gene PH01002416G0140
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002416:91460 - 100528(- stand)   Name
Alternate name Locus tag PH01002416G0140
Length of gene 9069  bp Length of CDS 1959  bp
Product information
Feature type
CDS
Product name
citrate synthase
Alternate name
CS, gltA
Molecular weight
(predicted)
73259.6321200002  kDa
Isoeletric point
(predicted)
8.2619514465332
Length
652  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH02SNP00019580 PH01002416:92623 T T->A
PH02SNP00048480 PH01002416:92623 T T->A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127570 1
Please click OG5_127570 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G44350.1
Citrate synthase family protein
encodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA.
ATCS; FUNCTIONS IN: citrate (SI)-synthase activity, zinc ion binding, ATP binding; INVOLVED IN: response to cadmium ion, tricarboxylic acid cycle; LOCATED IN: mitochondrion, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 g
1E-164
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os11g33240.2 citrate synthase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 600 652
Detailed signature matches
    1. PF00285 (Citrate_synt)
    2. PTHR11739 (CITRATE ...)
    1. SSF48256 (Citrate s...)
    1. PS00480 (CITRATE_SY...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR11739:SF0 (SUBF...)
GO term prediction

Biological Process

GO:0006099 tricarboxylic acid cycle
GO:0044262 cellular carbohydrate metabolic process

Molecular Function

GO:0046912 transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Metabolism Carbohydrate metabolism Citrate cycle (TCA cycle)  
Metabolism Carbohydrate metabolism Glyoxylate and dicarboxylate metabolism  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K01647 citrate synthase EC:2.3.3.1
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 99858 380 647 0 cd06105 ScCit1-2_like cl00416 N
superfamily 241852 380 647 0 cl00416 CS_ACL-C_CCL superfamily - N
non-specific 99857 380 644 1.77E-153 cd06103 ScCS-like cl00416 N
non-specific 181961 380 645 1.71E-134 PRK09569 PRK09569 cl00416 N
non-specific 215250 380 651 1.27E-130 PLN02456 PLN02456 cl00416 N
non-specific 99859 380 644 7.60E-125 cd06106 ScCit3_like cl00416 N
non-specific 99871 348 639 1.46E-72 cd06118 citrate_synt_like_1 cl00416 -
non-specific 99855 450 639 4.27E-63 cd06101 citrate_synt cl00416 N
non-specific 99853 444 638 9.42E-62 cd06099 CS_ACL-C_CCL cl00416 -
non-specific 99858 40 155 2.48E-40 cd06105 ScCit1-2_like cl00416 C
superfamily 241852 40 155 2.48E-40 cl00416 CS_ACL-C_CCL superfamily - C
non-specific 215250 7 155 4.51E-30 PLN02456 PLN02456 cl00416 C
non-specific 99857 40 156 6.07E-29 cd06103 ScCS-like cl00416 C
non-specific 99859 40 155 1.56E-28 cd06106 ScCit3_like cl00416 C
non-specific 99865 381 618 1.82E-25 cd06112 citrate_synt_like_1_1 cl00416 -
non-specific 99863 380 624 2.03E-24 cd06110 BSuCS-II_like cl00416 -
