gene PH01002440G0320
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002440:160067 - 168562(- stand)   Name
Alternate name Locus tag PH01002440G0320
Length of gene 8496  bp Length of CDS 1653  bp
Product information
Feature type
CDS
Product name
protein kinase
Alternate name
Molecular weight
(predicted)
60549.1287200002  kDa
Isoeletric point
(predicted)
7.0101203918457
Length
550  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127930 60
Please click OG5_127930 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G19130.1
S-locus lectin protein kinase family protein
S-locus lectin protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, sugar binding, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane sys
7E-169
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g06240.1 protein kinase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 100 200 300 400 500 550
Detailed signature matches
    1. PF00954 (S_locus_gl...)
    1. SM00473 (PAN_AP)
    2. PS50948 (PAN)
    1. PF08276 (PAN_2)
    1. SSF56112 (Protein k...)
    1. PF00069 (Pkinase)
    2. PS50011 (PROTEIN_KI...)
    1. SM00220 (S_TKc)
    1. PS00107 (PROTEIN_KI...)
    1. PS00108 (PROTEIN_KI...)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

GO:0006468 protein phosphorylation
GO:0048544 recognition of pollen

Molecular Function

GO:0004672 protein kinase activity
GO:0004674 protein serine/threonine kinase activity
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173623 304 490 2.84E-44 cd00180 PKc cl09925 -
superfamily 245201 304 490 2.84E-44 cl09925 PKc_like superfamily - -
specific 238531 142 235 4.07E-19 cd01098 PAN_AP_plant cl00112 -
superfamily 241619 142 235 4.07E-19 cl00112 PAN_APPLE superfamily - -
non-specific 173724 302 495 1.45E-34 cd06606 STKc_MAPKKK cl09925 C
non-specific 173624 302 492 6.15E-34 cd00192 PTKc cl09925 C
non-specific 173659 302 494 1.41E-29 cd05122 PKc_STE cl09925 C
non-specific 201524 15 121 1.63E-28 pfam00954 S_locus_glycop cl03036 -
superfamily 201524 15 121 1.63E-28 cl03036 S_locus_glycop superfamily - -
non-specific 173755 302 495 1.71E-27 cd08215 STKc_Nek cl09925 C
non-specific 173628 300 492 4.38E-26 cd05038 PTKc_Jak_rpt2 cl09925 C
non-specific 133171 300 496 5.84E-26 cd05039 PTKc_Csk_like cl09925 C
non-specific 173731 300 494 7.70E-25 cd06627 STKc_Cdc7_like cl09925 C
non-specific 133180 300 506 2.07E-24 cd05049 PTKc_Trk cl09925 -
non-specific 173660 304 494 4.34E-24 cd05123 STKc_AGC cl09925 C
non-specific 133165 302 506 7.52E-24 cd05033 PTKc_EphR cl09925 -
non-specific 132957 303 495 1.16E-23 cd06626 STKc_MEKK4 cl09925 C
non-specific 133199 300 492 2.68E-23 cd05068 PTKc_Frk_like cl09925 C
non-specific 173733 302 494 3.57E-23 cd07829 STKc_CDK_like cl09925 C
non-specific 173723 303 494 2.10E-22 cd06605 PKc_MAPKK cl09925 C
non-specific 133191 302 492 7.27E-22 cd05060 PTKc_Syk_like cl09925 C
non-specific 133243 300 492 7.71E-22 cd05112 PTKc_Itk cl09925 C
non-specific 173672 300 494 9.92E-22 cd05581 STKc_PDK1 cl09925 C
non-specific 173626 302 492 1.18E-21 cd05034 PTKc_Src_like cl09925 C
non-specific 132954 303 494 2.25E-21 cd06623 PKc_MAPKK_plant_like cl09925 C
non-specific 173772 303 494 2.73E-21 cd08530 STKc_CNK2-like cl09925 C
non-specific 133248 302 492 3.04E-21 cd05148 PTKc_Srm_Brk cl09925 C
non-specific 132952 302 494 3.38E-21 cd06621 PKc_MAPKK_Pek1_like cl09925 C
non-specific 143333 302 494 3.41E-21 cd05118 STKc_CMGC cl09925 C
non-specific 132963 302 494 3.67E-21 cd06632 STKc_MEKK1_plant cl09925 C
non-specific 133194 304 533 7.00E-21 cd05063 PTKc_EphR_A2 cl09925 -
non-specific 173728 298 493 7.98E-21 cd06614 STKc_PAK cl09925 C
non-specific 133179 300 499 8.21E-21 cd05048 PTKc_Ror cl09925 -
non-specific 173629 302 493 1.12E-20 cd05041 PTKc_Fes_like cl09925 C
non-specific 132962 302 494 1.20E-20 cd06631 STKc_YSK4 cl09925 C
