gene PH01002475G0070
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002475:54704 - 67890(+ stand)   Name
Alternate name Locus tag PH01002475G0070
Length of gene 13187  bp Length of CDS 2058  bp
Product information
Feature type
CDS
Product name
WD domain, G-beta repeat domain containing protein
Alternate name
Molecular weight
(predicted)
77960.7349200001  kDa
Isoeletric point
(predicted)
5.81009292602539
Length
685  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128313 2
Please click OG5_128313 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G40360.1
Transducin/WD40 repeat-like superfamily protein
Transducin/WD40 repeat-like superfamily protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPr
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os07g25440.1 WD domain, G-beta repeat domain containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 600 685
Detailed signature matches
    1. SM01035 (BOP1NT)
    2. PF08145 (BOP1NT)
    1. SSF50978 (WD40 repe...)
    2. PS50294 (WD_REPEATS...)
    1. PS50082 (WD_REPEATS_2)
    2. SM00320 (WD40)
    3. PF00400 (WD40)
    1. PS00678 (WD_REPEATS_1)
GO term prediction

Biological Process

GO:0006364 rRNA processing

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 219727 78 361 3.19E-119 pfam08145 BOP1NT cl18522 -
superfamily 219727 78 361 3.19E-119 cl18522 BOP1NT superfamily - -
non-specific 238121 363 618 1.92E-22 cd00200 WD40 cl02567 -
superfamily 243092 363 618 1.92E-22 cl02567 WD40 superfamily - -
non-specific 238121 364 644 4.23E-21 cd00200 WD40 cl02567 -
non-specific 238121 513 650 1.04E-08 cd00200 WD40 cl02567 C
non-specific 197651 361 400 1.18E-07 smart00320 WD40 cl02567 -
non-specific 201208 362 399 1.57E-07 pfam00400 WD40 cl02567 -
non-specific 238121 362 400 2.08E-06 cd00200 WD40 cl02567 N
non-specific 197651 580 619 0.00165826 smart00320 WD40 cl02567 -
non-specific 201208 582 619 0.00167694 pfam00400 WD40 cl02567 -
multi-dom 214986 78 361 8.26E-103 smart01035 BOP1NT - -
multi-dom 225201 366 619 2.05E-14 COG2319 COG2319 - C
multi-dom 225201 361 618 4.52E-12 COG2319 COG2319 - NC
multi-dom 225201 362 572 2.65E-07 COG2319 COG2319 - N
multi-dom 225201 356 424 8.06E-06 COG2319 COG2319 - N
multi-dom 225201 367 416 0.00457735 COG2319 COG2319 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic structural tetrad G370,H371,S389,D393,W399,E400,G413,A431,D435,L441,N442,Q466,D485,H491,H492,G508,V524,K527,Y533,D534,S546,G547,I564,D569,F575,D576,T589,H590,S608,D612,F618 40 31 238121
 
DNA sequence
Upstream 1000 bp region from PH01002475G0070 gene.
