gene PH01002850G0100
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002850:81883 - 88045(+ stand)   Name
Alternate name Locus tag PH01002850G0100
Length of gene 6163  bp Length of CDS 2931  bp
Product information
Feature type
CDS
Product name
expressed_protein
Alternate name
Molecular weight
(predicted)
109758.101819999  kDa
Isoeletric point
(predicted)
6.60888290405273
Length
976  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_170272 2
Please click OG5_170272 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g53250.1 expressed protein 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
1 100 200 300 400 500 600 700 800 900 976
Detailed signature matches
    1. PF14381 (EDR1)
    1. SSF56112 (Protein k...)
    1. PF00069 (Pkinase)
    2. PS50011 (PROTEIN_KI...)
    1. SM00220 (S_TKc)
    1. PS00108 (PROTEIN_KI...)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0004674 protein serine/threonine kinase activity
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173623 752 915 8.06E-27 cd00180 PKc cl09925 N
superfamily 245201 752 915 8.06E-27 cl09925 PKc_like superfamily - N
specific 173623 576 752 1.49E-22 cd00180 PKc cl09925 -
superfamily 245201 576 752 1.49E-22 cl09925 PKc_like superfamily - -
non-specific 173660 750 903 1.33E-23 cd05123 STKc_AGC cl09925 N
non-specific 173724 750 887 8.86E-23 cd06606 STKc_MAPKKK cl09925 NC
non-specific 173659 770 887 3.87E-22 cd05122 PKc_STE cl09925 NC
non-specific 173724 577 739 3.99E-21 cd06606 STKc_MAPKKK cl09925 C
non-specific 173755 749 906 5.38E-21 cd08215 STKc_Nek cl09925 N
non-specific 173691 769 925 2.08E-19 cd05600 STKc_Sid2p_Dbf2p cl09925 NC
non-specific 173728 770 960 4.93E-19 cd06614 STKc_PAK cl09925 N
non-specific 173688 747 905 7.51E-19 cd05597 STKc_DMPK_like cl09925 NC
non-specific 173725 580 741 8.80E-19 cd06608 STKc_myosinIII_like cl09925 C
non-specific 173726 771 962 1.37E-18 cd06610 STKc_OSR1_SPAK cl09925 N
non-specific 173733 752 900 6.00E-18 cd07829 STKc_CDK_like cl09925 NC
non-specific 173672 769 900 7.68E-18 cd05581 STKc_PDK1 cl09925 N
non-specific 173664 769 881 8.25E-18 cd05573 STKc_ROCK_NDR_like cl09925 NC
non-specific 173713 724 905 1.06E-17 cd05624 STKc_MRCK_beta cl09925 C
non-specific 88524 750 905 2.54E-17 cd05623 STKc_MRCK_alpha cl09925 NC
non-specific 173659 543 784 2.83E-17 cd05122 PKc_STE cl09925 -
non-specific 132963 773 887 6.01E-17 cd06632 STKc_MEKK1_plant cl09925 NC
non-specific 132991 750 925 9.31E-17 cd06917 STKc_NAK1_like cl09925 N
non-specific 173755 578 739 1.21E-16 cd08215 STKc_Nek cl09925 C
non-specific 132940 755 890 1.55E-16 cd06609 STKc_MST3_like cl09925 NC
non-specific 173757 749 906 1.99E-16 cd08217 STKc_Nek2 cl09925 N
non-specific 173669 769 919 2.40E-16 cd05578 STKc_Yank1 cl09925 N
non-specific 173723 750 962 2.46E-16 cd06605 PKc_MAPKK cl09925 N
non-specific 173725 752 880 3.20E-16 cd06608 STKc_myosinIII_like cl09925 NC
non-specific 173731 539 739 6.84E-16 cd06627 STKc_Cdc7_like cl09925 C
non-specific 173731 768 890 7.88E-16 cd06627 STKc_Cdc7_like cl09925 NC
non-specific 173728 547 748 1.31E-15 cd06614 STKc_PAK cl09925 C
non-specific 173688 571 748 2.39E-15 cd05597 STKc_DMPK_like cl09925 C
non-specific 173692 735 887 2.91E-15 cd05601 STKc_CRIK cl09925 C
non-specific 132957 778 894 3.57E-15 cd06626 STKc_MEKK4 cl09925 NC
non-specific 132954 749 888 4.42E-15 cd06623 PKc_MAPKK_plant_like cl09925 NC
non-specific 222722 253 474 4.52E-15 pfam14381 EDR1 cl18686 -
superfamily 222722 253 474 4.52E-15 cl18686 EDR1 superfamily - -
non-specific 173661 769 907 5.52E-15 cd05570 STKc_PKC cl09925 NC
non-specific 173660 622 739 9.45E-15 cd05123 STKc_AGC cl09925 NC
non-specific 173687 768 887 9.96E-15 cd05596 STKc_ROCK cl09925 NC
non-specific 173668 766 888 1.14E-14 cd05577 STKc_GRK cl09925 NC
non-specific 132956 773 964 1.19E-14 cd06625 STKc_MEKK3_like cl09925 N
non-specific 173710 768 932 1.24E-14 cd05620 STKc_nPKC_delta cl09925 NC
non-specific 173683 769 899 1.47E-14 cd05592 STKc_nPKC_theta_delta cl09925 NC
non-specific 132963 576 749 1.53E-14 cd06632 STKc_MEKK1_plant cl09925 C
non-specific 173764 749 964 1.91E-14 cd08224 STKc_Nek6_Nek7 cl09925 N
non-specific 173663 769 899 2.50E-14 cd05572 STKc_cGK_PKG cl09925 NC
non-specific 173709 768 900 2.70E-14 cd05619 STKc_nPKC_theta cl09925 NC
non-specific 173672 525 738 2.87E-14 cd05581 STKc_PDK1 cl09925 C
non-specific 132942 770 906 3.96E-14 cd06611 STKc_SLK_like cl09925 N
non-specific 173769 749 965 4.23E-14 cd08229 STKc_Nek7 cl09925 N
non-specific 173757 577 741 4.40E-14 cd08217 STKc_Nek2 cl09925 C
non-specific 173727 748 910 5.08E-14 cd06613 STKc_MAP4K3_like cl09925 N
non-specific 132943 782 902 5.11E-14 cd06612 STKc_MST1_2 cl09925 N
non-specific 132979 770 887 6.79E-14 cd06648 STKc_PAK_II cl09925 NC
non-specific 132978 771 887 6.92E-14 cd06647 STKc_PAK_I cl09925 NC
non-specific 173675 769 915 7.00E-14 cd05584 STKc_p70S6K cl09925 NC
non-specific 132940 621 739 7.15E-14 cd06609 STKc_MST3_like cl09925 NC
non-specific 173664 621 741 7.20E-14 cd05573 STKc_ROCK_NDR_like cl09925 NC
non-specific 173624 749 901 8.70E-14 cd00192 PTKc cl09925 N
non-specific 173703 769 899 9.57E-14 cd05612 STKc_PRKX_like cl09925 NC
non-specific 173772 749 925 1.01E-13 cd08530 STKc_CNK2-like cl09925 N
non-specific 173624 565 700 1.28E-13 cd00192 PTKc cl09925 C
non-specific 132991 542 739 1.34E-13 cd06917 STKc_NAK1_like cl09925 C
non-specific 132960 766 912 1.59E-13 cd06629 STKc_MAPKKK_Bck1_like cl09925 N
non-specific 143345 752 899 1.73E-13 cd07840 STKc_CDK9_like cl09925 NC