non-specific 143345 302 494 1.81E-20 cd07840 STKc_CDK9_like cl09925 C
non-specific 173637 300 493 2.66E-20 cd05059 PTKc_Tec_like cl09925 C
non-specific 133212 300 492 2.70E-20 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 C
non-specific 173650 303 495 5.52E-20 cd05094 PTKc_TrkC cl09925 C
non-specific 173671 299 493 6.19E-20 cd05580 STKc_PKA cl09925 C
non-specific 173669 305 495 6.22E-20 cd05578 STKc_Yank1 cl09925 C
non-specific 133172 302 492 7.08E-20 cd05040 PTKc_Ack_like cl09925 C
non-specific 133214 302 495 7.74E-20 cd05083 PTKc_Chk cl09925 C
non-specific 173736 302 493 8.80E-20 cd07832 STKc_CCRK cl09925 C
non-specific 132960 302 495 1.09E-19 cd06629 STKc_MAPKKK_Bck1_like cl09925 C
non-specific 173638 302 499 1.11E-19 cd05065 PTKc_EphR_B cl09925 -
non-specific 173640 302 499 1.38E-19 cd05067 PTKc_Lck_Blk cl09925 -
non-specific 173641 302 499 1.47E-19 cd05072 PTKc_Lyn cl09925 -
non-specific 173726 299 546 1.81E-19 cd06610 STKc_OSR1_SPAK cl09925 -
non-specific 143338 302 493 4.23E-19 cd07833 STKc_CDKL cl09925 C
non-specific 173639 304 499 5.02E-19 cd05066 PTKc_EphR_A cl09925 -
non-specific 143346 302 494 7.55E-19 cd07841 STKc_CDK7 cl09925 C
non-specific 132943 302 494 1.08E-18 cd06612 STKc_MST1_2 cl09925 C
non-specific 173648 303 495 1.08E-18 cd05092 PTKc_TrkA cl09925 C
non-specific 173732 304 494 1.21E-18 cd06628 STKc_MAPKKK_Byr2_like cl09925 C
non-specific 173634 302 492 2.05E-18 cd05053 PTKc_FGFR cl09925 C
non-specific 173670 307 493 2.77E-18 cd05579 STKc_MAST_like cl09925 C
non-specific 173649 300 495 3.25E-18 cd05093 PTKc_TrkB cl09925 C
non-specific 173625 304 508 4.63E-18 cd05032 PTKc_InsR_like cl09925 -
non-specific 133168 304 506 7.49E-18 cd05036 PTKc_ALK_LTK cl09925 -
non-specific 173739 304 490 9.48E-18 cd07838 STKc_CDK4_6_like cl09925 C
non-specific 173633 303 492 9.84E-18 cd05052 PTKc_Abl cl09925 C
non-specific 173738 302 494 1.01E-17 cd07835 STKc_CDK1_like cl09925 C
non-specific 173636 304 495 1.18E-17 cd05057 PTKc_EGFR_like cl09925 C
non-specific 173734 302 494 1.25E-17 cd07830 STKc_MAK_like cl09925 C
non-specific 173757 302 494 1.43E-17 cd08217 STKc_Nek2 cl09925 C
non-specific 143367 303 500 1.82E-17 cd07862 STKc_CDK6 cl09925 C
non-specific 133167 304 492 2.05E-17 cd05035 PTKc_Axl_like cl09925 C
non-specific 173752 302 494 2.27E-17 cd07861 STKc_CDK1_euk cl09925 C
non-specific 133201 302 495 4.96E-17 cd05070 PTKc_Fyn_Yrk cl09925 C
non-specific 173770 302 492 5.33E-17 cd08528 STKc_Nek10 cl09925 C
non-specific 219774 158 213 5.61E-17 pfam08276 PAN_2 cl00112 -
non-specific 133211 304 492 8.97E-17 cd05080 PTKc_Tyk2_rpt2 cl09925 C
non-specific 132961 302 494 1.21E-16 cd06630 STKc_MEKK1 cl09925 C
non-specific 173630 304 506 1.22E-16 cd05044 PTKc_c-ros cl09925 -
non-specific 143344 302 500 1.29E-16 cd07839 STKc_CDK5 cl09925 C
non-specific 173661 304 494 1.76E-16 cd05570 STKc_PKC cl09925 C
non-specific 173730 304 494 1.90E-16 cd06624 STKc_ASK cl09925 C
non-specific 133216 302 492 2.07E-16 cd05085 PTKc_Fer cl09925 C
non-specific 133181 304 507 2.37E-16 cd05050 PTKc_Musk cl09925 -
non-specific 132951 292 494 2.58E-16 cd06620 PKc_MAPKK_Byr1_like cl09925 C
non-specific 173771 302 500 2.89E-16 cd08529 STKc_FA2-like cl09925 C
non-specific 173743 302 493 3.29E-16 cd07846 STKc_CDKL2_3 cl09925 C
non-specific 173751 302 494 3.83E-16 cd07860 STKc_CDK2_3 cl09925 C
non-specific 173702 307 495 4.07E-16 cd05611 STKc_Rim15_like cl09925 C
non-specific 173656 304 492 4.78E-16 cd05111 PTK_HER3 cl09925 C
non-specific 143341 302 494 5.11E-16 cd07836 STKc_Pho85 cl09925 C
non-specific 132940 302 494 5.87E-16 cd06609 STKc_MST3_like cl09925 C
non-specific 133219 300 492 6.09E-16 cd05088 PTKc_Tie2 cl09925 C
non-specific 133195 292 506 8.01E-16 cd05064 PTKc_EphR_A10 cl09925 -
non-specific 133200 303 495 8.75E-16 cd05069 PTKc_Yes cl09925 C