non-specific 99867 381 618 1.21E-20 cd06114 EcCS_like cl00416 N
non-specific 130859 380 618 2.11E-20 TIGR01800 cit_synth_II cl00416 -
non-specific 184465 447 618 2.85E-19 PRK14032 PRK14032 cl00416 N
non-specific 233579 446 622 4.52E-19 TIGR01798 cit_synth_I cl00416 N
non-specific 181961 40 157 6.72E-19 PRK09569 PRK09569 cl00416 C
non-specific 99866 415 618 4.01E-18 cd06113 citrate_synt_like_1_2 cl00416 N
non-specific 99869 446 639 5.23E-18 cd06116 CaCS_like cl00416 N
non-specific 180164 451 623 8.88E-18 PRK05614 gltA cl00416 N
non-specific 99860 428 635 1.10E-17 cd06107 EcCS_AthCS-per_like cl00416 N
non-specific 184468 447 618 3.69E-17 PRK14035 PRK14035 cl00416 N
non-specific 99868 446 647 1.62E-15 cd06115 AthCS_per_like cl00416 N
non-specific 99861 388 628 3.78E-15 cd06108 Ec2MCS_like cl00416 N
non-specific 184467 447 618 6.57E-14 PRK14034 PRK14034 cl00416 N
non-specific 184470 444 618 6.78E-14 PRK14037 PRK14037 cl00416 N
non-specific 99864 377 618 3.35E-13 cd06111 DsCS_like cl00416 -
non-specific 99870 382 627 3.48E-13 cd06117 Ec2MCS_like_1 cl00416 -
non-specific 183463 382 628 4.39E-12 PRK12351 PRK12351 cl00416 N
non-specific 237069 382 624 1.18E-09 PRK12349 PRK12349 cl00416 N
non-specific 237070 444 640 4.25E-09 PRK12350 PRK12350 cl00416 N
non-specific 99856 451 618 9.92E-09 cd06102 citrate_synt_like_2 cl00416 N
non-specific 99862 450 639 2.60E-08 cd06109 BsCS-I_like cl00416 N
non-specific 99871 87 157 1.32E-05 cd06118 citrate_synt_like_1 cl00416 C
non-specific 99854 458 619 0.000225208 cd06100 CCL_ACL-C cl00416 N
specific 215889 266 311 0.000422289 pfam00385 Chromo cl17459 -
superfamily 248013 266 311 0.000422289 cl17459 CHROMO superfamily - -
non-specific 235748 477 619 0.0088125 PRK06224 PRK06224 cl00416 N
multi-dom 130853 381 644 3.39E-161 TIGR01793 cit_synth_euk - N
multi-dom 215837 380 636 2.07E-77 pfam00285 Citrate_synt - -
multi-dom 223449 348 639 6.75E-64 COG0372 GltA - -
multi-dom 130853 37 155 3.22E-36 TIGR01793 cit_synth_euk - C
multi-dom 237591 456 618 1.32E-20 PRK14036 PRK14036 - N
multi-dom 237590 376 618 3.53E-14 PRK14033 PRK14033 - N
multi-dom 215837 87 157 6.48E-05 pfam00285 Citrate_synt - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic catalytic triad H488,H534,D589 3 3 99858
generic oxalacetate binding site H452,N456,H488,H534,G535,R543,R615,R635 8 8 99858
generic coenzyme A binding site P486,L487,H488,A491,E494,V528,V529,P530,G531,F532,G533,H534,G535,P584,N587,D589,P632 17 17 99858
generic citrylCoA binding site H452,N456,L487,H488,V528,V529,G531,F532,G533,H534,G535,R543,N587,R615 14 14 99858
generic catalytic triad 3 0 99858
generic oxalacetate binding site 8 0 99858
generic coenzyme A binding site 17 0 99858
generic citrylCoA binding site 14 0 99858
 
DNA sequence
Upstream 1000 bp region from PH01002416G0140 gene.
