gene PH01002440G0410
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002440:205203 - 207923(- stand)   Name
Alternate name Locus tag PH01002440G0410
Length of gene 2721  bp Length of CDS 717  bp
Product information
Feature type
CDS
Product name
MYB family transcription factor
Alternate name
Molecular weight
(predicted)
26764.4406199999  kDa
Isoeletric point
(predicted)
5.97906875610351
Length
238  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_141610 2
Please click OG5_141610 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G09600.1
Homeodomain-like superfamily protein
Homeodomain-like superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONT
1E-46
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g06320.1 MYB family transcription factor, putative, expressed 1E-105
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 238
Detailed signature matches
    1. SSF46689 (Homeodoma...)
    1. PF00249 (Myb_DNA-bi...)
    2. SM00717 (SANT)
    1. PS51294 (HTH_MYB)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003677 DNA binding
GO:0003682 chromatin binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238096 18 61 9.01E-07 cd00167 SANT cl17250 -
superfamily 247804 18 61 9.01E-07 cl17250 SANT superfamily - -
non-specific 130620 14 64 1.48E-14 TIGR01557 myb_SHAQKYF cl17250 -
non-specific 215818 16 60 1.06E-10 pfam00249 Myb_DNA-binding cl17250 -
non-specific 197842 16 61 2.17E-07 smart00717 SANT cl17250 -
multi-dom 227584 17 52 0.000450367 COG5259 RSC8 - NC
multi-dom 227445 17 75 0.00734915 COG5114 COG5114 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific DNA binding site W19,K48,T49,I51,Q52,R54,S55,H56,Q58,K59,Y60 11 11 238096
 
DNA sequence
Upstream 1000 bp region from PH01002440G0410 gene.
TGTCTTGTTTCTTTCCCATGAATATGGCTAGGCATACAGTGAGGCAGCGCGCAGAACGTACCAAAAAAAGCCAGGAATCATGGGCGGCGGGCACGACATGCACGGGCACAGCGGCGGCGCGAAGGGGTTCGTATCCAACCTCGTCCACGGCGGGCAAGGCCAAGGGCACGGGCACGGCCATGGCCATGGATACGAGCAGGGATACGGCCACGGCCATGGATACGAGCAGGGATACGGCCATGGGCAACAGCACGGTTACTACCCCCCTCCTGCCGCCGGGGCTTACCCTCCGCAAAGCTACCCGGCGCACGGCTACGCGCCGGCCGCCTACCCTGCGCACTCGGCGCAGCACGGTAAGCACGCACCAGCGATAAGTTTTGTTGCGTCTGATCGCAAAATCGGCCGCGGTTGGTGTGATCACTGATGAGTTAATTTCGTACAGGGCACATGGGGTCGTACCACACCGGGCACGGCGGCGGGCACGGCGGCATGTTCGGCGGCAAGCACAAGGGCGGCATGTTCGGCGGCAAGCACTCCAGGAAGTGGAAGTGAAGTAGTGTGACGCGAGACGTACGTACGTACGTACCCAGCTACACTCACGTATCTGCCTAAGTTAACCGTTCACGCTCCGTATGTGTGTAATAAATTAAATAAAGTGCTAGGCAGGCGTGCGTGTTTGCTAGCTTGCGCTGGTAATTAAGTCTGTGGTACAGTGAGTGTGAGTGTGGCGTAGTACAAAATAAAATGTGACATGTGTAATAACCTCTCTCTCTCTATATGTATATGCTCGGTAATCGGCTTGTGTGCTGTGTGCCGAGCAGTCTTCTGTTTGTATCAGTCGTATGTATAAACTGAGAGTAATACACATACAGTTCGCACAACAATGCTCTCCTACGGCACGTGCTAGATTCGGCTTACGTGAGGTGGTATTGTAAAAGGCTATCTGTTCATTAAGGCCGGCCGGGAGGTGGATATGTTGGTGGCCGAGTCGGCCTACCAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCCGGGGAAGAAAGCGAGGAAGCCGTACACCATCACCAAGCCCCGGGAGAGGTGGGCCGCCGAGGAGCACGAGCGATTCCTCGACGCGTTGCTGATGTTTGGCCGTGACTGGAAGAAGATTGAAGAGCATGTCGGCACCAAGACGACGATACAGATCCGCAGCCATGCCCAGAAGTACTTCCTCAAGGTTCAGAAGCTCGGCTTGGCCGCCGGGCTGCCGCCGCAGTACCCGAGGGGCAGTAGTGTTTCAGAGTGTTTTTCAGACATGCAAAACTTCGATTGGGCAGGCACTTCAGGTGCTTCAGCCTGGGGGAACCATGGTGCAGAAAGCCAGGCTGAACAAGCTGCAACGTACCCAGGTGGCAATTCATTCATGGGGACACCGAGCTTCAGCAATATGAGCATGGACTGGACTGGCAGCACAAGTGAAGCGTCAGCAATTGGTGATGAGCAGTATGAAACGATTCAGCTTCCACTGTCACCGGATGATCTGCATTTTGCGCAAGTATACAGGTTCATTGGCGACATATTCGATCCAAACACGCCATGCCCAATTGAAGCCCATCTGCAGAAACTGAAGGACATGGATGATATCACTGTGAAGACGGGCCTACTCTACTCACATAATGTTTCAGAGTGTCTAGCACTATACTTCATGTTTGTTAAGCGCATACTGATTGTTACATGTACTGAAGGATGTCTTTACTGGAAATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002440G0410 gene.
GCCCAAACGCGATGTCCACACACACATATATACAGAAAGAATCCATTTGGAGTTTGGAGTTTGGACAGCTAATTGAGGATGGATCCAGGATGCATCCCTCTCTCAGTCTCTCTAGTCTCTGCACGGATCAGCAGCAATTTCAGACAACGAATCGACGATGTGACGATGCGAGATCGAGTTCGAGGGGGCCTAAGAATTAGGCGAGGCCTAAGGTAAGGTACAGTTGGCACTTGCATGGATGTGGCAAGCTAGGTTGCATTCAGTAGCCACTAGTACGGCTCAAGCGAGGGCAGGCGCCGGGTTGGTGCAAGCAAAGCAAGCGGCGACACTTGTTGCTTTGGTCGGAGCGAGACGTGTCCTCGTTGGGGAAAAGGAGCACGTGCGCGTGTGTGTGGATGCCTGGATACGGCAATGCTTATCTCCCGAGCGCTTTCCGTTTCTGGAAAGTCGGTACGTTTTCGCCGCGTGCGTGGAACGGGCTCGGTTCGTTACATTGGATTTGATGGGCTGGGCCGCTGGGCACACCGTACGCTTGGACTGCCACGTCGGGGAGAAATGCTAGACACGATTTTAAGCTCTCTTTTTTGCGAGTGTAGTCATGTCAAGACTCACAAATTACCGTTCACGTGATCAAATCTTGGAAAATCATCGTAGGAAATACACATGAAAAACCCGCTCAACACGCGGAATCAAACTCTACACGCGCATGCTAATACAAGCACCACATGCCGATTGAGCTATCCAACTGCTATATTAGATTAGGATTACTTTAGGGTCTTTTTTTAACTTTAGGGTCTTTCTTAACACAAAAATACTATTTAAAAAAGAAAAACAAACAATTGCTAAAAAAATCTTTCCATTTCAACAACAAGCGTGTGTATATTCACGCATGCCTGAAAACTGCCGTGCTAATTAAGTTGGATGCGTGTGCAGTTCATTGTACCAAATTGTACGAATTAGCAAATAGTTCGTGTCCCTTTTGATCGACGTGGGAAAGAAGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002440 Download
Protein sequence
Protein sequence
MPGKKARKPYTITKPRERWAAEEHERFLDALLMFGRDWKKIEEHVGTKTTIQIRSHAQKYFLKVQKLGLAAGLPPQYPRGSSVSECFSDMQNFDWAGTSGASAWGNHGAESQAEQAATYPGGNSFMGTPSFSNMSMDWTGSTSEASAIGDEQYETIQLPLSPDDLHFAQVYRFIGDIFDPNTPCPIEAHLQKLKDMDDITVKTGLLYSHNVSECLALYFMFVKRILIVTCTEGCLYWK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above