non-specific 133186 300 492 9.10E-16 cd05055 PTKc_PDGFR cl09925 C
non-specific 173658 300 523 1.05E-15 cd05114 PTKc_Tec_Rlk cl09925 -
non-specific 173760 304 500 1.83E-15 cd08220 STKc_Nek8 cl09925 C
non-specific 133213 287 495 2.45E-15 cd05082 PTKc_Csk cl09925 C
non-specific 132956 304 494 2.78E-15 cd06625 STKc_MEKK3_like cl09925 C
non-specific 173761 304 498 3.31E-15 cd08221 STKc_Nek9 cl09925 C
non-specific 133202 303 495 3.46E-15 cd05071 PTKc_Src cl09925 C
non-specific 173645 302 549 3.47E-15 cd05084 PTKc_Fes cl09925 -
non-specific 173663 304 524 3.56E-15 cd05572 STKc_cGK_PKG cl09925 C
non-specific 132988 292 494 4.54E-15 cd06657 STKc_PAK4 cl09925 C
non-specific 143371 299 494 4.69E-15 cd07866 STKc_BUR1 cl09925 C
non-specific 173631 304 492 5.95E-15 cd05045 PTKc_RET cl09925 C
non-specific 133204 296 495 6.19E-15 cd05073 PTKc_Hck cl09925 C
non-specific 132979 292 494 8.95E-15 cd06648 STKc_PAK_II cl09925 C
non-specific 173744 302 493 1.06E-14 cd07847 STKc_CDKL1_4 cl09925 C
non-specific 173764 303 490 1.16E-14 cd08224 STKc_Nek6_Nek7 cl09925 C
non-specific 173680 304 493 2.60E-14 cd05589 STKc_PKN cl09925 C
non-specific 133232 304 492 2.87E-14 cd05101 PTKc_FGFR2 cl09925 C
non-specific 133220 300 492 3.03E-14 cd05089 PTKc_Tie1 cl09925 C
non-specific 133189 302 492 3.08E-14 cd05058 PTKc_Met_Ron cl09925 C
non-specific 173652 304 492 3.86E-14 cd05100 PTKc_FGFR3 cl09925 C
non-specific 173657 300 516 5.19E-14 cd05113 PTKc_Btk_Bmx cl09925 -
non-specific 133187 301 499 5.37E-14 cd05056 PTKc_FAK cl09925 -
non-specific 143368 303 494 5.38E-14 cd07863 STKc_CDK4 cl09925 C
non-specific 173691 302 522 9.27E-14 cd05600 STKc_Sid2p_Dbf2p cl09925 C
non-specific 132978 302 494 1.02E-13 cd06647 STKc_PAK_I cl09925 C
non-specific 132986 302 494 1.45E-13 cd06655 STKc_PAK2 cl09925 C
non-specific 173675 304 493 1.66E-13 cd05584 STKc_p70S6K cl09925 C
non-specific 133247 303 512 1.77E-13 cd05116 PTKc_Syk cl09925 -
non-specific 173748 396 494 1.99E-13 cd07853 STKc_NLK cl09925 NC
non-specific 132947 302 524 2.41E-13 cd06616 PKc_MKK4 cl09925 C
non-specific 133246 303 492 2.62E-13 cd05115 PTKc_Zap-70 cl09925 C
non-specific 133174 302 490 2.95E-13 cd05042 PTKc_Aatyk cl09925 C
non-specific 132971 302 499 3.71E-13 cd06640 STKc_MST4 cl09925 C
non-specific 132950 397 524 3.91E-13 cd06619 PKc_MKK5 cl09925 NC
non-specific 173740 299 492 4.28E-13 cd07842 STKc_CDK8_like cl09925 C
non-specific 132946 397 494 4.74E-13 cd06615 PKc_MEK cl09925 NC
non-specific 133178 304 492 5.78E-13 cd05046 PTK_CCK4 cl09925 C
non-specific 133221 300 492 6.36E-13 cd05090 PTKc_Ror1 cl09925 C
non-specific 173683 304 494 6.52E-13 cd05592 STKc_nPKC_theta_delta cl09925 C
non-specific 173642 304 492 7.80E-13 cd05075 PTKc_Axl cl09925 C
non-specific 132980 397 494 9.47E-13 cd06649 PKc_MEK2 cl09925 NC
non-specific 173727 302 494 1.09E-12 cd06613 STKc_MAP4K3_like cl09925 C
non-specific 133229 304 492 1.16E-12 cd05098 PTKc_FGFR1 cl09925 C
non-specific 173735 303 492 1.18E-12 cd07831 STKc_MOK cl09925 C
non-specific 133228 300 492 1.19E-12 cd05097 PTKc_DDR_like cl09925 C
non-specific 132989 292 494 1.28E-12 cd06658 STKc_PAK5 cl09925 C
non-specific 132987 302 494 1.40E-12 cd06656 STKc_PAK3 cl09925 C
non-specific 173742 298 494 1.56E-12 cd07845 STKc_CDK10 cl09925 C
non-specific 133230 304 492 1.71E-12 cd05099 PTKc_FGFR4 cl09925 C
non-specific 173627 302 493 1.78E-12 cd05037 PTK_Jak_rpt1 cl09925 C
non-specific 173750 300 494 1.97E-12 cd07857 STKc_MPK1 cl09925 C
non-specific 173668 304 494 2.12E-12 cd05577 STKc_GRK cl09925 C
non-specific 132949 397 503 2.39E-12 cd06618 PKc_MKK7 cl09925 NC
non-specific 132990 292 494 2.42E-12 cd06659 STKc_PAK6 cl09925 C
non-specific 132942 304 490 2.89E-12 cd06611 STKc_SLK_like cl09925 C
non-specific 173753 304 545 3.22E-12 cd07864 STKc_CDK12 cl09925 -
non-specific 132981 303 494 3.46E-12 cd06650 PKc_MEK1 cl09925 C