AGACGATTACATGCTTAAGAATTGTTGGTTGCTGATAGATGATGCCACTTCCCAGTCGGAGTACCTGCGCGTCCACGTCACTTTCTGAACATAGCGACGTCCAATTACCTATCGACAACATCCAGGTAATTGGATGTCCTGACGCTCTCCTTGCATCCATACTTCTTAAACCTGTATGGGCTCAATGAGATTGCACGTGGCTACTGTCTTATCCTTCTCATGCTGCGTGGACGGTCCCTCCAAAGTGGCTGAGAGACTACGAACAATGTATAATATGATGTCAGTTTTAATGGCACAAGCAGCCACTACTTGGAGCTTTATAGAGAAAAGTTATCACAGATGGTTTGTGGCTAAAACCGTCCGTAATAGGTATCACAGACGGTTTTAGCCACAAATCGTCTGTGATAGGTTACTATCACAGACGGTTCTCAGTTAATAACCATCTGTGAAAGTATGCATCACAGACGGCTCATGTCATCACTGACCCATAAACTCAGACGGCTCATGAAACCGTCTGTGATGATGTTTTTGAACCATCTGTGAATACCTTTTTTTGTAGTAGTGCACCCAGATTCTCCACCATCTGCTGCAGTCCCGTCAGAGTGTTGTCGACGATTGGCCTCTATGCTTTCGCATTTTTCATACGCCCATCCATCGCCGTGAGCATCGACATGATCATCTTCACATTGTCGTCCAAGGTGGAGACCTTTTCTTTCGCTGCCGCCATCTTGGCCGTGAGCGTGGGCCGCGCTGCCTTCTTCTTCGCCACGATTGCCTCAGATCTGATGGCTCTGATACCAATCTATCATGATCCTAGCGTCGCGTCAGAGGATTCGAGACGATTTCACGGTGATTGAGAGGAAGGAGCGAGGTGAGGAAAAACAAGATAGGAGAGGATGTGTAAATCTCATATGTTTTTCGATGCCAGAGTCGGTTTGGTACACAGTCCTAAATCCCCTACGAGCTGTAGCCCGATAGACACACCTATAGCACAACCGACA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGGCACAGCGACGGCGACGGCGACGGCGACCACGACGACCTGTCCGCCGACGATTCGCCGTGGAGCAACGACGTCTGGTCCGAGGACGATGAGGGGTCGCTGTCGTTTGAGGACAGCGGTGAGGGCTCCGACGCCGAGGCCGACGAGCCGGAGGCGGCGGAAGAGAGCGACTCTTCAGGGGATGAGGTGGCGCCGCGGAATACGGTGGGGGTCGTGCCGCTGGAGTGGTACAAGAACGAGGAGCATGTCGGCTACGACATCTCCGGGAGGAAGATCAAAAAGCGGGATAGGGAGGGCCGAATCGAGGCCTACCTCAGGAATGCTGATGATGCTAAGAATTGGAGGAAGATCTATGATGAGTATAATGACGAGGAGGTGCAGATTACCAAGGAAGAGGCTAAGATAATTAGTAGATTGTTGAAAGGAAAGACTCCACATACCAATGTTGATCCATATCCAGATTATGTTGATTGGTTTGAATATGATGATAAAGGGCATCCGCTTTCTAGTGCTCCTGAGCCAAAGAGGCGATTTGTTCCCTCAAAGTGGGAGCAGAAGAAGGTTGTTAAACTTGTTAGAGCTATTCGTAAAGGATGGATAAGGTTTGACAAGCCAAAAGAGGAGCCTAACTTTTATCTCTTATGGGGAGATGAAACTGATACAGCAGACAATAAGCGTCAAGGCTTGAGTTACATTCCCGCGCCTAAATCAAATTTACCAGGTCATGAAGAGTCATATAATCCTTCTGTTGAATATATTCCTACACAAGAGGAGATAGATTCGTACCAGCTTATGTATGAGGAGGACAGGCCGAAGTTTATTCCACGACGGTATTGTATCATTCATCATTTTCATTATGAATTTTCTTATGCATGGTCTGGGAAATATAAGTTGAGTTGTGGAATTGCTAGGTTTGATTCTCTTCGAAGTGTACCTGCTTATGAGAAGGCACTTAGGGAAGGATTTGATCGGTGCCTAGATCTTTATCTATGCCCTCGAACCCGCAAAAAGCGTATAAACATTGATCCTGAGTCTCTCAAGCCCAAGTTACCTAGTAAAAAAGATTTGAGGCCATACCCAAGAACTTGTTACCTTGAGTTTAAGGGCCATAATGGTGCAGTGAAGTCTCTTTCAGTTGAAGCAACAGGGCAATGGATAGCATCAGGTTCATCTGATGGAACAATTCGTGTTTGGGAAGTTGAAACTGGTCGCTGTCTTAAGGTTTGGAACGTTGGTGGTGATGTCCATCATATTGCCTGGAATCCTTCACCTGACAGGCCAATTCTTGCTGCTATTGTGGATCATGATCTGCTGCTTCTTAATGCTGAGGTGGGGGATGATGAAGTTCAAATGAGGACAAAAGGGCTCCTTCGTGTTGAGGAACCGGCTCCTCAAGAAGATACTGGTGATAAGAAACCAGCTGTGAGGTGGGTGAAGCATGACAAACTTGACGGAATCACATTGATCCATCATAAGCTCTCCAAGAAGCACTCGCACCATCCTTTCCGTAAACTGCCAGGCCTCCCTGTTGCAGCAGCATTCCATCCAAGTCAAAAGATGTTCTTTGTTGCCACTAAGAAATTTGTTCAGGTTTATGATCTCCAAAAAGCGCAGGTAGTCAAGAAGCTGGAGTCAGGTGTCCGTGAGATTTCCTCTATCTCAATCCATCCTGGCGGTGATAATGTTATTGTGGGCAGCAAAGATGGCAAATTGTGTTGGTTCGATACCGATCTATCTACACGGCCATATAAGACATTAAAGACCCACTTGAAGGATATCACTAGTGTTACTTTTCACCGGAGATACCCTCTTTTTGCCTCATCCTCAGAGGATTGTACAGCCTATGTGTTTCATGGAATGGTCTATTCAGATCTTAACCAGAACCCACTTATTGTACCATTGGAAATTCTTCGTGGTCATTTGAGTTCAGATGGAAGAGATATGGTGGGGCAATTTGTAACCATTAGTTGTGCTGTTGTTGGTGTGCAGGAGTTTTGGATTGCAAATTCCATCCAAGACAGCCTTGGTTGTTCACTGCTGGTGCTGACTCCGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002475G0070 gene.