non-specific 173702 770 903 1.99E-13 cd05611 STKc_Rim15_like cl09925 N
non-specific 132961 773 899 2.16E-13 cd06630 STKc_MEKK1 cl09925 N
non-specific 173690 769 881 3.03E-13 cd05599 STKc_NDR_like cl09925 NC
non-specific 173670 769 903 3.67E-13 cd05579 STKc_MAST_like cl09925 N
non-specific 173689 764 901 3.86E-13 cd05598 STKc_LATS cl09925 NC
non-specific 173665 750 889 4.69E-13 cd05574 STKc_phototropin_like cl09925 NC
non-specific 173711 763 887 6.46E-13 cd05621 STKc_ROCK2 cl09925 NC
non-specific 173673 766 903 6.59E-13 cd05582 STKc_RSK_N cl09925 NC
non-specific 173726 537 746 8.09E-13 cd06610 STKc_OSR1_SPAK cl09925 C
non-specific 132969 525 738 1.05E-12 cd06638 STKc_myosinIIIA cl09925 C
non-specific 173671 769 899 1.08E-12 cd05580 STKc_PKA cl09925 NC
non-specific 173681 769 899 1.11E-12 cd05590 STKc_nPKC_eta cl09925 NC
non-specific 173730 767 887 1.18E-12 cd06624 STKc_ASK cl09925 NC
non-specific 132938 746 887 1.20E-12 cd06607 STKc_TAO cl09925 NC
non-specific 132954 539 743 1.33E-12 cd06623 PKc_MAPKK_plant_like cl09925 C
non-specific 132983 772 887 1.43E-12 cd06652 STKc_MEKK2 cl09925 NC
non-specific 173669 568 740 1.64E-12 cd05578 STKc_Yank1 cl09925 C
non-specific 173682 768 899 1.74E-12 cd05591 STKc_nPKC_epsilon cl09925 NC
non-specific 173759 774 888 1.83E-12 cd08219 STKc_Nek3 cl09925 NC
non-specific 173712 763 887 2.27E-12 cd05622 STKc_ROCK1 cl09925 NC
non-specific 132990 771 906 2.48E-12 cd06659 STKc_PAK6 cl09925 NC
non-specific 173760 778 906 2.49E-12 cd08220 STKc_Nek8 cl09925 N
non-specific 173703 525 752 2.57E-12 cd05612 STKc_PRKX_like cl09925 C
non-specific 173691 623 740 2.72E-12 cd05600 STKc_Sid2p_Dbf2p cl09925 NC
non-specific 173732 773 887 2.76E-12 cd06628 STKc_MAPKKK_Byr2_like cl09925 NC
non-specific 143333 752 900 3.23E-12 cd05118 STKc_CMGC cl09925 NC
non-specific 173678 768 899 3.62E-12 cd05587 STKc_cPKC cl09925 NC
non-specific 173727 579 739 3.83E-12 cd06613 STKc_MAP4K3_like cl09925 C
non-specific 88524 573 748 4.06E-12 cd05623 STKc_MRCK_alpha cl09925 C
non-specific 173666 760 907 4.33E-12 cd05575 STKc_SGK cl09925 NC
non-specific 173761 754 884 4.62E-12 cd08221 STKc_Nek9 cl09925 NC
non-specific 143338 752 882 6.23E-12 cd07833 STKc_CDKL cl09925 NC
non-specific 173765 774 889 7.03E-12 cd08225 STKc_Nek5 cl09925 NC
non-specific 132982 773 887 7.91E-12 cd06651 STKc_MEKK3 cl09925 NC
non-specific 132956 566 738 8.94E-12 cd06625 STKc_MEKK3_like cl09925 C
non-specific 173677 755 913 9.42E-12 cd05586 STKc_Sck1_like cl09925 NC
non-specific 173729 760 887 1.13E-11 cd06617 PKc_MKK3_6 cl09925 NC
non-specific 173760 539 737 1.17E-11 cd08220 STKc_Nek8 cl09925 C
non-specific 173671 580 744 1.49E-11 cd05580 STKc_PKA cl09925 C
non-specific 173713 621 748 1.50E-11 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 173680 769 899 1.91E-11 cd05589 STKc_PKN cl09925 NC
non-specific 173686 766 928 2.38E-11 cd05595 STKc_PKB_beta cl09925 NC
non-specific 143371 779 899 2.96E-11 cd07866 STKc_BUR1 cl09925 NC
non-specific 132988 778 908 3.51E-11 cd06657 STKc_PAK4 cl09925 N
non-specific 173662 769 925 3.55E-11 cd05571 STKc_PKB cl09925 NC
non-specific 132957 549 737 4.07E-11 cd06626 STKc_MEKK4 cl09925 C
non-specific 173706 768 899 4.46E-11 cd05615 STKc_cPKC_alpha cl09925 NC
non-specific 132987 771 887 4.55E-11 cd06656 STKc_PAK3 cl09925 NC
non-specific 132989 778 915 4.93E-11 cd06658 STKc_PAK5 cl09925 N
non-specific 132946 750 886 5.98E-11 cd06615 PKc_MEK cl09925 NC
non-specific 173689 609 738 6.20E-11 cd05598 STKc_LATS cl09925 C
non-specific 132985 771 887 7.35E-11 cd06654 STKc_PAK1 cl09925 NC
non-specific 173707 768 899 7.65E-11 cd05616 STKc_cPKC_beta cl09925 NC
non-specific 132984 773 887 7.66E-11 cd06653 STKc_MEKK3_like_1 cl09925 NC
non-specific 173768 749 889 8.70E-11 cd08228 STKc_Nek6 cl09925 NC
non-specific 132978 621 827 9.18E-11 cd06647 STKc_PAK_I cl09925 N
non-specific 132986 771 887 9.54E-11 cd06655 STKc_PAK2 cl09925 NC
non-specific 132967 545 738 9.88E-11 cd06636 STKc_MAP4K4_6 cl09925 C
non-specific 173708 760 893 1.00E-10 cd05617 STKc_aPKC_zeta cl09925 NC
non-specific 173692 609 749 1.04E-10 cd05601 STKc_CRIK cl09925 NC
non-specific 132967 748 880 1.19E-10 cd06636 STKc_MAP4K4_6 cl09925 NC
non-specific 132952 771 917 1.48E-10 cd06621 PKc_MAPKK_Pek1_like cl09925 N
non-specific 173723 620 748 1.56E-10 cd06605 PKc_MAPKK cl09925 NC
non-specific 173679 760 897 1.62E-10 cd05588 STKc_aPKC cl09925 NC
non-specific 132949 752 889 1.72E-10 cd06618 PKc_MKK7 cl09925 NC
non-specific 173734 743 884 2.21E-10 cd07830 STKc_MAK_like cl09925 NC
non-specific 132974 771 906 3.21E-10 cd06643 STKc_SLK cl09925 NC
non-specific 173758 774 884 3.28E-10 cd08218 STKc_Nek1 cl09925 NC
non-specific 132975 771 919 3.36E-10 cd06644 STKc_STK10_LOK cl09925 N
non-specific 173771 750 887 3.97E-10 cd08529 STKc_FA2-like cl09925 NC
non-specific 132951 750 906 4.50E-10 cd06620 PKc_MAPKK_Byr1_like cl09925 N
non-specific 132976 770 917 5.30E-10 cd06645 STKc_MAP4K3 cl09925 N
non-specific 132968 748 880 5.83E-10 cd06637 STKc_TNIK cl09925 NC
non-specific 173687 595 748 6.84E-10 cd05596 STKc_ROCK cl09925 NC
non-specific 173675 589 739 7.48E-10 cd05584 STKc_p70S6K cl09925 C
non-specific 173699 769 888 8.44E-10 cd05608 STKc_GRK1 cl09925 NC
non-specific 132943 621 739 8.81E-10 cd06612 STKc_MST1_2 cl09925 NC
non-specific 173696 768 915 8.95E-10 cd05605 STKc_GRK4_like cl09925 NC
non-specific 173721 768 915 9.60E-10 cd05632 STKc_GRK5 cl09925 NC
non-specific 132968 545 738 9.77E-10 cd06637 STKc_TNIK cl09925 C