non-specific 173644 304 492 3.88E-12 cd05079 PTKc_Jak1_rpt2 cl09925 C
non-specific 173747 302 494 4.21E-12 cd07852 STKc_MAPK15 cl09925 C
non-specific 88330 304 492 4.30E-12 cd05047 PTKc_Tie cl09925 C
non-specific 132991 302 493 4.89E-12 cd06917 STKc_NAK1_like cl09925 C
non-specific 143377 302 494 5.21E-12 cd07872 STKc_PCTAIRE2 cl09925 C
non-specific 173765 302 494 5.67E-12 cd08225 STKc_Nek5 cl09925 C
non-specific 132938 289 494 6.49E-12 cd06607 STKc_TAO cl09925 C
non-specific 132972 302 494 7.79E-12 cd06641 STKc_MST3 cl09925 C
non-specific 173632 299 492 8.01E-12 cd05051 PTKc_DDR cl09925 C
non-specific 173647 296 499 8.64E-12 cd05091 PTKc_Ror2 cl09925 -
non-specific 173678 399 521 9.14E-12 cd05587 STKc_cPKC cl09925 NC
non-specific 173749 396 495 1.13E-11 cd07855 STKc_ERK5 cl09925 NC
non-specific 173666 304 543 1.20E-11 cd05575 STKc_SGK cl09925 C
non-specific 173719 304 548 1.22E-11 cd05630 STKc_GRK6 cl09925 -
non-specific 173737 396 494 1.32E-11 cd07834 STKc_MAPK cl09925 NC
non-specific 173709 304 494 1.89E-11 cd05619 STKc_nPKC_theta cl09925 C
non-specific 173729 302 494 2.01E-11 cd06617 PKc_MKK3_6 cl09925 C
non-specific 132974 303 490 2.02E-11 cd06643 STKc_SLK cl09925 C
non-specific 143374 302 493 2.08E-11 cd07869 STKc_PFTAIRE1 cl09925 C
non-specific 143376 302 494 2.27E-11 cd07871 STKc_PCTAIRE3 cl09925 C
non-specific 133227 300 492 2.29E-11 cd05096 PTKc_DDR1 cl09925 C
non-specific 173651 300 492 2.35E-11 cd05095 PTKc_DDR2 cl09925 C
non-specific 132970 295 493 2.41E-11 cd06639 STKc_myosinIIIB cl09925 C
non-specific 133205 304 492 2.48E-11 cd05074 PTKc_Tyro3 cl09925 C
non-specific 173646 302 443 3.01E-11 cd05087 PTKc_Aatyk1_Aatyk3 cl09925 C
non-specific 132984 304 494 3.59E-11 cd06653 STKc_MEKK3_like_1 cl09925 C
non-specific 173710 304 494 3.89E-11 cd05620 STKc_nPKC_delta cl09925 C
non-specific 143354 396 494 3.96E-11 cd07849 STKc_ERK1_2_like cl09925 NC
non-specific 143375 302 494 4.12E-11 cd07870 STKc_PFTAIRE2 cl09925 C
non-specific 132985 302 494 4.66E-11 cd06654 STKc_PAK1 cl09925 C
non-specific 143342 302 493 4.67E-11 cd07837 STKc_CdkB_plant cl09925 C
non-specific 143378 302 494 4.82E-11 cd07873 STKc_PCTAIRE1 cl09925 C
non-specific 132966 290 494 5.64E-11 cd06635 STKc_TAO1 cl09925 C
non-specific 173741 404 494 5.71E-11 cd07843 STKc_CDC2L1 cl09925 NC
non-specific 173673 388 493 6.27E-11 cd05582 STKc_RSK_N cl09925 NC
non-specific 173698 304 494 6.30E-11 cd05607 STKc_GRK7 cl09925 C
non-specific 173655 304 492 6.50E-11 cd05110 PTKc_HER4 cl09925 C
non-specific 143359 289 494 6.79E-11 cd07854 STKc_MAPK4_6 cl09925 C
non-specific 173676 381 493 8.68E-11 cd05585 STKc_YPK1_like cl09925 NC
non-specific 132973 302 494 8.88E-11 cd06642 STKc_STK25-YSK1 cl09925 C
non-specific 143356 289 494 9.07E-11 cd07851 STKc_p38 cl09925 C
non-specific 173681 304 493 1.12E-10 cd05590 STKc_nPKC_eta cl09925 C
non-specific 133193 301 492 1.15E-10 cd05062 PTKc_IGF-1R cl09925 C
non-specific 173745 304 494 1.20E-10 cd07848 STKc_CDKL5 cl09925 C
non-specific 173769 299 492 1.42E-10 cd08229 STKc_Nek7 cl09925 C
non-specific 173746 405 494 1.44E-10 cd07850 STKc_JNK cl09925 NC
non-specific 143380 323 494 1.66E-10 cd07875 STKc_JNK1 cl09925 C
non-specific 173696 304 494 1.81E-10 cd05605 STKc_GRK4_like cl09925 C
non-specific 173762 302 490 2.07E-10 cd08222 STKc_Nek11 cl09925 C
non-specific 173703 348 494 2.12E-10 cd05612 STKc_PRKX_like cl09925 C
non-specific 173694 304 543 2.24E-10 cd05603 STKc_SGK2 cl09925 C
non-specific 133235 375 492 2.38E-10 cd05104 PTKc_Kit cl09925 N
non-specific 132982 304 494 2.41E-10 cd06651 STKc_MEKK3 cl09925 C
non-specific 173693 304 543 2.45E-10 cd05602 STKc_SGK1 cl09925 C
non-specific 173706 299 500 2.68E-10 cd05615 STKc_cPKC_alpha cl09925 C
non-specific 143381 323 493 3.35E-10 cd07876 STKc_JNK2 cl09925 C
non-specific 132983 304 494 3.45E-10 cd06652 STKc_MEKK2 cl09925 C
