gene PH01002606G0040
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002606:22722 - 33734(- stand)   Name
Alternate name Locus tag PH01002606G0040
Length of gene 11013  bp Length of CDS 2946  bp
Product information
Feature type
CDS
Product name
anthocyanin 3-O-beta-glucosyltransferase
Alternate name
Molecular weight
(predicted)
106628.99162  kDa
Isoeletric point
(predicted)
6.0562400817871
Length
981  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_172721 6
Please click OG5_172721 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g53350.1 anthocyanin 3-O-beta-glucosyltransferase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
1 100 200 300 400 500 600 700 800 900 981
Detailed signature matches
    1. PF00201 (UDPGT)
    2. PS00375 (UDPGT)
    1. SM00415 (HSF)
    2. PS00434 (HSF_DOMAIN)
    3. PF00447 (HSF_DNA-bind)
    4. PR00056 (HSFDOMAIN)
Unintegrated signatures no IPR
Unintegrated signatures
  1. SSF46785 ("Winged h...)
  2. SSF53756 (UDP-Glyco...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent
GO:0008152 metabolic process

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0016758 transferase activity, transferring hexosyl groups
GO:0043565 sequence-specific DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 215293 17 402 1.84E-83 PLN02534 PLN02534 cl18328 -
superfamily 215293 17 402 1.84E-83 cl18328 PLN02534 superfamily - -
non-specific 215465 20 402 4.50E-63 PLN02863 PLN02863 cl18332 -
superfamily 215465 20 402 4.50E-63 cl18332 PLN02863 superfamily - -
non-specific 215084 20 396 1.36E-52 PLN00164 PLN00164 cl18320 -
superfamily 215084 20 396 1.36E-52 cl18320 PLN00164 superfamily - -
non-specific 178581 29 402 1.41E-43 PLN03004 PLN03004 cl18098 -
superfamily 178581 29 402 1.41E-43 cl18098 PLN03004 superfamily - -
non-specific 215304 227 402 3.47E-42 PLN02554 PLN02554 cl18329 N
superfamily 215304 227 402 3.47E-42 cl18329 PLN02554 superfamily - N
specific 215924 624 712 7.66E-41 pfam00447 HSF_DNA-bind cl12113 -
superfamily 245876 624 712 7.66E-41 cl12113 HSF_DNA-bind superfamily - -
non-specific 214654 621 712 3.73E-39 smart00415 HSF cl12113 -
non-specific 177857 189 402 1.15E-35 PLN02207 PLN02207 cl18091 N
superfamily 177857 189 402 1.15E-35 cl18091 PLN02207 superfamily - N
non-specific 215112 189 396 1.77E-35 PLN02167 PLN02167 cl18322 N
superfamily 215112 189 396 1.77E-35 cl18322 PLN02167 superfamily - N
non-specific 178589 29 402 7.62E-35 PLN03015 PLN03015 cl18099 -
superfamily 178589 29 402 7.62E-35 cl18099 PLN03015 superfamily - -
non-specific 99960 19 402 1.51E-17 cd03784 GT1_Gtf_like cl10013 -
superfamily 245227 19 402 1.51E-17 cl10013 Glycosyltransferase_GTB_type superfamily - -
multi-dom 178584 16 402 1.16E-81 PLN03007 PLN03007 - -
multi-dom 215247 20 402 6.08E-42 PLN02448 PLN02448 - -
multi-dom 178275 17 400 1.07E-41 PLN02670 PLN02670 - -
multi-dom 215305 16 396 1.86E-35 PLN02562 PLN02562 - -
multi-dom 178572 29 402 1.01E-34 PLN02992 PLN02992 - -
multi-dom 178170 124 388 5.53E-33 PLN02555 PLN02555 - NC
multi-dom 178032 17 398 6.00E-30 PLN02410 PLN02410 - -
multi-dom 178364 17 402 3.63E-29 PLN02764 PLN02764 - -
multi-dom 177858 16 402 1.28E-26 PLN02208 PLN02208 - -
multi-dom 177807 17 402 1.37E-25 PLN00414 PLN00414 - -
multi-dom 177830 130 402 3.51E-25 PLN02173 PLN02173 - N
multi-dom 227497 622 712 8.12E-25 COG5169 HSF1 - C
multi-dom 177813 187 402 4.72E-24 PLN02152 PLN02152 - N
multi-dom 215127 184 402 2.81E-23 PLN02210 PLN02210 - N
multi-dom 201077 276 398 1.18E-17 pfam00201 UDPGT - NC
multi-dom 224732 17 400 2.44E-13 COG1819 COG1819 - -
multi-dom 233407 126 402 3.04E-10 TIGR01426 MGT - N
multi-dom 223071 275 400 5.73E-10 PHA03392 egt - NC
multi-dom 224885 745 848 0.00381461 COG1974 LexA - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002606G0040 gene.