non-specific 143346 778 895 1.05E-09 cd07841 STKc_CDK7 cl09925 NC
non-specific 132964 746 886 1.10E-09 cd06633 STKc_TAO3 cl09925 NC
non-specific 173670 621 738 1.13E-09 cd05579 STKc_MAST_like cl09925 NC
non-specific 173751 783 900 1.20E-09 cd07860 STKc_CDK2_3 cl09925 NC
non-specific 173693 768 909 1.22E-09 cd05602 STKc_SGK1 cl09925 NC
non-specific 132966 746 886 1.23E-09 cd06635 STKc_TAO1 cl09925 NC
non-specific 173698 759 927 1.26E-09 cd05607 STKc_GRK7 cl09925 N
non-specific 173695 769 920 1.45E-09 cd05604 STKc_SGK3 cl09925 NC
non-specific 132962 782 891 1.51E-09 cd06631 STKc_YSK4 cl09925 NC
non-specific 132942 553 746 1.75E-09 cd06611 STKc_SLK_like cl09925 C
non-specific 173694 768 902 1.85E-09 cd05603 STKc_SGK2 cl09925 NC
non-specific 173738 783 900 1.99E-09 cd07835 STKc_CDK1_like cl09925 NC
non-specific 173685 766 907 2.07E-09 cd05594 STKc_PKB_alpha cl09925 NC
non-specific 173752 783 900 2.36E-09 cd07861 STKc_CDK1_euk cl09925 NC
non-specific 132979 589 738 2.60E-09 cd06648 STKc_PAK_II cl09925 NC
non-specific 173684 769 899 2.67E-09 cd05593 STKc_PKB_gamma cl09925 NC
non-specific 173714 764 887 2.90E-09 cd05625 STKc_LATS1 cl09925 NC
non-specific 173732 525 742 2.99E-09 cd06628 STKc_MAPKKK_Byr2_like cl09925 C
non-specific 88519 760 887 3.00E-09 cd05618 STKc_aPKC_iota cl09925 NC
non-specific 173702 559 746 3.07E-09 cd05611 STKc_Rim15_like cl09925 C
non-specific 133172 752 905 3.54E-09 cd05040 PTKc_Ack_like cl09925 N
non-specific 132938 533 747 3.57E-09 cd06607 STKc_TAO cl09925 C
non-specific 173676 769 906 3.78E-09 cd05585 STKc_YPK1_like cl09925 NC
non-specific 173634 772 912 3.90E-09 cd05053 PTKc_FGFR cl09925 N
non-specific 173743 782 958 4.21E-09 cd07846 STKc_CDKL2_3 cl09925 N
non-specific 173719 768 888 5.20E-09 cd05630 STKc_GRK6 cl09925 NC
non-specific 132970 555 751 5.23E-09 cd06639 STKc_myosinIIIB cl09925 C
non-specific 132977 770 913 5.72E-09 cd06646 STKc_MAP4K5 cl09925 N
non-specific 132965 746 886 6.68E-09 cd06634 STKc_TAO2 cl09925 NC
non-specific 173700 763 896 6.98E-09 cd05609 STKc_MAST cl09925 NC
non-specific 173761 578 739 7.42E-09 cd08221 STKc_Nek9 cl09925 C
non-specific 173674 769 887 7.77E-09 cd05583 STKc_MSK_N cl09925 NC
non-specific 173711 556 748 8.94E-09 cd05621 STKc_ROCK2 cl09925 C
non-specific 132952 539 739 9.02E-09 cd06621 PKc_MAPKK_Pek1_like cl09925 C
non-specific 173739 762 899 9.14E-09 cd07838 STKc_CDK4_6_like cl09925 NC
non-specific 143342 782 900 9.95E-09 cd07837 STKc_CdkB_plant cl09925 NC
non-specific 173735 777 889 1.12E-08 cd07831 STKc_MOK cl09925 NC
non-specific 133229 772 900 1.25E-08 cd05098 PTKc_FGFR1 cl09925 N
non-specific 173668 621 739 1.32E-08 cd05577 STKc_GRK cl09925 NC
non-specific 173747 770 882 1.34E-08 cd07852 STKc_MAPK15 cl09925 NC
non-specific 173730 577 750 1.42E-08 cd06624 STKc_ASK cl09925 C
non-specific 132973 748 901 1.53E-08 cd06642 STKc_STK25-YSK1 cl09925 NC
non-specific 132987 621 827 1.81E-08 cd06656 STKc_PAK3 cl09925 N
non-specific 173665 614 737 1.87E-08 cd05574 STKc_phototropin_like cl09925 NC
non-specific 133230 772 912 2.17E-08 cd05099 PTKc_FGFR4 cl09925 N
non-specific 173682 622 741 2.18E-08 cd05591 STKc_nPKC_epsilon cl09925 NC
non-specific 173736 782 881 2.31E-08 cd07832 STKc_CCRK cl09925 NC
non-specific 173663 611 739 3.05E-08 cd05572 STKc_cGK_PKG cl09925 NC
non-specific 173690 611 739 3.25E-08 cd05599 STKc_NDR_like cl09925 C
non-specific 132985 621 827 3.33E-08 cd06654 STKc_PAK1 cl09925 N
non-specific 173712 552 748 3.55E-08 cd05622 STKc_ROCK1 cl09925 C
non-specific 132950 771 962 3.66E-08 cd06619 PKc_MKK5 cl09925 N
non-specific 143368 751 899 4.55E-08 cd07863 STKc_CDK4 cl09925 NC
non-specific 173714 609 738 4.57E-08 cd05625 STKc_LATS1 cl09925 C
non-specific 173661 623 753 4.75E-08 cd05570 STKc_PKC cl09925 NC
non-specific 173770 749 887 5.39E-08 cd08528 STKc_Nek10 cl09925 NC
non-specific 173633 750 906 5.40E-08 cd05052 PTKc_Abl cl09925 N
non-specific 132953 750 957 5.59E-08 cd06622 PKc_MAPKK_PBS2_like cl09925 N
non-specific 133248 770 907 6.06E-08 cd05148 PTKc_Srm_Brk cl09925 N
non-specific 173744 755 882 6.57E-08 cd07847 STKc_CDKL1_4 cl09925 NC
non-specific 143349 783 894 7.12E-08 cd07844 STKc_PCTAIRE_like cl09925 NC
non-specific 173771 621 739 7.84E-08 cd08529 STKc_FA2-like cl09925 NC
non-specific 173652 772 900 7.99E-08 cd05100 PTKc_FGFR3 cl09925 NC
non-specific 173720 768 902 8.52E-08 cd05631 STKc_GRK4 cl09925 NC
non-specific 173759 621 758 8.91E-08 cd08219 STKc_Nek3 cl09925 NC
non-specific 132969 755 880 9.26E-08 cd06638 STKc_myosinIIIA cl09925 NC
non-specific 173678 622 738 1.04E-07 cd05587 STKc_cPKC cl09925 NC
non-specific 173666 622 738 1.11E-07 cd05575 STKc_SGK cl09925 NC
non-specific 173763 774 902 1.11E-07 cd08223 STKc_Nek4 cl09925 N
non-specific 173737 777 889 1.24E-07 cd07834 STKc_MAPK cl09925 NC
non-specific 173697 766 890 1.28E-07 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173740 782 906 1.34E-07 cd07842 STKc_CDK8_like cl09925 NC
non-specific 133175 723 910 1.39E-07 cd05043 PTK_Ryk cl09925 N
non-specific 132986 621 827 1.42E-07 cd06655 STKc_PAK2 cl09925 N
non-specific 173683 622 739 1.43E-07 cd05592 STKc_nPKC_theta_delta cl09925 NC
non-specific 132980 750 886 1.51E-07 cd06649 PKc_MEK2 cl09925 NC
non-specific 173715 769 887 1.67E-07 cd05626 STKc_LATS2 cl09925 NC
non-specific 143381 770 889 1.67E-07 cd07876 STKc_JNK2 cl09925 NC
non-specific 173704 774 947 1.68E-07 cd05613 STKc_MSK1_N cl09925 N
non-specific 173657 750 911 1.70E-07 cd05113 PTKc_Btk_Bmx cl09925 N