non-specific 133237 390 492 3.49E-10 cd05106 PTKc_CSF-1R cl09925 N
non-specific 143363 396 494 3.64E-10 cd07858 STKc_TEY_MAPK_plant cl09925 NC
non-specific 173682 304 494 3.71E-10 cd05591 STKc_nPKC_epsilon cl09925 C
non-specific 173677 304 493 3.88E-10 cd05586 STKc_Sck1_like cl09925 C
non-specific 173722 304 493 4.27E-10 cd05633 STKc_GRK3 cl09925 C
non-specific 132965 290 494 4.62E-10 cd06634 STKc_TAO2 cl09925 C
non-specific 173768 302 492 4.65E-10 cd08228 STKc_Nek6 cl09925 C
non-specific 173725 302 494 4.89E-10 cd06608 STKc_myosinIII_like cl09925 C
non-specific 132968 302 493 5.33E-10 cd06637 STKc_TNIK cl09925 C
non-specific 173654 304 492 5.33E-10 cd05108 PTKc_EGFR cl09925 C
non-specific 133192 299 492 5.91E-10 cd05061 PTKc_InsR cl09925 C
non-specific 173763 300 511 6.36E-10 cd08223 STKc_Nek4 cl09925 -
non-specific 132975 303 490 7.86E-10 cd06644 STKc_STK10_LOK cl09925 C
non-specific 143379 323 494 8.09E-10 cd07874 STKc_JNK3 cl09925 C
non-specific 132964 303 494 8.91E-10 cd06633 STKc_TAO3 cl09925 C
non-specific 173708 356 512 9.49E-10 cd05617 STKc_aPKC_zeta cl09925 C
non-specific 173758 302 494 1.13E-09 cd08218 STKc_Nek1 cl09925 C
non-specific 132967 302 493 1.37E-09 cd06636 STKc_MAP4K4_6 cl09925 C
non-specific 173721 304 494 1.49E-09 cd05632 STKc_GRK5 cl09925 C
non-specific 133240 304 492 1.65E-09 cd05109 PTKc_HER2 cl09925 C
non-specific 173695 304 493 1.78E-09 cd05604 STKc_SGK3 cl09925 C
non-specific 173699 304 494 2.07E-09 cd05608 STKc_GRK1 cl09925 C
non-specific 173754 303 490 2.07E-09 cd07865 STKc_CDK9 cl09925 C
non-specific 133233 402 492 2.08E-09 cd05102 PTKc_VEGFR3 cl09925 NC
non-specific 143349 302 493 2.83E-09 cd07844 STKc_PCTAIRE_like cl09925 C
non-specific 173697 304 493 3.16E-09 cd05606 STKc_beta_ARK cl09925 C
non-specific 133209 302 493 3.23E-09 cd05078 PTK_Jak2_Jak3_rpt1 cl09925 C
non-specific 173635 399 492 3.41E-09 cd05054 PTKc_VEGFR cl09925 NC
non-specific 173705 304 500 3.43E-09 cd05614 STKc_MSK2_N cl09925 C
non-specific 173662 364 494 4.10E-09 cd05571 STKc_PKB cl09925 NC
non-specific 143361 289 494 4.61E-09 cd07856 STKc_Sty1_Hog1 cl09925 C
non-specific 173707 299 494 4.87E-09 cd05616 STKc_cPKC_beta cl09925 C
non-specific 173679 356 499 5.34E-09 cd05588 STKc_aPKC cl09925 C
non-specific 143364 404 494 6.07E-09 cd07859 STKc_TDY_MAPK_plant cl09925 NC
non-specific 173720 304 494 6.17E-09 cd05631 STKc_GRK4 cl09925 C
non-specific 132969 295 493 6.30E-09 cd06638 STKc_myosinIIIA cl09925 C
non-specific 88519 356 499 6.89E-09 cd05618 STKc_aPKC_iota cl09925 C
non-specific 173664 304 493 1.00E-08 cd05573 STKc_ROCK_NDR_like cl09925 C
non-specific 143383 289 494 2.62E-08 cd07878 STKc_p38beta_MAPK11 cl09925 C
non-specific 133234 402 492 3.31E-08 cd05103 PTKc_VEGFR2 cl09925 N
non-specific 143385 286 494 3.40E-08 cd07880 STKc_p38gamma_MAPK12 cl09925 C
non-specific 143382 286 494 3.58E-08 cd07877 STKc_p38alpha_MAPK14 cl09925 C
non-specific 132953 398 494 3.88E-08 cd06622 PKc_MAPKK_PBS2_like cl09925 NC
non-specific 173674 368 500 3.98E-08 cd05583 STKc_MSK_N cl09925 NC
non-specific 173687 291 493 8.30E-08 cd05596 STKc_ROCK cl09925 C
non-specific 143384 304 494 1.02E-07 cd07879 STKc_p38delta_MAPK13 cl09925 C
non-specific 133217 302 442 1.10E-07 cd05086 PTKc_Aatyk2 cl09925 C
non-specific 173759 304 494 1.35E-07 cd08219 STKc_Nek3 cl09925 C
non-specific 173692 362 546 1.43E-07 cd05601 STKc_CRIK cl09925 NC
non-specific 173653 402 492 1.71E-07 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 173686 364 494 2.65E-07 cd05595 STKc_PKB_beta cl09925 NC
non-specific 173704 397 493 2.76E-07 cd05613 STKc_MSK1_N cl09925 NC
non-specific 173685 364 494 3.48E-07 cd05594 STKc_PKB_alpha cl09925 NC
non-specific 173684 364 494 3.56E-07 cd05593 STKc_PKB_gamma cl09925 NC
non-specific 133175 301 492 4.65E-07 cd05043 PTK_Ryk cl09925 C
non-specific 143372 303 494 5.28E-07 cd07867 STKc_CDC2L6 cl09925 C
