gene PH01002344G0400
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002344:227171 - 230076(- stand)   Name
Alternate name Locus tag PH01002344G0400
Length of gene 2906  bp Length of CDS 279  bp
Product information
Feature type
CDS
Product name
MYB family transcription factor
Alternate name
Molecular weight
(predicted)
10746.5291199999  kDa
Isoeletric point
(predicted)
9.24894332885742
Length
92  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_177274 1
Please click OG5_177274 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT4G01060.1
CAPRICE-like MYB3
Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowe
CAPRICE-like MYB3 (CPL3); CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-related (InterPro:IPR012287), MYB-like (InterPro:IPR017877), Myb transc
1E-21
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g43180.1 MYB family transcription factor, putative, expressed 2E-30
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 10 20 30 40 50 60 70 80 92
Detailed signature matches
    1. SSF46689 (Homeodoma...)
    1. PF00249 (Myb_DNA-bi...)
    2. SM00717 (SANT)
    1. PS51294 (HTH_MYB)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR10641 (MYB-LIKE...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003677 DNA binding
GO:0003682 chromatin binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238096 47 85 1.59E-07 cd00167 SANT cl17250 -
superfamily 247804 47 85 1.59E-07 cl17250 SANT superfamily - -
non-specific 197842 47 85 3.02E-07 smart00717 SANT cl17250 -
non-specific 215818 47 85 3.04E-07 pfam00249 Myb_DNA-binding cl17250 -
multi-dom 178751 48 92 2.09E-15 PLN03212 PLN03212 - NC
multi-dom 215570 47 85 6.98E-09 PLN03091 PLN03091 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific DNA binding site F47,R76,T77,E79,E80,E82,M83,F84 11 8 238096
 
DNA sequence
Upstream 1000 bp region from PH01002344G0400 gene.
TGCAATTTTTTATTTTGTGGGCCATTCGCGACTTGATAGTCACTACGATCATTTAACCTGTGATTAATTCTATTACATAAAAAGAGTAATAGATAGTCCTGGAATAAACAATTTTGTAATTTTGTTTATTCAGTTTGTTCTTCCTTTTACATCAGGCTTTTCTACCTAACCCATGCTTGGTACAAAACAAGTTATTTTTAGCATGGTTCAGAAAATAGGAGTTAAATCAGCACAAGTTTCTTAGGGACATGAAAACGCAGATTGTACATCAACGTAGTTTTATTGCATGCAATTTTTTTTTTCATTTTCTCTGGTGTTTTTATCTCTATTTCTTCTGCTGTCCTTCCGGGCATTCTTCCAGCTATAAGTTCCCACCTACATAATTCCATCATAAGAGCAACCCAATCAGGGAACTGCAAATACTGTTATTTGCCTGAACTGATAGACTTATGGATTTCGTGAGTTTGTAAAATGTTTTTCTCCATTTTCACTCGATACCAAGGTAGTTAGGATCGCGATCCTACTCTTAGAGTCTTACGATTCTACGAACNNNNNNNNNNATTTCGTAGTACCAAATCCACTTCATTCCTTACGTAAGTTTGATGATGTTATTTGGGTTTGTCATTGATATGCTTGAATATGTAATTTGACAGTGGAGCGTCACACCTGTATGACAACACATGATGTGCATTTTTATGTAGCACATTTACATTTTGTACACCAAACATATAGTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATTTAACCTGTGGTTAATTCTAATACATAAAAAGAGTAATAAATAGTCCTGGAATAAACAATTTCGTAATTTTGTTTATTCAGTTTGTTCTTCCTTTTACATCAGGCTTTTCTACCTAACCCATGCTTGGTACAAAACAAGTTATTTTTAGCATGGTTCAGAAAATAGGAGTTAAATCAGCACAAGTTTCTTAGGGACATGAAAACGCAGATTGTACATCAACGTAGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCATGAAACAAAAGAAGTTAATAGCACCGCACAGCATTTTGTTGATTTCACAGAAGACGAGGAAGATCTTGTTTTCAGAATGCACAGGCTTGTCGGGAACAGAAGTTAATAGCACCGCACAGCATTTTGTTGATTTCACAGAAGACGAGGAAGATCTTGTTTACAGAATGCACAGGCTTGTCGGGAACAGGTGGGAACTTATAGCTGGAAGAATGCCCGGAAGGACAGCAGAAGAAATAGAGATGTTTTGGGCAAAAAAACACCAGAGAAAATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002344G0400 gene.
GCCCAGGATAAAATATGAGCAAATCTCTGGTTTTTAAAGAGATGGAGTTGGTTGTCACCTTTCTGCTCTAGCTGTACTGACTGGGCCTGATGCCATAGGCCATTGACTTTTCCCTCTCTCAAATCATCTGGCAGAGAAGATCATACCATGTCAGGTGTAGAGAAGTTCATGGTTGTGAGAAAGTAAGAAAGCAACTCACTCAGTTGAGCTCCTTCATTTTCTATGAAGTAAGTGACACGGTGCTCAAGCGTTTATACAGCAAAAGACAAAACCTTGTTTTCTTTTGTTCCCCCTGGTCTTCCATTTGTTCTCCCATTTCTGTGGATTGGAGTTTTATCTCATGTTTTTGCTCCTGCTCTGCAGACCCAAAGTTCTTTCTAGCTATCAGTTTTCTTTTGTTTTCTTTACGCTGTCTATCGGAAATAGTAATTTTTCTATATAACCTGGTTTTCTAGACTGCTATCATGACCACTGTACCAAGTTTCACCGTATTCTTTTCCAAATTCCGCTGGTTCCTATTCTTCTGATTTGGTCCATAGTAAGAAAAGAAATAAAAAAATGTTTTGAATGTAACTTTAAAGGCGCAAAAATTATTTCTACAAAAATATTAATTATATCCTAGGTAGACCGATGCGGCCAGGAGCGCGGAACCGGCGGTGTCAAGGACCACGCGATGGACACGACATCGCAGGTCGGCAAGGAGGCACGCCATTCTACCCGTTGGCAGTAGGTGGTGGGCCCCGGCGGCAGGCTCGAAATCTACTACAACGACAAGGGTGTGCTTTTCGTCATCACCTGGGCCGACTTCACCGCCGATGTATTGTTCAGAGATTTCGAGCCCTCGCCGGAGGCGCACGGCTTGCACCCAGAAGCGTGGTGGGCCAGCACGGGTGAGTGGGCACGACAAGCGGCGGGTAGTTGTCGATGTGCTTTGAAATCCCATGAAACTCGTTTTGGATATTTGAAACTTGCCTGAAATTTAGATGAGACTTCCTGGAAAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002344 Download
Protein sequence
Protein sequence
MAMKQKKLIAPHSILLISQKTRKILFSECTGLSGTEVNSTAQHFVDFTEDEEDLVYRMHRLVGNRWELIAGRMPGRTAEEIEMFWAKKHQRK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above