non-specific 173705 774 887 1.78E-07 cd05614 STKc_MSK2_N cl09925 NC
non-specific 132972 771 901 1.80E-07 cd06641 STKc_MST3 cl09925 NC
non-specific 173681 622 748 1.82E-07 cd05590 STKc_nPKC_eta cl09925 NC
non-specific 173772 621 739 2.03E-07 cd08530 STKc_CNK2-like cl09925 NC
non-specific 173734 574 700 2.18E-07 cd07830 STKc_MAK_like cl09925 C
non-specific 173627 620 710 2.25E-07 cd05037 PTK_Jak_rpt1 cl09925 NC
non-specific 132971 748 880 2.66E-07 cd06640 STKc_MST4 cl09925 NC
non-specific 173626 750 907 2.95E-07 cd05034 PTKc_Src_like cl09925 N
non-specific 132982 544 738 3.01E-07 cd06651 STKc_MEKK3 cl09925 C
non-specific 173722 766 888 3.34E-07 cd05633 STKc_GRK3 cl09925 NC
non-specific 133186 774 901 3.44E-07 cd05055 PTKc_PDGFR cl09925 N
non-specific 132947 759 889 3.58E-07 cd06616 PKc_MKK4 cl09925 NC
non-specific 132990 557 738 3.76E-07 cd06659 STKc_PAK6 cl09925 C
non-specific 132981 779 899 4.18E-07 cd06650 PKc_MEK1 cl09925 NC
non-specific 132961 547 748 4.19E-07 cd06630 STKc_MEKK1 cl09925 C
non-specific 133200 748 906 4.27E-07 cd05069 PTKc_Yes cl09925 N
non-specific 173718 769 881 4.75E-07 cd05629 STKc_NDR_like_fungal cl09925 NC
non-specific 132960 621 755 4.98E-07 cd06629 STKc_MAPKKK_Bck1_like cl09925 NC
non-specific 133172 566 700 5.19E-07 cd05040 PTKc_Ack_like cl09925 C
non-specific 143361 752 881 5.94E-07 cd07856 STKc_Sty1_Hog1 cl09925 NC
non-specific 133199 752 906 6.05E-07 cd05068 PTKc_Frk_like cl09925 N
non-specific 133167 756 919 6.13E-07 cd05035 PTKc_Axl_like cl09925 N
non-specific 173709 622 738 6.32E-07 cd05619 STKc_nPKC_theta cl09925 NC
non-specific 173718 621 709 6.50E-07 cd05629 STKc_NDR_like_fungal cl09925 NC
non-specific 173627 678 921 6.54E-07 cd05037 PTK_Jak_rpt1 cl09925 -
non-specific 173674 621 753 6.55E-07 cd05583 STKc_MSK_N cl09925 NC
non-specific 132946 581 742 6.83E-07 cd06615 PKc_MEK cl09925 C
non-specific 173701 614 820 6.88E-07 cd05610 STKc_MASTL cl09925 C
non-specific 132977 589 737 7.13E-07 cd06646 STKc_MAP4K5 cl09925 NC
non-specific 133205 774 912 7.40E-07 cd05074 PTKc_Tyro3 cl09925 N
non-specific 173636 772 907 9.11E-07 cd05057 PTKc_EGFR_like cl09925 N
non-specific 143367 673 899 9.79E-07 cd07862 STKc_CDK6 cl09925 C
non-specific 143338 566 738 1.00E-06 cd07833 STKc_CDKL cl09925 C
non-specific 173733 635 711 1.10E-06 cd07829 STKc_CDK_like cl09925 NC
non-specific 173662 622 748 1.11E-06 cd05571 STKc_PKB cl09925 NC
non-specific 173641 750 908 1.14E-06 cd05072 PTKc_Lyn cl09925 N
non-specific 133209 571 704 1.24E-06 cd05078 PTK_Jak2_Jak3_rpt1 cl09925 C
non-specific 173700 621 738 1.25E-06 cd05609 STKc_MAST cl09925 NC
non-specific 143374 782 901 1.30E-06 cd07869 STKc_PFTAIRE1 cl09925 NC
non-specific 143384 770 889 1.39E-06 cd07879 STKc_p38delta_MAPK13 cl09925 NC
non-specific 173710 622 741 1.44E-06 cd05620 STKc_nPKC_delta cl09925 NC
non-specific 132962 554 739 1.49E-06 cd06631 STKc_YSK4 cl09925 C
non-specific 173708 621 740 1.60E-06 cd05617 STKc_aPKC_zeta cl09925 NC
non-specific 132970 770 880 1.70E-06 cd06639 STKc_myosinIIIB cl09925 NC
non-specific 132983 580 738 1.71E-06 cd06652 STKc_MEKK2 cl09925 C
non-specific 173716 769 896 1.83E-06 cd05627 STKc_NDR2 cl09925 NC
non-specific 132984 523 738 1.86E-06 cd06653 STKc_MEKK3_like_1 cl09925 C
non-specific 173715 609 700 2.01E-06 cd05626 STKc_LATS2 cl09925 C
non-specific 173637 749 908 2.04E-06 cd05059 PTKc_Tec_like cl09925 N
non-specific 132971 621 739 2.06E-06 cd06640 STKc_MST4 cl09925 NC
non-specific 173717 769 896 2.23E-06 cd05628 STKc_NDR1 cl09925 NC
non-specific 173741 774 895 2.34E-06 cd07843 STKc_CDC2L1 cl09925 NC
non-specific 173762 782 889 2.41E-06 cd08222 STKc_Nek11 cl09925 NC
non-specific 132973 621 743 2.43E-06 cd06642 STKc_STK25-YSK1 cl09925 NC
non-specific 173706 622 738 2.48E-06 cd05615 STKc_cPKC_alpha cl09925 NC
non-specific 133232 774 912 2.60E-06 cd05101 PTKc_FGFR2 cl09925 N
non-specific 173764 620 739 2.70E-06 cd08224 STKc_Nek6_Nek7 cl09925 NC
non-specific 173746 770 889 2.74E-06 cd07850 STKc_JNK cl09925 NC
non-specific 143376 783 901 2.80E-06 cd07871 STKc_PCTAIRE3 cl09925 NC
non-specific 133201 750 906 3.18E-06 cd05070 PTKc_Fyn_Yrk cl09925 N
non-specific 173686 622 748 3.74E-06 cd05595 STKc_PKB_beta cl09925 NC
non-specific 132976 621 737 3.77E-06 cd06645 STKc_MAP4K3 cl09925 NC
non-specific 173679 622 739 4.28E-06 cd05588 STKc_aPKC cl09925 NC
non-specific 173749 777 881 4.52E-06 cd07855 STKc_ERK5 cl09925 NC
non-specific 173648 699 907 4.81E-06 cd05092 PTKc_TrkA cl09925 -
non-specific 173699 621 739 4.95E-06 cd05608 STKc_GRK1 cl09925 NC
non-specific 173677 621 738 5.20E-06 cd05586 STKc_Sck1_like cl09925 NC
non-specific 173742 771 899 5.50E-06 cd07845 STKc_CDK10 cl09925 NC
non-specific 132989 557 741 5.77E-06 cd06658 STKc_PAK5 cl09925 C
non-specific 173676 581 751 5.94E-06 cd05585 STKc_YPK1_like cl09925 C
non-specific 133204 750 907 6.06E-06 cd05073 PTKc_Hck cl09925 N
non-specific 173629 568 703 6.79E-06 cd05041 PTKc_Fes_like cl09925 C
non-specific 133174 749 916 6.93E-06 cd05042 PTKc_Aatyk cl09925 N
non-specific 143379 770 889 7.13E-06 cd07874 STKc_JNK3 cl09925 NC
non-specific 173673 621 738 7.66E-06 cd05582 STKc_RSK_N cl09925 NC
non-specific 173640 750 907 7.89E-06 cd05067 PTKc_Lck_Blk cl09925 N
non-specific 173655 693 907 8.30E-06 cd05110 PTKc_HER4 cl09925 C
non-specific 173750 777 889 8.35E-06 cd07857 STKc_MPK1 cl09925 NC
non-specific 143375 782 891 9.01E-06 cd07870 STKc_PFTAIRE2 cl09925 NC
non-specific 143378 783 889 9.09E-06 cd07873 STKc_PCTAIRE1 cl09925 NC
