gene PH01002550G0300
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002550:191321 - 195650(- stand)   Name
Alternate name Locus tag PH01002550G0300
Length of gene 4330  bp Length of CDS 2946  bp
Product information
Feature type
CDS
Product name
importin-alpha re-exporter
Alternate name
Molecular weight
(predicted)
108021.50732  kDa
Isoeletric point
(predicted)
5.17050552368164
Length
981  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128085 2
Please click OG5_128085 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G46520.1
cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative
cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, pro
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g13430.1 importin-alpha re-exporter, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 600 700 800 900 981
Detailed signature matches
    1. SSF48371 (ARM repeat)
    1. SM00913 (IBN_N)
    2. PF03810 (IBN_N)
    3. PS50166 (IMPORTIN_B_NT)
    1. PF08506 (Cse1)
    1. PF03378 (CAS_CSE1)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

GO:0006886 intracellular protein transport

Molecular Function

GO:0005488 binding
GO:0005515 protein binding
GO:0008565 protein transporter activity

Cellular Component

GO:0005643 nuclear pore

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 217521 548 972 1.41E-141 pfam03378 CAS_CSE1 cl04032 -
superfamily 217521 548 972 1.41E-141 cl04032 CAS_CSE1 superfamily - -
non-specific 217743 55 88 0.00602588 pfam03810 IBN_N cl04271 N
superfamily 243689 55 88 0.00602588 cl04271 IBN_N superfamily - N
multi-dom 219873 178 527 7.98E-136 pfam08506 Cse1 - -
multi-dom 227944 16 972 7.97E-50 COG5657 CSE1 - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002550G0300 gene.
CAATAATGAAACTCAAACCCGTGGACACCACTGATTAAATTTTAAGATTGATGTCTAGTTAATACTTGAAGGTTCCACTTAACTCATGAAAATTCCTTGATAAATATAAATTGATAAGAAAAGTCATTAAATAAACCAGACCTCATGTGTCAGTTAAAATCGTATCCGTCATGTGTGGCCCATCGCAACCATACACCAACCTCAGCTAAGGTTCATGGAACTTTCTTGATAAATAGAAACAATAATAAAAGAAATCAGTAAGTGAACTAGACCTCACATGCCGGTGAGATTTATATTTTATCTTGTGCGGATCCTCGCATCTACATATATGATTCACCTGACCTTCATGGAACTTCCTTGATAAATAGAAAATAATAACTAAAAAAATCATTAAATCAAATAAGCCCCACGTGTGAGTAGTGATAAGGTGTTCTCAACGGAATGATACTAATTCAACCATCAATCAACACCACGTAGATTCCATCTATCACCCACCGCTATCCGCTTCCAATAGGAGAACAATTCGTAACATGAATAAGGATCAGAAGATCCTGCCTAATAAAGTAATCTCTTCCATCCAAATAACCTTAGAGGAATTTATAGGAATATTCTCTTCCTCCTGTTTGTTCATAATTTTCTTCACCAATGAACCTTCCGAGAGCCCGATCCCTCTCATCCTAACTCCAGATCAAATAGTTTCCTGATCCTAAATCTATCAAAAATCCAAACCCCATCCTTAGACCAAAAGTATAAAGTTTGGATTTATCTATTTTTATCCGAAGTATTTCCTTCTTTCAAAATACCCGTGGATACATCTAATTCCATTTGAAGTATTTCCTTCTTCAAACACTCTTAGATTTATCTACTTTTGTCTGAAGTATTTCCTTCTTCAAACACTTTTAGATATATCTAGTTTCGTTTGAAGTATTTCCTTCTTCAAACACTCTTATATTTATCTACTTTTGTCTGCAGTATTTCCTTTTGCCTCGAGTGCCTCTGGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAAGTGCCGCCGGAGATGCTCGACACCCTGGCGGGGTGGTTCGCGCAGTCGCTCTCCCCCGACACCGCCGCGCGCCGCGCCGCCTCGCAGAACCTCTCCTCCGCTGCCGCAACCCCCGGTTTCGCGCTCGCGCTCCTCGGCCTCGCCTCCTCCCCGCGCCACGACCTCGAGGCCCGCCTCGCCGCCTCCGTCAACTTCAAGAACCTGCTCCGCCGCCGCTGGCCCAAGCCCTCCCCCGACGCCGACGACGCTGACCACCTCCCGGCCTCCGACTGCGCCATCATCAAGGCCCACCTCCTCCAGCTCCTCCTCACTGCCCCGCCCCTCATCCAGGCGCAGCTCTCCGAGGCCCTAGCCGCCGCCGCAGCCTCCGACTTCCCCGCCAAGTGGGAGTCGCTCCTGCCGTCCATCGTCTCCTCCCTCGGCACCGCAATCTCCGCGGGGGACGTCCCCGCGACCAACTCCCTCCTCGCCGCCGCGGCCTCCCTCTTCTCCAGCTTCAGCAACGCCTTCGACAACAACGCCCTCCGCCTCGACCTCAAGTACTGCCTCGAGAACTTCGCCGCGCCCCACCTCGAGGTCTTCCTCTCCACCTCCCGCCGCCTTCAGGCTGCTGCAGCCACGGCAAACCCGCTCGAACTCCGCCCGGTGTTCGAGTGCCTTCGCCTCTGCTGTGAGATCTTCTATTCGCTCAACTCCGTGGACCTGCCCGAGTTCTTCGAGGACCACATGCGTGAGTGGATGACAGAGTTTCGTGCATTCCTCACCACCTCCTACCCGCCGCCCATTGAGGCAGACGGTGGCCCTGATGCACTCCGCTCCGCTGTGTGTGATAACCTGCAGCTGTACATGGAGAAGTACGAGGAGGAGTTCAGGGGATACCTGAAGGAGTTTGTAGAGGCTGTGTGGAGGCTCCTCATGGCGCCAACGGCCTCGCCGTCCTGCGGGCAGCTTGCGGTGACTGCAATAAGGTTCTTGACAACAGTCGCTGAGAGTGTGTACCATGCGTTGTTTGGGAGCCCTGAGGCAATGAAGCAGATATGTGATAGTGTTGTTGTGCCTAACCTGCGCTTGCGGGATGAGGATGAGGAGTTGTTTGAGGGGAACTGGGTGGAATATGTCAGGCGTGACGCAGAGGGGAGTGATGCGGATACTCTGAGGCGTGCTGCATGCCGGTTGCTGCGGGGGCTTGCAGCGAACTACCGGGAGCAGGTGGCTGCACTTGTTTCAGCGCAGGTTCAGCAGATGTTGGCTGCATACGCAGCTGATCGGGCAAACAACTGGAAGGAGAAGGATGCTGCAATATACCTTGTTATCGCTCTTATGCAGAAGCCCGGTGCCACAGGTGGTGGGACACCTGTGGTTGACATGGAGAGCTTCTTTAAGTCTGTGATCGTGCCCGAGCTGCAGGCCCCTGATTGGCAGTCTGAGCCAATGCTGAAGGCAACCGTTCTGAGGTTCTTGAAGGAGTTCAAGGATCAGATCCCCAAAGCCACTTCACTAGCACTGCTTCCAAGTGTGATAAGGTTCCTGACACATGAATCCAATGTTGTCCATTCCTATGCCGCAACCTTTATCGAGAACCTGCTGATCATCAAGGATGTGGTCCCGGTACCAGGGGTGAACGTGGTGACCAGGGCTCCACGTTATGTTGCTGCCGATATCAACCCATTTGCCCAGCAGATTATTCAGAACCTGTCCAAGGCGCTAAGTTTTCCTGATTCGTATGAGAACCCCTATCTGATGAAGTGCCTGTTGAGAGTGCTTGGGATTGCCAATGTTGCCGGCCAAATCGTTCATGAGATTACTGCTCGTCTTGTGGGTATTCTCATGGAAGTGTGCAATAACCCCAAGAACCCTGACTTTAACCATTACTTGTTTGAGGCTCTGGCAGCTGTGATTGGCCGGGCTGGTGAGCAGGACCCAGCACTACTCCCTGGATTTGAGGCAAGCCTTTTCCCAGTGCTCCAGAGGATATTGGTTGAGGACATCTCAGAGTTCTGGCCATATGCTTTCCAGATATTCGCACAACTTGTCAATTTGAGCCGACCACCTCTCTCACAGAATTACATGCAGCTGTTTGGTGTCCTGCTGAGCAATGCAACTTGGGACCGACCACCGTGTGTTCCAGCCTTGGTTCGCTTGCTGCGAGCATTCCTTCGGAAAATTCCAAATGAGCTAAACCAAGAGGGCCGGCTGCCAAATATCCTAGTGATATTCCGTAGTCTCCTTTCGCGAAGCAGCACTGAAGATTCTGCATTCTACATGCTTAACACACTAGTGGAAAATGTTGGTTTTGACATTATGAATCCGTACATAAGTGAGATATGGAGTGCTCTGTTTACTCGACTACAGACTAGGCAGGCAGTGAAGTTTGTGAATTCTCTTGTGGTCTTCATGTCCTTAGTGTTGGTCAAATATGGGCCAGTTGTTCTTGTCAGTTCCGTCGATGCAATTCAGCCAAATCTTTTCACCACAATCCTTCAGCGTTTTTGGATCCCCAATCTCAAATCGATCAAAGGGTCTCTTGAAGTTAAGCTGACAGCAGTTGCCTCAACAAAGTTGCTTTGTGAGTCTGCTGTACTGTTGGATGCTGCTGCTGCCCAATCATGGGGCAAATTGCTTGACAGCATCGTTGCACTGTTGTCCAGAACGAACCAAGATGGAGCACAAGAAGAGCAAAATGACGGCACTGATGCAGTGGATATTCAGAAGACATCAGGTTATTCGGTCTCATTTGTACGCCTTCAATATGCTGGGAAAAGTGAAGATGATCTGCTGAAAGAAGTAAATGATCCAAAACAGCTTCTGGTCACATCCCTGGCCACACTTTCTGCGCAGTCTCCTGGGAGGTTTGGTCCTATCATTGAGCAGCATGTGGACCCAGCAAACAAAAGCGTTCTTATTCAACTTTGCTCTGCCTACAATACCAACATTGTCTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002550G0300 gene.
GGGCCTTGGTTGGGTATTGTTTTTTCTTTCTTTTTATCGTTTTCATTTTCATCCTACGCTAGTCGAATTTTTCTCTACAAAACTAGGTCTCGGACTCTGTCGTCCAAAGGAATAGTAGAGGATATTTCTATCACCAATTCAATTAGCGACAGGATTTTTGTTGCTATTTGAATTGGCGACAGGTTTCTAAAATTTTTTAAATATATCAAATGAGCTAAAAAAAATATGATATTTTTTTGTGTAGCCTTCTGACATAGTGTATTTGCTTTTGTAATTTTTTCATAATTTTATCCGTTCTGAATTTTTCTTTAAAATTCATTTACGTATACTATTTGTAGGAATTTTGGAGAAAAATTCATAATGGATAAAATTATAGAAAAATTACACAAGCAATTACACTATGTCAGAAGGCTCCAAAAAATAGTAATTTTTTAAGCTCATTTACTATATTTAAAAATTCCTATAAACCTGTCGCCAATTCAAATAGCGACAGGAATCCTATCTCTAATTGAACTGACGACAGGAACCTCCCCCACTGTTCTCTTTGGCAACAGGGTCCCTGTCGCCAATTAAAATGGTGATAGGAACCTAGTTTTGTAATTGTTTTGGACGACTACTTAGTTTTGTAAATAAAAAATTAAAAAATTCTTCTTGAGTTTGGCTGGTCGCTTTTCTAATATCACCTCTTAAGGCATGCTACGCACGTGTAGAACTCGGGCAGCCCGTGCACAACTCAGCATGAAACATAAAAGCTGAGAAAATGCAGGCATGAAGCAACCCTTAATGTAGTGAGTTATCATTTGAACCATTGCACAATTGTTCAGTCAAAGCAGCAATTATACACAGATAGAACCCAATATAGGTGCACCATACATAATGGTATAGTAAATATGGATGAGTAAACTATAAAGGCAAAAGCTAGAATAAAGTTCTAGATGTTGTATCTAATAGTTTTGCAATCTAGCGGGTAGCAAGTACTAATCATCTAAAATAAACTTACA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002550 Download
Protein sequence
Protein sequence
MEVPPEMLDTLAGWFAQSLSPDTAARRAASQNLSSAAATPGFALALLGLASSPRHDLEARLAASVNFKNLLRRRWPKPSPDADDADHLPASDCAIIKAHLLQLLLTAPPLIQAQLSEALAAAAASDFPAKWESLLPSIVSSLGTAISAGDVPATNSLLAAAASLFSSFSNAFDNNALRLDLKYCLENFAAPHLEVFLSTSRRLQAAAATANPLELRPVFECLRLCCEIFYSLNSVDLPEFFEDHMREWMTEFRAFLTTSYPPPIEADGGPDALRSAVCDNLQLYMEKYEEEFRGYLKEFVEAVWRLLMAPTASPSCGQLAVTAIRFLTTVAESVYHALFGSPEAMKQICDSVVVPNLRLRDEDEELFEGNWVEYVRRDAEGSDADTLRRAACRLLRGLAANYREQVAALVSAQVQQMLAAYAADRANNWKEKDAAIYLVIALMQKPGATGGGTPVVDMESFFKSVIVPELQAPDWQSEPMLKATVLRFLKEFKDQIPKATSLALLPSVIRFLTHESNVVHSYAATFIENLLIIKDVVPVPGVNVVTRAPRYVAADINPFAQQIIQNLSKALSFPDSYENPYLMKCLLRVLGIANVAGQIVHEITARLVGILMEVCNNPKNPDFNHYLFEALAAVIGRAGEQDPALLPGFEASLFPVLQRILVEDISEFWPYAFQIFAQLVNLSRPPLSQNYMQLFGVLLSNATWDRPPCVPALVRLLRAFLRKIPNELNQEGRLPNILVIFRSLLSRSSTEDSAFYMLNTLVENVGFDIMNPYISEIWSALFTRLQTRQAVKFVNSLVVFMSLVLVKYGPVVLVSSVDAIQPNLFTTILQRFWIPNLKSIKGSLEVKLTAVASTKLLCESAVLLDAAAAQSWGKLLDSIVALLSRTNQDGAQEEQNDGTDAVDIQKTSGYSVSFVRLQYAGKSEDDLLKEVNDPKQLLVTSLATLSAQSPGRFGPIIEQHVDPANKSVLIQLCSAYNTNIV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above