non-specific 173690 304 493 5.67E-07 cd05599 STKc_NDR_like cl09925 C
non-specific 214680 158 220 6.05E-07 smart00473 PAN_AP cl00112 -
non-specific 240159 302 445 6.17E-07 cd05120 APH_ChoK_like cl17270 -
superfamily 247824 302 445 6.17E-07 cl17270 APH_ChoK_like superfamily - -
non-specific 133238 402 492 3.88E-06 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 143373 303 494 4.05E-06 cd07868 STKc_CDK8 cl09925 C
non-specific 173716 304 493 7.19E-06 cd05627 STKc_NDR2 cl09925 C
non-specific 132976 294 490 1.12E-05 cd06645 STKc_MAP4K3 cl09925 C
non-specific 133207 348 490 1.75E-05 cd05076 PTK_Tyk2_rpt1 cl09925 NC
non-specific 173689 353 494 2.39E-05 cd05598 STKc_LATS cl09925 C
non-specific 173717 304 493 3.23E-05 cd05628 STKc_NDR1 cl09925 C
non-specific 173713 418 534 3.24E-05 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 132977 302 490 3.77E-05 cd06646 STKc_MAP4K5 cl09925 C
non-specific 88524 418 534 4.35E-05 cd05623 STKc_MRCK_alpha cl09925 NC
non-specific 173712 364 493 6.41E-05 cd05622 STKc_ROCK1 cl09925 NC
non-specific 173701 307 444 7.11E-05 cd05610 STKc_MASTL cl09925 C
non-specific 173700 406 493 9.47E-05 cd05609 STKc_MAST cl09925 NC
non-specific 214801 398 494 0.000300637 smart00750 KIND cl09925 C
non-specific 173688 418 534 0.000432037 cd05597 STKc_DMPK_like cl09925 NC
non-specific 173711 368 493 0.000987868 cd05621 STKc_ROCK2 cl09925 NC
non-specific 173756 323 531 0.00181632 cd08216 PK_STRAD cl09925 C
non-specific 173667 347 550 0.00340638 cd05576 STKc_RPK118_like cl09925 -
non-specific 173718 418 443 0.00876804 cd05629 STKc_NDR_like_fungal cl09925 NC
multi-dom 215690 302 494 3.54E-48 pfam00069 Pkinase - C
multi-dom 214567 302 494 8.90E-44 smart00220 S_TKc - C
multi-dom 197581 300 492 1.78E-43 smart00219 TyrKc - C
multi-dom 214568 300 492 1.19E-42 smart00221 STYKc - C
multi-dom 219530 300 520 8.03E-40 pfam07714 Pkinase_Tyr - -
multi-dom 223589 299 495 2.94E-31 COG0515 SPS1 - C
multi-dom 215061 341 501 3.08E-19 PLN00113 PLN00113 - N
multi-dom 177649 302 494 1.18E-16 PLN00009 PLN00009 - C
multi-dom 234389 336 495 1.29E-16 TIGR03903 TOMM_kin_cyc - C
multi-dom 240233 294 494 3.78E-13 PTZ00024 PTZ00024 - C
multi-dom 215036 295 494 1.57E-12 PLN00034 PLN00034 - C
multi-dom 140289 302 493 1.34E-11 PTZ00263 PTZ00263 - C
multi-dom 177557 348 492 1.62E-10 PHA03209 PHA03209 - NC
multi-dom 173616 289 493 9.66E-09 PTZ00426 PTZ00426 - C
multi-dom 223009 395 489 1.00E-08 PHA03211 PHA03211 - NC
multi-dom 240344 304 500 1.43E-08 PTZ00283 PTZ00283 - C
multi-dom 165476 304 492 2.67E-08 PHA03210 PHA03210 - NC
multi-dom 140293 339 495 2.94E-08 PTZ00267 PTZ00267 - NC
multi-dom 165478 398 507 3.53E-08 PHA03212 PHA03212 - NC
multi-dom 173333 271 493 9.55E-08 PTZ00036 PTZ00036 - C
multi-dom 223069 398 494 1.42E-07 PHA03390 pk1 - NC
multi-dom 183880 303 492 5.01E-07 PRK13184 pknD - C
multi-dom 173502 289 494 4.68E-05 PTZ00266 PTZ00266 - C
multi-dom 165473 398 495 7.99E-05 PHA03207 PHA03207 - NC
multi-dom 140307 389 494 0.000146917 PTZ00284 PTZ00284 - NC
multi-dom 165211 406 489 0.000497811 PHA02882 PHA02882 - NC
multi-dom 226168 351 445 0.00398933 COG3642 COG3642 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific active site L304,G305,E306,G307,G308,V312,A324,K326,V354,Y370,E371,H372,A373,S377,D379,D421,K423,Q425,N426,L428,D439,M442,G459,T460,V461,G462 26 26 173623
specific ATP binding site L304,G305,E306,G307,G308,V312,A324,K326,V354,Y370,E371,H372,A373,S377,D421,K423,Q425,N426,L428,D439 20 20 173623
specific substrate binding site G308,S377,D379,D421,K423,Q425,M442,G459,T460,V461,G462 11 11 173623
specific activation loop (A-loop) A438,D439,F440,G441,M442,A443,K444,G459,T460,V461,G462 11 11 173623
specific putative binding site P169,N171,A187 3 3 238531
 
DNA sequence
Upstream 1000 bp region from PH01002440G0320 gene.