ACCTTCCCCGTTCATCTGTCGCTTGGACCAGCCTCCTCCCGTCATGTGGACGCCGCCACTCTTCTGGCGCACGGACACGCCCCGTGTCCGAATGCGCTCTTGTCCGCAACTCCCTGCCCTGGACGCGCCGGCTGGCTCTTGTCCGTAGCTCCCTGGCTCGGACGCACCTCGCCCTTCCACCTAGCGTGCGGATAACTGGCGACGCCGCACCACCCTGGATTGGACACGCTTTGCCCGTCCACCTGGCGCACGGACGGCCTGCGCTTCCAGCTCCCCCTCGCCCGGACGCGCCACGCGGGTGACGCCACACCTCTATCATACTCCACTTTGTACTACGTAAAAGTTTCAATTGTCAGCACTAAGCACACGATCGTTGCTTTTATCCTCGACTTAGAAGTCAGAACAGCCTCTTCCACGACAAAAACTTCACAAGTCAAAACAGTGGCGGACCCAACAGGGGTTAAGGGGGGCAGAGCACCCCCCAAGGCCGGTCGGACCATAGGTATCCCCTAGCACCCTCGTATATCGAATATCATGGCTTGAAGCTTAGTTGCTCTAGGGATAAAAGAAGAACAAGGAAATGATTTGGACTGGAATTCTCTTGTATGAGCTGCGTCAAACCAAGTACTGGTCATTGCTGTCCTAGACCAACTCGGCGAACCCACCAAACCCATCTATCTCATTCTCACTCTGCTTTCTTCTCACCAGACATCAAGTTCTACTCCAATCCCTAATCAATTCCCCAATTCCTATCATAGCGAACCCTTGCGACTAGTGCCGCGGGCTGCGTGCAGGCATGGGCTTGGACGTGCTAGACGACTCAACGTAGGCATGAGGTGCAGCGGCAACCGAGCAGTGTTGCGTGGCACAAACCTGTGTGCAGTGCTGTAGTCGGTAGGGCAGGTAGGTAGCACTAGCAACTGGGCAGGAAGGCAACACGCGGCCGCGGAGGCAGGCGACAGTGCAGGCAAGCGGCAACGTCTTATTAGCACTTCCTAAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCGCAGATGCGGGTGCGGGTGCGGGCGCCGGCGAGGGCGGGAGGCGGCTGAGGGTGTTCTTCCTGCCGTTCTTCGCTCGGGGGCACCTCATCCCGATGACCGACCTGGCGTGCCTCATGGCGGCGGCGAGGCCGGACGGGGTGGAGGCCACGATGATGGTGACGCCAGCCAACGCGGCGCTCATCGCGACCACGGTCACGCGTGCCGCGGCCGCGGGGCACACCGTGAACCTCATGTGCTACCCGTTCCCCGACGTCGGCATGGAGCGCGGGGTGGAGAGCCTCGGCGTCGCCGCCGCGCACGACGCCTGGCGGGTGTACCGCGCCGTGGACCTGTCGCAGCCCATCCACGAGTCGCTGCTCCTGCAGCACCGCCCCGACGCCATCGTCGCCGACGTGCCGTTCTGGTGGGTCACCGACATCGCCGCCGAGCTCGGTGTCCCGCGCATCACTTTCAACCCTGTCGGCGTCTTCCCGCAGCTCACCATGAACAACCTCGTCACCATTCGCTCCGACATCGTCCGGGGAGGCCCCGCCGCCCCGGCGGTCTCCGTGCCTGGCCTGCCCGGCAAGGAGATCACCATCCCGGCGTCCGAGCTCCCGGACTTCCTTGTCCAGGACGACCACCTCTCCATGTCGTGGGACCGGATCAAGGCGTCCCAGCTCGCCGGCTTCGGCGTCGTCGTCAACACCTTCGCCGACCTGGAGCAGCCCTACTGCGACGAGTTCAGCCGCGTCGACGCGCGCCGCGCCTACTTCGTCGGGCCCGTCAGCCTGCCGTCGCGCTCCGCCGTGCACCGCGGCGGCGACGCCAACGTGGACTGCCTGAGGTGGCTGTCCACCCAGTCGATCCGGTCCGCGGTCTACGTCTGCTTCGGGAGCTGGGCCTACTTCTCGGAGCACCAGGTCCGCGAGCTCGCTCTGGGGCTGGAGGCCTCGAACCAGCCGTTCCTCTGGGTGCTTCGCTCAGAGGACTCCAACGGCCGGTGGGCGCCGGAGGGGTGGGAGCAGCGCGTCGCCGGCCGCGGCATGGTCGTCCGAGGGTGGGTCCCTCAGCTGGCCGTGTTAGCCCACCCGTCGGTGGGCGCGTTCGTGACGCACTGCGGGTGGAACTCGGTGCTGGAGGCCGCTTCGGCCGGCGTTCCGGTGCTGACGTGGCCGCTGGTGTTCGAGCAGTTCATCAACGAGCGGCTGGTCACCGAGCCACACCGTCCCTGCAGCGTCACATCGCACGCACGCACGCACCACGGCGACCACGCAGCAAAACTAACCAGCAGCAGCCAGTGGCCTCCCTCCCTTTCTCGCAAAGGCGTCGGGGCCATCGGCGGCGGCGGCGGCGGCGGCAATAAGATAAGCGGCGAGATGGATAGAGATGTGGATGTGTCATGTGTGGGTGGATGGACGCTTCCAGAACTCTCGCCCTGGGCCTTCCGGAACGTTCGCCGCCAACTCGCCCCTATTAAAATAAGCTCCTGGGGAGGAGGGAGGGAGCTCAGGATGGCTCCAATCCTTCCAGAACCGCCTGGAAACTTCGGAGCCGGGGGTGGATACGTCCGTGGGGCCCTCGCCCCGATTAAAATAAGCTCCTGGGACTCTGGGAGGGAGGGAGGGAGCTCAGGATGGCTCCAATCCTTCCAGAACCGCCTGGAAACTTCGGAGCCGGGGGTGGTGGTGCTCTGTTCTTCTTGTTCCGTTGCTCGATTGCATTTGTTGGTTGGTTTGATCATGGACCCGTTCCGCGGCATTGTGAAAGAGGAGTTCGACTTCGCCGGAGCGGCGGCGGATGGATCGCCGTCGTCGTGGGCCGGCGGCGCCGTAGCGGAGCTGCCCCGGCCAATGGAGGGCCTCGGCGAGGCCGGCCCGCCGCCGTTCCTGAACAAGACGTACGACGTCGTGGACGACTCCAGCACGGACACCGTCGTGTCGTGGGGCGTCGCCGGCAACAGCTTCGTCGTGTGGGACGCCAGCGCCTTCGCCACGGTGCTCCTCCCGCGCTACTTCAAGCACAGCAACTTCTCAAGCTTCGTCCGCCAGCTCAACACCTATGGGTTCAGGAAGGTAGATCTAGACAGGTGGGAGTTCGCGAACGAGGGGTTCCTGCGGGGCCAGAAGGAGCTCCTGAAAACGATCAAGCGCCGGCGGCCGCCGTCAAGTCCGTCGGCGCAGCAGTCGCAGTCGGCGGCGGCGTGCCTGGAGGTGGGGCAATTCGGGAGCGAGGGCCAGGTGCACCGTCTGCAGCGCGACAAGGGCATCCTGATCGAGGAGGTGGTGAAGCTGCGGCAAGAGCAGCAGACGACGCGCGCGCAGATGCAGGCGATGGAGGAGCGCATCTCCGCGGCAGAGCAGAAGCAGCAGCGGATGACGGTGTTCTTGGCGCGCGCCATGAAGAACCCGGGCTTCCTCCAGATGCTCATGGACCGGCAGGGCCAGGGCCGGCGGAGGGAGCTCGAGGACGCCCTCTCCAAGAAGCGCCGCCGCCCCATCGAGTACCTCCTCCCCCGCGACGGCGAGATCAGTCCCGGGGAGTCGGCGGTGGGAGACTACGTTCCCGGGCTGGGGGTCGACGGCGTGGCGGATGCGGACGGCGACGAAAGCCGGCGCGGAGGCGGCGAGGACACGGAGAGCTTCTGGGCGGAGCTGCTGATCCTCGGGCTCGAGGAGAAGCAGAGAGAGGAGGCCGAGGAGGGGAGCGGCACCGACGTGGACGATGACGTGGACGTGCTCGTGCAGAGCATATACCACCTCAGCCCGAGCGCCAGTAGCCCCAGCCCCAGGCTGCGCAAGTTGCCAAAAGAAACCAAATGGATAAGGGCTGATGGGGTAGGGCCTCGAAGCCCTCCCCATCAGATTTTCTTCTGGGGGCTTGCTGGCAAGGCAGTCGTGGAATGTTCAAGAAGCCGATCAGTTACGAAACTTCTAGAAAGAGAAGCCTACACCTCGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002606G0040 gene.