non-specific 143377 783 889 1.10E-05 cd07872 STKc_PCTAIRE2 cl09925 NC
non-specific 143341 783 901 1.18E-05 cd07836 STKc_Pho85 cl09925 NC
non-specific 133180 755 907 1.21E-05 cd05049 PTKc_Trk cl09925 N
non-specific 143380 770 889 1.21E-05 cd07875 STKc_JNK1 cl09925 NC
non-specific 132972 621 743 1.25E-05 cd06641 STKc_MST3 cl09925 NC
non-specific 133181 699 895 1.35E-05 cd05050 PTKc_Musk cl09925 -
non-specific 173707 622 738 1.38E-05 cd05616 STKc_cPKC_beta cl09925 NC
non-specific 132975 534 743 1.60E-05 cd06644 STKc_STK10_LOK cl09925 C
non-specific 173649 699 907 1.74E-05 cd05093 PTKc_TrkB cl09925 -
non-specific 133202 771 906 1.78E-05 cd05071 PTKc_Src cl09925 N
non-specific 132974 621 746 1.86E-05 cd06643 STKc_SLK cl09925 NC
non-specific 132988 557 741 1.91E-05 cd06657 STKc_PAK4 cl09925 C
non-specific 173753 783 901 2.03E-05 cd07864 STKc_CDK12 cl09925 NC
non-specific 88519 622 740 2.13E-05 cd05618 STKc_aPKC_iota cl09925 NC
non-specific 132951 541 739 2.28E-05 cd06620 PKc_MAPKK_Byr1_like cl09925 C
non-specific 133171 576 700 2.36E-05 cd05039 PTKc_Csk_like cl09925 C
non-specific 173628 580 700 2.72E-05 cd05038 PTKc_Jak_rpt2 cl09925 C
non-specific 173704 621 766 2.91E-05 cd05613 STKc_MSK1_N cl09925 NC
non-specific 143356 749 882 3.38E-05 cd07851 STKc_p38 cl09925 NC
non-specific 173765 537 739 3.48E-05 cd08225 STKc_Nek5 cl09925 C
non-specific 173643 769 880 3.56E-05 cd05077 PTK_Jak1_rpt1 cl09925 NC
non-specific 133180 565 703 4.40E-05 cd05049 PTKc_Trk cl09925 C
non-specific 173650 757 908 4.76E-05 cd05094 PTKc_TrkC cl09925 N
non-specific 173625 764 903 6.33E-05 cd05032 PTKc_InsR_like cl09925 N
non-specific 173745 752 917 6.36E-05 cd07848 STKc_CDKL5 cl09925 NC
non-specific 133209 749 880 6.57E-05 cd05078 PTK_Jak2_Jak3_rpt1 cl09925 NC
non-specific 173717 564 700 6.64E-05 cd05628 STKc_NDR1 cl09925 C
non-specific 133221 769 906 7.13E-05 cd05090 PTKc_Ror1 cl09925 N
non-specific 173658 750 908 7.78E-05 cd05114 PTKc_Tec_Rlk cl09925 N
non-specific 173684 622 748 7.86E-05 cd05593 STKc_PKB_gamma cl09925 NC
non-specific 143354 778 884 7.99E-05 cd07849 STKc_ERK1_2_like cl09925 NC
non-specific 173694 622 739 8.22E-05 cd05603 STKc_SGK2 cl09925 NC
non-specific 173748 782 899 8.51E-05 cd07853 STKc_NLK cl09925 NC
non-specific 133235 774 900 8.64E-05 cd05104 PTKc_Kit cl09925 N
non-specific 133207 750 906 8.83E-05 cd05076 PTK_Tyk2_rpt1 cl09925 N
non-specific 133237 764 907 9.21E-05 cd05106 PTKc_CSF-1R cl09925 N
non-specific 173695 622 739 9.29E-05 cd05604 STKc_SGK3 cl09925 NC
non-specific 173763 557 738 0.000100366 cd08223 STKc_Nek4 cl09925 C
non-specific 132964 621 747 0.000103675 cd06633 STKc_TAO3 cl09925 NC
non-specific 173680 623 738 0.000104295 cd05589 STKc_PKN cl09925 NC
non-specific 133211 579 700 0.000106737 cd05080 PTKc_Tyk2_rpt2 cl09925 C
non-specific 143344 783 901 0.000108342 cd07839 STKc_CDK5 cl09925 NC
non-specific 133187 747 908 0.000111499 cd05056 PTKc_FAK cl09925 N
non-specific 173729 621 700 0.000112947 cd06617 PKc_MKK3_6 cl09925 NC
non-specific 143359 782 899 0.000115415 cd07854 STKc_MAPK4_6 cl09925 NC
non-specific 173643 615 727 0.000120483 cd05077 PTK_Jak1_rpt1 cl09925 NC
non-specific 143333 635 700 0.000129959 cd05118 STKc_CMGC cl09925 NC
non-specific 132966 621 747 0.000142252 cd06635 STKc_TAO1 cl09925 NC
non-specific 173716 606 744 0.000147199 cd05627 STKc_NDR2 cl09925 C
non-specific 173698 621 739 0.000150757 cd05607 STKc_GRK7 cl09925 NC
non-specific 143382 782 909 0.00015962 cd07877 STKc_p38alpha_MAPK14 cl09925 NC
non-specific 133207 618 699 0.000165 cd05076 PTK_Tyk2_rpt1 cl09925 NC
non-specific 173626 577 700 0.000172234 cd05034 PTKc_Src_like cl09925 C
non-specific 132965 533 747 0.000173351 cd06634 STKc_TAO2 cl09925 C
non-specific 132980 621 742 0.000181262 cd06649 PKc_MEK2 cl09925 NC
non-specific 173756 770 896 0.000181663 cd08216 PK_STRAD cl09925 NC
non-specific 173696 628 760 0.000193167 cd05605 STKc_GRK4_like cl09925 NC
non-specific 173722 622 739 0.000202922 cd05633 STKc_GRK3 cl09925 NC
non-specific 133168 621 700 0.000215885 cd05036 PTKc_ALK_LTK cl09925 NC
non-specific 143345 635 700 0.000247705 cd07840 STKc_CDK9_like cl09925 NC
non-specific 173758 621 739 0.000250122 cd08218 STKc_Nek1 cl09925 NC
non-specific 143364 778 910 0.000274247 cd07859 STKc_TDY_MAPK_plant cl09925 NC
non-specific 133216 750 901 0.000275352 cd05085 PTKc_Fer cl09925 N
non-specific 173721 621 826 0.000281934 cd05632 STKc_GRK5 cl09925 N
non-specific 133191 566 703 0.000282458 cd05060 PTKc_Syk_like cl09925 C
non-specific 173653 774 900 0.000286749 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 173685 622 748 0.000317769 cd05594 STKc_PKB_alpha cl09925 NC
non-specific 133213 766 921 0.000324002 cd05082 PTKc_Csk cl09925 N
non-specific 143385 749 889 0.00035383 cd07880 STKc_p38gamma_MAPK12 cl09925 NC
non-specific 143368 631 700 0.000378531 cd07863 STKc_CDK4 cl09925 NC
non-specific 173719 621 739 0.000382733 cd05630 STKc_GRK6 cl09925 NC
non-specific 173697 649 739 0.000427214 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173648 563 708 0.0004994 cd05092 PTKc_TrkA cl09925 C
non-specific 173766 778 931 0.000608139 cd08226 PK_STRAD_beta cl09925 NC
non-specific 173705 621 703 0.000665211 cd05614 STKc_MSK2_N cl09925 NC
non-specific 173693 622 739 0.000767962 cd05602 STKc_SGK1 cl09925 NC
non-specific 133229 577 738 0.000924993 cd05098 PTKc_FGFR1 cl09925 NC
non-specific 173720 621 760 0.000929138 cd05631 STKc_GRK4 cl09925 NC
non-specific 133247 748 904 0.0011003 cd05116 PTKc_Syk cl09925 N