ACTCTACCATAAATTATGCACATCATGTTTGTCTTGACGTAAGGTTGCTTGAACTGCAACACCAATCAAAGCAGTATATAAGTTCAGGGATAGGAAGATCAGATGGTATGCTGCAAGGGAGAAGAGAAAGGAGGGCAATCATGGCAAGGAAGGACAGGGTGCCACGAGGGTACATACCGATCCTCATCGGGCTGGGGGAGGAGAGGGAGAAGATCCTCGTGCGTATGGAGCAGCTCAACCAGCCTAACTTCCTTAAGCTTCTTGATCTGTCGGTGCAGGAATTCGGGTATGAGCAGCAGGGGATCCTCCGTATCCCCTGCACCGCCAAGGTCTTCCGGTCGATCATTGGTGCCACCGGCGAGCAGAAGTCATGACAAATCCTTCTCTCCACTTTTTTCCCTCTTCATCTTTCTCTGCGAATTCGTTAGCTTAGCTCACACAAGGAACAAGATTGTACAGGCAGGTCATGGAAGATTTCTGCAAAATCATGATTACAGTGAGGCTGCTCACTGTTGTTTTTACCCTGCTGCCATTTTACTCTGTGTTTTTCTTCCGCTTCTTGTATCCTATGCGCGGTTCAACTCAGCCCTCGATCAAACCGCGCCGGCGGAGGGGGGGACTGAGGAAGACGGCGATGCGTCGCGTGCTCTACGCGGGGAGATGAGATGAGCCGCATATGTACCGGGCAATTAAGCCGGAAGGCATTGGGCCGCCAATCGCCTCGTCTATTTACGCTGGCGCGGGGATAGTTCGGGTCGGCCTATCAATCGGCAGGAGTAAAGCATGGGCGGAAAGAAGGCATATGGCCACGTGGCCGGCGGGCTGGGAAGCCCAACCAACATCATTTCCTCCATAGTCCAAATAACGCCACCACACTGACAGGCTCAGTTTCAGTACAGAAGCTAATCTTTCCTTCGAATACAAATTAGAAGCAACAATTCAGTTTGCTTATTCAGGGCCCAAATGCTTTCTAGTTTAAGGAACTTACCCACTTCTAAATT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCTCGTCCTGAAGCTATGCAACTCGTCCATAACCTACTGGTCTAGTGGGACATGGAATGGTCAGTACTTCAGTGCCATCCCGGAGCTGTCAGGCAAAGTCCCTTCTTTTCAGCTTGTGTTCGTCGACAATAGCCAAGAGGAGTACCTCCAGTTCAATGTGACCAATGAAGCAGTAGTGACACGCAATATAATCGATATCACTGGTCAGAACAAGCATCAGGTTTGGCTTGATGGCTCGCAGGATTGGATGACACTCTACGCTAATCCAAAGGCTCAATGTGATGTGTATGGAATCTGTGGAACATTTGCAGTCTGCAAGTACGATTTGCTCCCACTCTGCAGTTGCATGAAGGGCTTCTCTGTAAGTTCCCCGAAGGACTGGGAGCAAGGTGATCGGACAGGTGGATGTGTGAGAGACACTCCATTGGATTGTACTAGTAGCAACACAAGTGCAGCTGCTTCAACCGATAGGTTCTACTCCATAACTAGTATTAGCTTGCCTGACAATGGCCAAACCATGCAAGCTTCTGGGAGTTCAGATGAATGCTCAGAGGCTTGCCTGAATAACTGCACTTGCACCGCATATTCCTATGGCAGCCAGGGATGCCTTGTTTGGCATACTGAATTGCTTAATGCAAAACAACCGCAAAGCAATGCCGCTACGGTTTCTAATGGAGACATTCTTTATCTTCGTCTTTCTGCAAGAGAGATGCAGAGTTCGAGAAGCAACAAAAGAAGAGTGATCATTGGGGTCGTCACTGGTGCATGTACTGGTGCTGTCTTCGTCCTTGCATTGATGATGTGGATGAAGAAAAGCAAGAACAGCATCCAAGGTGGTGGTGGTGGGGTTGTGGCTTTTAGATACAAAGATTTGCGTTCTGCAACTAAAAATTTCTCTGAAAAGCTAGGGGAAGGTGGATTTGGTTCTGTCTTCAAGGGGCAATTGCGCGACTCAACCGGTATTGCGGTGAAAAGACTTGATGGTTGCTCGCAAGGAGAGAAGCAATTCAGGGCTGAAGTGAGTTCAATTGGAATCATCCAACATATCAACTTGGTTAAACTAATAGGTCTCTGCTGCGACGGCGACAATAGGTTGCTTGTTTACGAGCACGCGCCAAACCGTTCTCTTGACATCCATCTGTTCCAAAGCAACGGCATGTTCTTGGATTGGAGTACTCGGTACCAAATAGCCCTTGGAGTCGCTAGAGGCTTGACCTACTTACATGAGAGCTGTCGAGACTGCATCATTCACTGCGATATCAAGCCGCAGAATATACTGCTCGACGCATCGTTTCTTCCTAAAATCGCAGATTTTGGGATGGCGAAGTTTGTCGGAAGGGATTTCAGCAGAGTACTAACCACAATGAGAGGAACCGTAGGGTATCTCGCACCCGAATGGATTAGTGGAACAGCCATTACACCGAAAGTGGATGTCTACAGCTATGGCATGGTGCTGCTAGAGCTTGTGTCAGGAAAGAGGAACACAGATGTAGAATATACGACCACCGATGGCAACCATGTCGTCTATTTCCCTATGCAAGCTTGGAGAGAACTTGTTCAGGGAGACGTGAGGAGTCTGCTGGACCAGAAATTGTGTGGTGAAGCCAATTTTAAGGAGGTTGAAAGAGTCTGCAAGGGTTATGCTTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002440G0320 gene.
GGAAAGATTAGATTAGATTGATAGGTTTCTTTATAGATTATTTCTTAGGCGTCAAGTCAGACTGTCCCTATAAAAGAGACAACATGTATCCATTATCAATCAAGCAATGAGAAATCAAAAGTTCAACTAAGTCTCAGAGCCTCGCTACCTCGACAGGGAAGAGTCCTGCCGACGGTTAGATGAGGGCGAGTGCTCTACCCTCGGTCCTTGGACCCGTACCCTAACAACTACCACAACATTTGGTATCAGAGCCAATCATTGCCCCTTCCACCATGTTAGGCAGCGAGGGTTTCGATTCCATGACAATCAGCGACATGCTGGGTCGCATGATTAAGATGTTTGAAAAGATGCTTGGTGTTTCGAAGGAGGAGAGAAGCCACGCTAGGAGCAAGGAATGATCCACCAATCTGTTGGCCTTGACGGCAACCCCGCCGACTGTGACCTTGGCCAAGATGGAGGAGCAAAAGGAGGTGATGCCTGTCGTCGCCAACATGGTTGCGTCGCCACTTTCATCACCTCCAGAACTAGCACCGCCAACAATACCATTCCGACCGTCGTCACCAATACCTCCTCAACGGGCAACGTTGCCCTTAGCTACACCCCTGGTGCGTTTGCCGAGGAGGGTTGCCGCTGTCCAGCGGTGGTATTTTCCGCGTGGCCGGCCGACATCGTGCCCTAGGCGATGCGGAGCGCAACGGCTGAGGGGCCAACGCCACCGTCGTGTCCTCCCCGCCATCATCATGCTCCATGACAGTACGGGCGTCACTGCTTCCCCATGCCGTTTGCCCATGTCGCTAGTGTCTTCCTCGATGCCACATCATGCTAAGGCGTTTCTTTCTTGGGCGCCATATGTCGGAGTGTCGTTGATGTGCTCTCAAGCGAACCGACGCTGGTACCGGATACTCTTGTCAACATGGGGCCACCAAGGACTTCAACTGTGGCCACCACCGCAGCTCGAGGACGAGCTACCTCGCCGCGAGTGGTGTAATGTTATGGAGAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002440 Download
Protein sequence
Protein sequence
MALVLKLCNSSITYWSSGTWNGQYFSAIPELSGKVPSFQLVFVDNSQEEYLQFNVTNEAVVTRNIIDITGQNKHQVWLDGSQDWMTLYANPKAQCDVYGICGTFAVCKYDLLPLCSCMKGFSVSSPKDWEQGDRTGGCVRDTPLDCTSSNTSAAASTDRFYSITSISLPDNGQTMQASGSSDECSEACLNNCTCTAYSYGSQGCLVWHTELLNAKQPQSNAATVSNGDILYLRLSAREMQSSRSNKRRVIIGVVTGACTGAVFVLALMMWMKKSKNSIQGGGGGVVAFRYKDLRSATKNFSEKLGEGGFGSVFKGQLRDSTGIAVKRLDGCSQGEKQFRAEVSSIGIIQHINLVKLIGLCCDGDNRLLVYEHAPNRSLDIHLFQSNGMFLDWSTRYQIALGVARGLTYLHESCRDCIIHCDIKPQNILLDASFLPKIADFGMAKFVGRDFSRVLTTMRGTVGYLAPEWISGTAITPKVDVYSYGMVLLELVSGKRNTDVEYTTTDGNHVVYFPMQAWRELVQGDVRSLLDQKLCGEANFKEVERVCKGYA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above