CACGCTCTACATTTGCCATGTTGAGATTTCTAGTGTGGCAGCTGCCACACTACCATGCGTGGCGTGGTAGGGTGGGTTAATAGTTGTGCCCGAGCCAGCCCACCCCATTCTTTCCTCTCATCACCTCCTCTCTTCTTCATCCTCCATCGCCTCTCTCCTTCCCGCACCCTAGCTCTTCAAATCCATCGATTTTACACCGATTGTATAGCCCATGCAAAATGAGAGACCATTAGGGGTGATGTCTCCCCATATTTCACATTATATATTGCATTTTAAATATCGATAACTTTATCCGTGCATAGAAGCCAAAGGAGCGTTGCTACTTCTTTCAATGGATCGACGACCAGGAGAAGTACGACAGTGCATTTATTCTGCAAAAATACATGTTGAGCTATGCAATTGCGCTCGAGGTATTTACCTGTTGGAGACCTCCCTCTACTGGGAGCGGGGAAGATAAGGGAAATGCACCAATGGTCTCTGATTCCCTTGTTGCACCGAACACTATTCTGAACAAGGACATGTTTGAAAAAGGATCTTATAGCCGAGTACTGGGAGGCCCACGCGAAGGCCCACACCCACAAAGGGAAGTAGGACGTATGTCCACAAACCTGACTTGTTTTCTAGCTGCAAGTGTTTTTTTATTCCAAAAGACATGCATGTATCTCAGTTGTAGTTCGGGCTCATGGTTCATGCATGTTGGCATTTGTACCATAGAATTAGCGAGGCAAACATATGCACATAATCAAACCATGCGCGCCATGTAATTCACAGCTTCATTGTCAAGTGTTATGCCAGTCTTAAAATATTATCTTCGTTGCTGTATTCCCATTCGAACCTAAGCTTATGAAATATTTGTCCAATTGATCCCATAATAATAATAAAAACTAACTAATTCCTATGGTTCTAATTTTCTCTATCTTCTGAAAAAAAAAACTAACTAATTCCTATGGTTCTAATTTTCTGTGTCTTCTGAAGCATATGATTCTGCTTTCAACATATGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGTTCTTCCGGGGCCTTGCTGCGGTCTCCAGGCTGCGATCCCGTGTGACGCAGGAGGCCACCACGCTTGGTGGTGTGAGATGGCTGCAGATGCAGAGCGCTTCCGATCTCGATCTTAGGTCCCAGCTGCAGGAACTGATTCCCGAACAACAGGATCGCTTAAAGAAACTTAAGTCGGAGTATGGAAAGGTCCAGCTTGGAAACATAACTGTGGACATGGTCCTTGGTGGGATGAGAGGGATGGTTGGAATGCTTTGGGAAACATCGTTACTTGACGCGGAAGAGGGTATTCGCTTTAGGGGTCTCTCTATTCCAGAGTGCCAGAAAGTACTACCAGCAGCAGTTAAAGATGGAGAACCTTTGCCTGAGGGCCTCCTTTGGCTTCTTTTGACCGGAAAGGTTCCAACCAAGGAGCAAGTTGATGCTTTATCAAAGGAATTGCTTAGCCGTTCGAATGTTCCAGCTCAGGATTACATGAAGCAACATTATGATAAACATCACTGTGATATCAACTTTGAGGTGGGGGAATGGGCCTCGCTTCGCCTTTATCACTGCACAACAGTTTCCATCACAGACCAACAACGTTCTAAATTGGCTCTCCGTTTTTACGGCCCCTTCTTGGTTGAAGAACGAATTGGCACAGTTGCTTACCGTCTTCAACTCCCTCCCAAAGCTCTTATACACAATATTTTCCATGTTGCTTTACTCAAAAAGTATCTCGGGCCAATTCCACCAGTTCTTGGCCGACTTCCGGACATTGTGCATGGTCGTGTGGTACCTTCGGCGTTATCTATTGTCCGAGCTCGTCTGAACCGTGGTACTTGGGAACTACTCGTTCAATTGTTGGGGTGTTCTTTTGCCGATGCGACATGGGAACGTTTGGATGATTTTCAACAACGGTATCCCTTATTCCAGCTCGAGGATGAGCTATTTCGCGGAGATGGAGGTAATGTTGTGGATGCCTTTGTGGGGAAGACGTATCAAAGACGGCGACGGACTGCAGCGGCAACGACTTTGGCCGAGAAAAATTTCCCGGCCGGGATACTGTACTATAGAATTGAATTATCTACAAATATAAGCTCCATTTCCTACTTTCACTTTGCTCTCAAGCAGCTGATATTTGATTTGGATGCAGATCATGTCTATAAGGCAATAGATGCTCTCCCTGTAACTGCTCATCCAATGACACAGTTTACCACTGGAGTGATGGCACTTCAGGTTGATAGCGAATTTCAAAAAGCTTATGACAAAGGGATGCCAAAATCAAAGTTCTGGGAGCCTACTTATGAAGATTGCTTAAATTTGATCGCTCGGCTTCCACCAGTGGCTTCATATGTTTACCAGAGTGACCACGAAGGTGGGAATGTCAGTGCTCACACTGGCCATCTGGTTGGAAGTGCCCTGTCAGATCCTTACCTTTCTTTTGCAGCTGCACTGAATGGTTTAGCTGGGCCTCTGCACGGCCTGGCTAATCAGGAAGTGTTGCTATGGATCAAATCTGTAATGGACGAGACTGGGAGTAACATTAGTACTGATCAACTCAAAGATTATGTATGGAAGACACTAAAGAGTGGAAAGGTTGTTCCTGGCTTTGGTCATGGAGTTCTACGTAAGACGGATCCACGATACACATGTCAAAGGGAGTTTGCCTTGAAGTATTTACCTGAGGACCCACTTTTCCAACTGGTCTCCAAGTTATATGAAGTTGTGCCTCCGATCCTCACCGAGTTAGGCAAGGTAAAAAATCCATGGCCCAATGTTGATGCTCACAGTGGAGTCTTACTGAACTACTTTGGATTATCTGAAGCAAGGTATTTCACTGTCTTGTTCGGTGTTTCAAGGAGCATAGGAATAGGATCTCAGCTCATTTGGGACCGTGCCCTTGGCCTTCCTCTGGAAAGACCAAAGAGTGTCACCATGGAGTGGCTGGAAAACCATTGCAGAAAGGCTGTTTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002416G0140 gene.