CAAATCACCCAGAGAGAGGTGACACAGGGATTTTTATACAGGTTCGGACCTTCTCCCAGAGAGAATAACAACCCTACTCCTGTGTGTATGTATTGAGTATGCTGAATTACAAGATCAAGAGAAAGATTCGAATGAGGCGTCTTGTGCTCTTGATTCCTCTCCCCTCTCCTTCTGATGATTCTACCTTTTATACAGTACTCAGAGCGTGCTGCTATTCCTCCAGTCCAAATGGCGCCTTAATGCTTGAGATAATGGAGCCGTTACTGGAGATTATTGTGGGAGTGGTAACGTTCCCACGTCGAGAGATAGTTATTACCATGACAGGGAGTTAAATCGTGTCATTATTCCAGAGAAGAATAATGTAGTTTACTGCCCATATCTTTAGATATGGTGCGAAAGATTTCCTAGTCGACTAGGCCCACATGCCTGTAAGCCCCATCGACTAGGGACTGGTCGTAGAAGAGCTTACGACCAGGTGGTGGTCGTAGAAGAGCTTACGACCACAGACTAATCGTAGAAGAACTTACGATCAGGGCATATTCGTAGAAGAACTTACGACTATGGGGTAGTCGTAGAAGGACTTACGACTATAGGGTGGTCGTAGAAGGACTTACAACCTCCAGCTTCTCCCTTAAGAATATTAAGGGGTATACTCAAGAACCATATGACGTCATTATTATCCATAATATGAATTACAGATAAATAACCAAATAAGGATTATTATATCCTCATCATCTAGCCCCCCAGCTTCAAGTGAAAATAACTTACTTGGGAAATGAACTGTAAATGATCTTACGACCAGTAGACGGTCGTAGAATGGCGGTCGAAGGGAAAACTCTTCGACTAGTGTTTCATTTGACCAGAAATTGACTTGGTCAAGAAGGTTGTGGAAGAATCTTATCACTTACTAGGTGGTTGCAGGATATCTTACGATCACCAAGTGGTCGCAGTATTGTGGTCGGAAGCAAAACCTTTCTGATTGTTGTTGCATTTGACCAGGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002606 Download
Protein sequence
Protein sequence
MAADAGAGAGAGEGGRRLRVFFLPFFARGHLIPMTDLACLMAAARPDGVEATMMVTPANAALIATTVTRAAAAGHTVNLMCYPFPDVGMERGVESLGVAAAHDAWRVYRAVDLSQPIHESLLLQHRPDAIVADVPFWWVTDIAAELGVPRITFNPVGVFPQLTMNNLVTIRSDIVRGGPAAPAVSVPGLPGKEITIPASELPDFLVQDDHLSMSWDRIKASQLAGFGVVVNTFADLEQPYCDEFSRVDARRAYFVGPVSLPSRSAVHRGGDANVDCLRWLSTQSIRSAVYVCFGSWAYFSEHQVRELALGLEASNQPFLWVLRSEDSNGRWAPEGWEQRVAGRGMVVRGWVPQLAVLAHPSVGAFVTHCGWNSVLEAASAGVPVLTWPLVFEQFINERLVTEPHRPCSVTSHARTHHGDHAAKLTSSSQWPPSLSRKGVGAIGGGGGGGNKISGEMDRDVDVSCVGGWTLPELSPWAFRNVRRQLAPIKISSWGGGRELRMAPILPEPPGNFGAGGGYVRGALAPIKISSWDSGREGGSSGWLQSFQNRLETSEPGVVVLCSSCSVARLHLLVGLIMDPFRGIVKEEFDFAGAAADGSPSSWAGGAVAELPRPMEGLGEAGPPPFLNKTYDVVDDSSTDTVVSWGVAGNSFVVWDASAFATVLLPRYFKHSNFSSFVRQLNTYGFRKVDLDRWEFANEGFLRGQKELLKTIKRRRPPSSPSAQQSQSAAACLEVGQFGSEGQVHRLQRDKGILIEEVVKLRQEQQTTRAQMQAMEERISAAEQKQQRMTVFLARAMKNPGFLQMLMDRQGQGRRRELEDALSKKRRRPIEYLLPRDGEISPGESAVGDYVPGLGVDGVADADGDESRRGGGEDTESFWAELLILGLEEKQREEAEEGSGTDVDDDVDVLVQSIYHLSPSASSPSPRLRKLPKETKWIRADGVGPRSPPHQIFFWGLAGKAVVECSRSRSVTKLLEREAYTS
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above