDKLGFDRVVLYDIVYQKRGPIKDGRHYLMGVALGPIKDAMVLFSEIHLPSPNQRHPLSQECHILKAIETMVTDATHYIDQAKELLENALDELQNPKFLE
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above