GTTTCATTTTCCATTCCACACGCTAACAAATATATATTTTTAGGGATTGACTAGTCATCATGCGAATGAGTTTAGCGTTAAAATTAGTCAGATTTTTTAGCCGTTAGATAGAGATCCAAAGGTCATCTTCTCTCCTCAACTTCCTTATTAAATCATAGCCCTCTCCAGCCTCCTCCCGTCTCCCTCCCACCCCGTCGCCACCAGACGCAGAGGCGCACCGCCGCCCCGCATTGCCACCCCCACCACCTTGCCGCTTCCGCTGCCGGCCTCCTCCTCTCCTGCCTCCCGTGCTGTCACCTTCTTCCCCGTATCCAGCGGCTACCACCGTCGGATCCGCCATCGCCACCCCCGCCTCCTAATTTCTTCCGCCGCCGGCCTCCTCCTCGCCTCTCTCCTCTGCAGCCGCCTTCTGCCCCGTCTCCGGAGGCTACCGCCACCGGATCCGCCATCGCGACCCCCCGCCTCCTAACTTCTAGTTGATTCTCGTGCTCCCCCGCCACCCTCCACCACTCACCACCCTCCTCCGACCCGTGGCCAGCTGCGCCACCGCCTCCTCGCCGCCCCTCCGCCACTGCCGCCCACCGCCTCGCGTCCGCCGCACCTCCCTCCCTCTATAGCCAGGCCCCGGTGAACCCAAAACCTAATCCGGCGAAGCTTCGACCTAACTCGCCGCTGCCGCCGCCGAAGAAGACAACCATGCCGCCGGCCGGAGCACGAATCATGACGCGGATCTAAAGGTTAGAAATTTAACTGATTTCCTGTAAATTTTCATTCGACTGATGTATAGCAGATTCGATATTTTCAACTCATCCATGCCCATATTACGACTTTACGAATTACGAGTATATAGGGATTTCTATACTTGTATAGAGGTGACCGGTGAGTGGATAAAATTGGGTCAAATACATATTGCCTCCAAAAAGAATTGGGCCGACCTTTGACAAAAGGAAGACAAATTAGATACGAATTATGACCAATAATATGGGGTTGTTAGCGCCTCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002416 Download
Protein sequence
Protein sequence
MAFFRGLAAVSRLRSRVTQEATTLGGVRWLQMQSASDLDLRSQLQELIPEQQDRLKKLKSEYGKVQLGNITVDMVLGGMRGMVGMLWETSLLDAEEGIRFRGLSIPECQKVLPAAVKDGEPLPEGLLWLLLTGKVPTKEQVDALSKELLSRSNVPAQDYMKQHYDKHHCDINFEVGEWASLRLYHCTTVSITDQQRSKLALRFYGPFLVEERIGTVAYRLQLPPKALIHNIFHVALLKKYLGPIPPVLGRLPDIVHGRVVPSALSIVRARLNRGTWELLVQLLGCSFADATWERLDDFQQRYPLFQLEDELFRGDGGNVVDAFVGKTYQRRRRTAAATTLAEKNFPAGILYYRIELSTNISSISYFHFALKQLIFDLDADHVYKAIDALPVTAHPMTQFTTGVMALQVDSEFQKAYDKGMPKSKFWEPTYEDCLNLIARLPPVASYVYQSDHEGGNVSAHTGHLVGSALSDPYLSFAAALNGLAGPLHGLANQEVLLWIKSVMDETGSNISTDQLKDYVWKTLKSGKVVPGFGHGVLRKTDPRYTCQREFALKYLPEDPLFQLVSKLYEVVPPILTELGKVKNPWPNVDAHSGVLLNYFGLSEARYFTVLFGVSRSIGIGSQLIWDRALGLPLERPKSVTMEWLENHCRKAV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above