non-specific 132949 635 747 0.00116305 cd06618 PKc_MKK7 cl09925 NC
non-specific 173770 621 700 0.00120194 cd08528 STKc_Nek10 cl09925 NC
non-specific 173631 765 906 0.00124275 cd05045 PTKc_RET cl09925 N
non-specific 133175 621 699 0.00140364 cd05043 PTK_Ryk cl09925 NC
non-specific 133174 620 700 0.00148679 cd05042 PTKc_Aatyk cl09925 NC
non-specific 132953 621 740 0.00155398 cd06622 PKc_MAPKK_PBS2_like cl09925 NC
non-specific 240159 530 683 0.00176715 cd05120 APH_ChoK_like cl17270 C
superfamily 247824 530 683 0.00176715 cl17270 APH_ChoK_like superfamily - C
non-specific 133238 774 901 0.00179184 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 173741 578 700 0.00200298 cd07843 STKc_CDC2L1 cl09925 C
non-specific 173657 621 703 0.00213897 cd05113 PTKc_Btk_Bmx cl09925 NC
non-specific 173637 621 700 0.0027478 cd05059 PTKc_Tec_like cl09925 NC
non-specific 132950 621 749 0.00283321 cd06619 PKc_MKK5 cl09925 NC
non-specific 173649 563 711 0.00318636 cd05093 PTKc_TrkB cl09925 C
non-specific 173667 621 683 0.00345397 cd05576 STKc_RPK118_like cl09925 NC
non-specific 173769 621 736 0.00372016 cd08229 STKc_Nek7 cl09925 NC
non-specific 143371 662 700 0.00409846 cd07866 STKc_BUR1 cl09925 NC
non-specific 173642 762 906 0.00425947 cd05075 PTKc_Axl cl09925 N
non-specific 173735 660 700 0.00447331 cd07831 STKc_MOK cl09925 NC
non-specific 173739 581 700 0.00507544 cd07838 STKc_CDK4_6_like cl09925 C
non-specific 132981 621 742 0.00528437 cd06650 PKc_MEK1 cl09925 NC
non-specific 173633 621 700 0.00541849 cd05052 PTKc_Abl cl09925 NC
non-specific 133165 620 703 0.00565357 cd05033 PTKc_EphR cl09925 NC
non-specific 133214 621 700 0.00604396 cd05083 PTKc_Chk cl09925 NC
non-specific 173768 621 736 0.00613827 cd08228 STKc_Nek6 cl09925 NC
non-specific 143363 782 889 0.00663421 cd07858 STKc_TEY_MAPK_plant cl09925 NC
non-specific 133186 533 700 0.00700392 cd05055 PTKc_PDGFR cl09925 C
non-specific 173756 558 739 0.00788943 cd08216 PK_STRAD cl09925 C
non-specific 133178 850 903 0.00813609 cd05046 PTK_CCK4 cl09925 N
non-specific 173630 563 700 0.00829805 cd05044 PTKc_c-ros cl09925 C
non-specific 173650 580 708 0.00887011 cd05094 PTKc_TrkC cl09925 C
non-specific 173747 653 704 0.00921086 cd07852 STKc_MAPK15 cl09925 NC
multi-dom 214567 752 903 1.53E-28 smart00220 S_TKc - N
multi-dom 215690 760 906 1.04E-23 pfam00069 Pkinase - N
multi-dom 214567 566 742 6.46E-21 smart00220 S_TKc - C
multi-dom 223589 750 959 1.10E-18 COG0515 SPS1 - NC
multi-dom 215690 539 739 1.11E-18 pfam00069 Pkinase - C
multi-dom 219530 749 907 2.67E-18 pfam07714 Pkinase_Tyr - N
multi-dom 223589 572 804 6.45E-16 COG0515 SPS1 - C
multi-dom 197581 749 907 1.31E-15 smart00219 TyrKc - N
multi-dom 214568 755 907 3.36E-15 smart00221 STYKc - N
multi-dom 219530 565 700 1.56E-13 pfam07714 Pkinase_Tyr - C
multi-dom 197581 565 700 1.69E-13 smart00219 TyrKc - C
multi-dom 214568 565 700 3.04E-13 smart00221 STYKc - C
multi-dom 140293 746 895 7.64E-11 PTZ00267 PTZ00267 - NC
multi-dom 140289 753 887 1.28E-10 PTZ00263 PTZ00263 - NC
multi-dom 140289 621 744 2.13E-10 PTZ00263 PTZ00263 - NC
multi-dom 215036 771 887 1.62E-09 PLN00034 PLN00034 - NC
multi-dom 177557 763 881 4.36E-09 PHA03209 PHA03209 - NC
multi-dom 177649 783 900 4.91E-09 PLN00009 PLN00009 - NC
multi-dom 173502 754 906 2.78E-08 PTZ00266 PTZ00266 - C
multi-dom 165473 758 889 3.15E-08 PHA03207 PHA03207 - NC
multi-dom 183880 777 888 1.70E-07 PRK13184 pknD - C
multi-dom 215036 621 736 1.81E-07 PLN00034 PLN00034 - NC
multi-dom 165478 760 882 3.78E-07 PHA03212 PHA03212 - NC
multi-dom 240344 774 889 4.15E-07 PTZ00283 PTZ00283 - NC
multi-dom 223069 620 683 7.86E-07 PHA03390 pk1 - NC
multi-dom 173616 761 887 1.29E-06 PTZ00426 PTZ00426 - NC
multi-dom 165476 771 882 4.51E-06 PHA03210 PHA03210 - NC
multi-dom 140293 620 737 6.08E-06 PTZ00267 PTZ00267 - NC
multi-dom 173333 763 881 2.25E-05 PTZ00036 PTZ00036 - NC
multi-dom 173616 570 738 2.47E-05 PTZ00426 PTZ00426 - C
multi-dom 223009 759 906 2.69E-05 PHA03211 PHA03211 - N
multi-dom 240233 771 882 7.41E-05 PTZ00024 PTZ00024 - NC
multi-dom 173502 621 747 0.000143394 PTZ00266 PTZ00266 - C
multi-dom 165473 641 683 0.00021206 PHA03207 PHA03207 - NC
multi-dom 183880 576 775 0.000285854 PRK13184 pknD - C
multi-dom 223069 771 895 0.000383968 PHA03390 pk1 - NC
multi-dom 177557 646 738 0.00120922 PHA03209 PHA03209 - NC
multi-dom 165291 862 902 0.00242863 PHA02988 PHA02988 - N
multi-dom 178763 627 706 0.00371699 PLN03224 PLN03224 - NC
multi-dom 165478 606 683 0.00503741 PHA03212 PHA03212 - NC
multi-dom 234389 775 896 0.00823339 TIGR03903 TOMM_kin_cyc - C
multi-dom 165476 654 687 0.00907384 PHA03210 PHA03210 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific active site T753,D791,K793,E795,N796,L798,D816,R819,G845,T846,P847,C848 26 12 173623
specific ATP binding site D791,K793,E795,N796,L798,D816 20 6 173623
specific substrate binding site T753,D791,K793,E795,R819,G845,T846,P847,C848 11 9 173623
specific activation loop (A-loop) S815,D816,F817,D818,R819,S820,I821,G845,T846,P847,C848 11 11 173623
specific active site V594,M623,E624,Y625,V626,S630,K632,D674,K676,E678,N679,L681,D699,R702,G728,T729,P730,C731 26 18 173623
specific ATP binding site V594,M623,E624,Y625,V626,S630,D674,K676,E678,N679,L681,D699 20 12 173623
specific substrate binding site S630,K632,D674,K676,E678,R702,G728,T729,P730,C731 11 10 173623
specific activation loop (A-loop) S698,D699,F700,D701,R702,S703,I704,G728,T729,P730,C731 11 11 173623
 
DNA sequence
Upstream 1000 bp region from PH01002850G0100 gene.