AAAAAAAAAATATAGATGAGAGGCAGAGGTTTTCATAGTCGTGGCAATTGTAGCTGTGTAACAGGAATAGAAAAATAACTTTTGTGCTGTCACTGGACTAGACGAAGAACATCGGGATTCCGGAAGTAATTTCGGTGCTGTCACAAGTATGTGGGCAGGGTGCTGCTATATTATGTTCTGTGAAGCTGAACTAACAGAGTAAAGTTGGAGCTTGAGTTTGATGCGGTGCAACTTAGCGAATTTGTAATATTCTTCGGTTTATGTTATGAACTTGTTTTATTGAACACCCGTAGCCTCTCTAACCAAGGGCTGAGAGATGCCTTATGAATTGCCTAGGCTTCCACCATATAGTGCGGTACTCAGGGTTCACAACTCCGGGGGGAACTGAATCCACGCTTTACAGGTGTGGACCAGGATATGGGATTCGGGCCGAATTTTTTTAATACCAAGTTTGAGTTTTGAATGTTGGAAGTGATTAATGTAAGGAACAAGTTCATTTTGTGTAAAAAGCAACCTTCAACTACGAAAACGAAACTGGATAATCGACTCCTTCAATTGTCAAATCTGGGTATTTTACCCTTTGGAGCCATCCCACACCAGTTTTTGACTGATGCGGCGGTCGTTCTAACATGGTTTGTGCTGGTTTCCGATTGACGTGGCAACCTAGTCAGCAAATAGATAGAAAAAAAAATGTTGGGCTCACCTGTTGGAACATCCTTTCCTACTCTTCCTCTTCCATTCCATTTCCCGTCCCTGGTCTCTCCGGTGTTCTCCATGGAGACTGCTCACCATGGACAGCGCTCTCCTCGTAGGCCGCAGCGGCCAGCTGGGGTGGTGAAGGCCCTTCGGGATCAGGACGCGTGCGGTAGTGGTGACGTCTTTAGTCTTCTCCTTTGGCAACGGCTTTGTGTCCGGACTCTCTAGAGCGCCACGCTGGTTAGTGGAGGAGTCAGGAATTTTTTTGAAGTTTGGGTAAGCCCGTGAGGAGACGTTGGTCGTCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002475 Download
Protein sequence
Protein sequence
MGHSDGDGDGDHDDLSADDSPWSNDVWSEDDEGSLSFEDSGEGSDAEADEPEAAEESDSSGDEVAPRNTVGVVPLEWYKNEEHVGYDISGRKIKKRDREGRIEAYLRNADDAKNWRKIYDEYNDEEVQITKEEAKIISRLLKGKTPHTNVDPYPDYVDWFEYDDKGHPLSSAPEPKRRFVPSKWEQKKVVKLVRAIRKGWIRFDKPKEEPNFYLLWGDETDTADNKRQGLSYIPAPKSNLPGHEESYNPSVEYIPTQEEIDSYQLMYEEDRPKFIPRRYCIIHHFHYEFSYAWSGKYKLSCGIARFDSLRSVPAYEKALREGFDRCLDLYLCPRTRKKRINIDPESLKPKLPSKKDLRPYPRTCYLEFKGHNGAVKSLSVEATGQWIASGSSDGTIRVWEVETGRCLKVWNVGGDVHHIAWNPSPDRPILAAIVDHDLLLLNAEVGDDEVQMRTKGLLRVEEPAPQEDTGDKKPAVRWVKHDKLDGITLIHHKLSKKHSHHPFRKLPGLPVAAAFHPSQKMFFVATKKFVQVYDLQKAQVVKKLESGVREISSISIHPGGDNVIVGSKDGKLCWFDTDLSTRPYKTLKTHLKDITSVTFHRRYPLFASSSEDCTAYVFHGMVYSDLNQNPLIVPLEILRGHLSSDGRDMVGQFVTISCAVVGVQEFWIANSIQDSLGCSLLVLTP
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above