GAAAGCTAAGAAAAATATCTACATCTTTCATAACCAGGCAAAATCATAATTTTGGACGGAGATACTCCAAATCCCCCCCCAAAGGTTCTGCAGTACAGTTTAACGAACTAGGGCATCATAAAACATCTAACTCCCTCTACCAAACCAATCTACAACGTGAATAAACATCCATCTAAGATCAATCTAAGGTTGATCAGAACGTTACCCACGAAAATTGCCAACGATCGACGGCGGAGCGTGAAGCCCTAACTTTTCCTTCCTTCTCCTTCCTGCTGGTTCACCTCCTTCCTTGCTTGGCGCCGGCAGCAAGTCACCACCACATGGCAAGGTGGCTTGGCAGAGAAGGGGCGCGGCAGGAGGAAGGGTGGCGCAAGGCTAGGGCAGGGGGTTGGCCAGCCCCACTGCCACCACCTTTATGCAGCCGGGCTCCCCCCACCTAACAGGCTTGGCTATGGGCTGGCGGCCCAGTTCTTCCCCCCAAGAGCCTAAATTTCAGAATTAATTCCTAATAGCTAATCTTAGCACTGGATAATTAAACGGGATATTACATTCAAGGTCTCAATTTATATTTGTTTTTCGTTGCTTTGGTGTTGATTCTATGACATTCATACTTTTCGAACCAAACGTTCAAAATTTTTCAGAACCTGATAAACAGTTATGTTTGGAGATAGATGTGTGTGCCACCTTTGAGGAAAGGATTAGCAATGGTTCCACATTATGCCTTTCATTTTCCAAGTTTTTGCTGTTATCCTTTAAAATTTAATGAAAAATGTGAGGGCAGGAGTGTGTCTGGAACCAGAAAACACTTGTGGAGGAGGTGTTTGAAAAAAATGTTGTGGAAGTGTTGGGTTTTATAAAAAACATTAGCCATTAATTTGCGTTGTTTTTTATTAAAGAATTTCTGGACTTACATTTTAGCTATTAATGATTGTATTGGGGGTATTCTTCTTAATTTTTTTTGTCTTCTGGTGCTTAATTTGAATATCAGATCCTGACAAAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGGGGAAATGGTGAAAATGCTGTGAAGGGTGACAAGCTAAAATATTTAGGTATTGCAAGCATCAACAGTTCAGCAGAACCTAGAATTGCGAGTCACTCTTCCAATGGTGTGCTTTCAATTTCATGCTCACATCCAGAAACATCCCCAAATTTAAAAGCTCATTCCACACAGAAAATGAAGAAGGGTTGGAAGCGGCGGGATTGCCTGCAACAACAAGCTCGCCAGGAGCGTTTAGACTCAAGCAGGAGCAAGCTCAATGAAAATTACATTGATGAAATGGCTGTGAACATGACAGAAGATGAATGCCCTTCTAGTTTGCATGATATGGAAAACAAGCCAGAGATGAAAGGCATTGATGAAGAAACTTCAGTACAGGATTTGTTGAAAGAAACAAGTTATATATCTGAAGACCTATCTTGTATAGTTGATGATGTCTCGGATGGGCTTATAAAAGATAGTGGCATGATGCTACAGGACCACTATGGTGAGGAGAAACCTGGAATTAATATGAGAAGTTACCATGGCAACAATTCTTGTATCAGCGCTGATTCTGCTTGTTTGAGCAGGAGCAGGATCCGTAGTGTTGAAAATGAACTAGAGGATACTGCTTCATCAGCCCACAATGTTGCTGAAGTTGTTGAAGAGAACCCTTCAGAGACATCCAAATTTACATCGAAATCTAAAAGGCACCCTGATATGGACAACAATCCTAAACCTAGCAAATGCGCTAGACCAATTGATGAATGCTCAAAGTTGTCTTATAAGTACAGTGTGGAATCATTTTGCAGCATAGATGACCATCTACCAGATGGCTTTTATGATGCGGGACGAGATATGCCCTTCATGCCATTAGAGGAGTATGAACGGAGTCTTGGACTATATGCACGTGAAGTTATTCTTTTGGACAGAGAGCAAGATGAAGAATTGGATGCAATTGCTTCTTCAGCACAACTATTGTTATCTAGTTTGAAGAGACCATGCTTTTCCGAAATGGATGAAGATGCAGGCCATGACTTACTAAGGGCATCAGTGCTTGCTTTGTTTGTTTCTGACTGCTTTGGAGGTTGTGATCGAAGTGATTCTCTTAGGAGAACAAGGAGAGCTATTGTTAGCCTGAGGAAGGAGCAACCTTTCGTTTGTACTTGTTCTGCTGGAAGCATATGTGACATCAATGAAGCATCTAAGCAGATCAATACTCTTTCTGGGCACTTCGATTTTACTCGTCTGTGTGATAAATCGATACATATCATCAAGGAAAGGAGAAATTCGGGTATCGTACCAATAGGGGCACTGCAATTCGGTGTTTGTAGGCACCGAGCTGTCCTAATGAAGTACTTGTGCGATCGGGCAGATCCTCCAATTCCATGTGAGCTTGTGAGGGGGCATCTTGACTACACACCTCATGCTTGGAATGTTGTTCCTGTTAGAAAAGGGGACGTCTGGGTTCTTTCTGAATCCAACATTGTCACCCTAATTTTGATTAACCCATTATGTACATGTGGTTTCAGGTATGTTCCGCTCAGTCGACTTCACATTGCACTTGATGATCAGAGCTATACACCTCGGTGTTCCTTCCCTTCTGTCTCACTATGCAAAGAAATTGAAGCTACAGCTTCTAGTGCTGTCTACCACTGCAAAATTGGTGCTGTTGATGCTGCAGCGAAGATACGATACCTAGATACCCGTAGGGCTTCTAATGATGAAGTTCAAAATTTTGAATACAAGCTTCTTGGGGAAGTAAGAATGCTGAGTGCTCTAAGGAAGCACAGATCCATAGTGGACATATATGGTCACCAACTTTCTTCTAAATGGGTTCAAGCTGATGGTGATAACAAGTACAGGGTATTGCAGTCTATAATTCTAATGGAGTATGTGAAAGGAGGTTCTCTGAAGGGCTATTTAACAAAACTACTGAAAGAGGGCAAGAAGCATGTACCTATTGACTTAGCATTTTATATTGCTCGAGAAGTTGCTTGTGCATTGTTGGAGCTGCACAAGAAGCTAGTTATTCACCGGGATATAAAAAGTGAGAATGTTTTGGTTGATCTAGATTCGAAGAGAAGTCATGGCACACCAGTAGTCAAACTCTCTGATTTTGACAGATCCATTCCTTTGCATTCTCTGTCCCATACATGCTGTATAGCTCACCTTGGCACATATCCACCCAATGTTTGTGTTGGGACACCTTGTTCGATGGCTCCAGAGGTTCTTCAGGCCATGCATGACAAAAACCAATATGGACTGGGCTATTTAACAAAACTACTGAAAGAGGGCAAGAAGCATGTACCTATTGACTTAGCATTTTATATTGCTCGAGAAGTTGCTTGTGCATTGTTGGAGCTGCACAAGAAGCTAGTTATTCACCGGGATATAAAAAGTGAGAATGTTTTGGTTGATCTAGATTCGAAGAGAAGTCATGGCACACCAGTAGTCAAACTCTCTGATTTTGACAGATCCATTCCTTTGCATTCTCTGTCCCATACATGCTGTATAGCTCACCTTGGCACATATCCACCCAATGTTTGTGTTGGGACACCTTGTTCGATGGCTCCAGAGGTTCTTCAGGCCATGCATGACAAAAACCAATATGGACTGGAAGTGGATATCTGGTCATTTGGATGTTTTTTATTGGAGATGCTTACACTTCGGATACCCTACCAGGGACTACCTGATTCAGAAATATATGATCTCATAAAGAGGAAGAAACAGAGGCCAAGGCTAACTCAAGAATTAGAAGCATTCTGGACAATGGACGAGCCAATTACGAGGCTGAAGTTGGGGATCACATCTGATGCTCATGCAGAGAAACTAAGACTTCTAATAGATCTCTTCTACCAGTGTACCAGAGGAATCACATCCAAGCGCCCCAAAGCTGAGAAAATTTACAATTTGCTGTGCTCCCTACCCACATGTTATGACATGAGGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002850G0100 gene.
ATAAAGTGCGCCGAGGTTAACTTTAAAATAAAATTTAAAAAAGATTAATTAATATAAAAAATTCCATGTGAATGGAGCATCGCGTTTTCGATCGGAAGCGCTTTGACTTTGCGCTGATTGGCCGACCGGCACTGGCTAATTTCCCGCTGCAGCGGCATCGCGTCTCGGATCCTCTCACGGTCAGCGACAAGCCGGCCGTGATAAATTACGAGCCGATCTTGACCGGGAGCTTTGGCACCCATGTGATCATCTTTGTTCGTCGATCCGTCTATATAAGGGGTACATCTTCAGTGCCTTACTCTCATGAGCCTTGCTTGTTGCGAGGGCTTAGCTTTTCTCTAGAATCCGGTCGACTTCACCGCAAGTTGTACCGGAGCTTAACCCTAAGTTTTCAGCAGCTTTAAGCTCAAGCTGAACCCCTTCGGAATGGCAGAGGTATCCTGTGAGCAAGCTGCAAGCACGCCGAAATTGAGTACCCAAGAGAAAGCGTGAAGCTGCCAGCATGATCTAGCTTCTTGGGGGAGTAGGCAATGCCATTCTGCATCTGCTGTCTGTGTCTGGCTCATGAGAACTCAGCTTGCTGGTTTTCAATGGGCATTCATGATATGTGCATGGCAGTGTGATGTATGAGGCTTCTAAGTAATGGTCAGATCATGCTGTGACAGTTTCACTCTTTCCCTGTTGGGCACACAAGAGATAGTAGTACTAGAAAGGGGTAAGCTCTGACAGAGGGTAACACGACAGCAGAGGTAAGCACATCCATGTCTCTCTATCTGCAGGTGCACACAGGTACAGTGGTACGCATTCGCCGCGCACACGCTCAAGGCATGCGTGTGATCGAGCACACGCCTCTGCCTGCTAGCTGCAGGGAAGGGGAAGCTTTTTGAAATTTTCTCTTTGTTTTGCTGGTCTCTAGTTATGTGCAAAAATTCCATACTTTGTTGGTGAAAAAGTTTGGTTGGTTAAACAGATCAAAAGGGCAATGTAGAACTCTCCTAAAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002850 Download
Protein sequence
Protein sequence
MRGNGENAVKGDKLKYLGIASINSSAEPRIASHSSNGVLSISCSHPETSPNLKAHSTQKMKKGWKRRDCLQQQARQERLDSSRSKLNENYIDEMAVNMTEDECPSSLHDMENKPEMKGIDEETSVQDLLKETSYISEDLSCIVDDVSDGLIKDSGMMLQDHYGEEKPGINMRSYHGNNSCISADSACLSRSRIRSVENELEDTASSAHNVAEVVEENPSETSKFTSKSKRHPDMDNNPKPSKCARPIDECSKLSYKYSVESFCSIDDHLPDGFYDAGRDMPFMPLEEYERSLGLYAREVILLDREQDEELDAIASSAQLLLSSLKRPCFSEMDEDAGHDLLRASVLALFVSDCFGGCDRSDSLRRTRRAIVSLRKEQPFVCTCSAGSICDINEASKQINTLSGHFDFTRLCDKSIHIIKERRNSGIVPIGALQFGVCRHRAVLMKYLCDRADPPIPCELVRGHLDYTPHAWNVVPVRKGDVWVLSESNIVTLILINPLCTCGFRYVPLSRLHIALDDQSYTPRCSFPSVSLCKEIEATASSAVYHCKIGAVDAAAKIRYLDTRRASNDEVQNFEYKLLGEVRMLSALRKHRSIVDIYGHQLSSKWVQADGDNKYRVLQSIILMEYVKGGSLKGYLTKLLKEGKKHVPIDLAFYIAREVACALLELHKKLVIHRDIKSENVLVDLDSKRSHGTPVVKLSDFDRSIPLHSLSHTCCIAHLGTYPPNVCVGTPCSMAPEVLQAMHDKNQYGLGYLTKLLKEGKKHVPIDLAFYIAREVACALLELHKKLVIHRDIKSENVLVDLDSKRSHGTPVVKLSDFDRSIPLHSLSHTCCIAHLGTYPPNVCVGTPCSMAPEVLQAMHDKNQYGLEVDIWSFGCFLLEMLTLRIPYQGLPDSEIYDLIKRKKQRPRLTQELEAFWTMDEPITRLKLGITSDAHAEKLRLLIDLFYQCTRGITSKRPKAEKIYNLLCSLPTCYDMR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above