gene PH01002325G0040
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002325:13620 - 18183(- stand)   Name
Alternate name Locus tag PH01002325G0040
Length of gene 4564  bp Length of CDS 1347  bp
Product information
Feature type
CDS
Product name
scarecrow transcription factor family protein
Alternate name
Molecular weight
(predicted)
47903.9724200001  kDa
Isoeletric point
(predicted)
6.89428329467773
Length
448  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH02SNP00019390 PH01002325:14242 G G->A
PH02SNP00047560 PH01002325:14242 G G->A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_153334 10
Please click OG5_153334 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g44360.1 scarecrow transcription factor family protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 350 400 448
Detailed signature matches
    1. PF03514 (GRAS)
    2. PS50985 (GRAS)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31523 (FAMILY N...)
  2. PTHR31523:SF0 (SUBF...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 217595 107 447 9.54E-97 pfam03514 GRAS cl15987 -
superfamily 217595 107 447 9.54E-97 cl15987 GRAS superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002325G0040 gene.
ACGTCATAGGTTTGCAAGGCCAATTGGCCATGTAAATAAACACCTCTCTTGAAATGCCATACAGGCTAAAATCAATAGTGACAAACGAAACATTGTTTTCTTCACCAGCTTACCAGTGAGTATATATACCACATCACAGGACAGACCCCCAAAAGTTACAATAGGCATATGTAGTTTTGTACTCATCATGTTCTACTGGCATTAAGTCTATTGTTGACAATATAACAGAATGGCCTGCGAAGTGCGAAGTGCGAATTGCTCATGTTGCTTGCCCTGTGTGTTAGGCACATCAGCAAATCAAGCACCACTATCCATTCCTGGAGATACTTCATATTCTGTCTTATTTCTTGTTGAAAGAAACATCCTTGGCATTCATGTGTAACTTCCTTGGAACCATATCAGACGGTGAGAATTAGTCAAGAGTTGACATTAAGGTTTTCCTCTAGCTATAAACAAACTAACTTTCAAAACAAGCTCGGTACGAAGACATGATGGTCAGATAATCCATTGCTAGCCAAAATCTGACATCTGTAGTTCCTCTGCATTTTATAGTCTAAATGGCAAGATTGTATATTTGCTAGGTACAATTCACACAAAAAAAAAGTACTGTGCGAATTATCAAAAGGACATTAATCTAATCCCCAGTTCCTTCCTGAACCTTAATTTCGTTCAATTGTTCCTAATACATCCGGGTAAAGGCACTCTTTGGCAAAATCTGCACCCTAAGCTTTTGAAATCATTGGTCAGGCTAAGTCTTATTTTCATATATTGTAGTCCTATGATAGCCATTACTCACTTTTTTCTTTAAGATGATGAAAGGCGTCAACATTGCAAAAATAAAATGCATGCATAGCTAAAATCATCCATTACAGTTCAATGCATAACAACAGAAATGCACTCCAAGCATGACAGCATGGCTAGATAACCTTTGATAATCCTTGTCTTGTTGTGTTGTGTATTGTTTTGTTTTTTGTCTTGTTTCTTTTGTTTTTGTACATACT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGTCGTTGGTGCAACTGAAGGAGAGGAGGGGAGCGATGGGGTCGGCGTATGCGAAGGGGACAAAGCGGGTGGCAGGGGCGGCGCAGGCGAAAGGGAGGAGGGGCGCGACGGAGTTCGGTTGCGAGGATGACGCATCCGAAGGGGTGGAGGAGGGGGCGGAGTGGGTGAAGGGGAGGAGGCCTCTAGGGGCGATAGCAGTAGAGAGAAGAAGCCACACCCACACACACCAAGGAGAGACCGTAGGGGCGGTGCAGCAGCAGCTGCTGGGCGAGCTGGCTGCGGCGGCAAAGGCGGCCGAGGCCGGCAATTCCATCGACGCGCGAGAGATATTGGCGCGGCTCAATCACCAGCTTCCCCCACTCGGGAAGCCTTTCCTCCGCTCCGCCTCCTACTTCAAGGAGGCCCTCCTCCTCGCGCTCGCCGACGGCAACCACGGCGCCTCCCGCCTCACCTCACCGCTCGACGTCGCACTCAAGCTCGCGGCCTACAAGTCTTTCTCTGACCTGTCCCCCGTGACGCAGTTCGCTAACTTCACGGCCACGCAGGCGCTTCTTGACGAAATTGCCGGCAGCCCAGCTGCCTGCATCCATGTCGTTGACTTCGATCTCAGCGTCGGCGGCCAGTGGGCTTCCTTCTTGCAGGAACTCGCGCAACGCCGTGGCTCTGGCGGTGTGGCTCTGCCGTTGTTGAAGCTCACGGCCTTTGTATCGTCTGCTTCCCACCATCCACTGGAGTTGCATCTTACTCAGGATATCCTCTCGCAGTTTGCTGCCGACCTTGGAATTCCTTTTGAGTTCAATGTCGTCAGTCTCGATGCTTGCAGTCTTGCGGATCTAATTTCCCCCGCTGGCAATGAAGTTGTAGCTGTTAGCCTCCCTGTTGGTTGCTCTGCTCGCGCACCACCACTGCATGTGATCCTTCGGTTGGTGAAACAGCTTAGCCCTAAGATTGTGGTGGCTATGGACCATGGAGGTGATCGTGCTGACCTCCCATTCTCGCAGCACTTCCTGAGTTGCTTCCAGTCTTGTGTGTTCCTCCTTGACTCGCTTGATGCCGCTGGTATTGATGCTGATTCTGCCTGCAAGATTGAGAGGTTTGTGATTCAGCCAAGAGTGGAAGATGCGGTGCTTGGGTGGCGCAAGGCTGACAAGGCAATGGCATGGAGGAATGTGTTTGCAGCTACCGGCTTCACCCCTGTGCCACTCAGCAACCTTGCGGAGGCACAGGCCGATTGCCTCCTGAAGCGGGTGCAAGTCCGAGGGTTCCATGTGGAGAAACGTGGGGGTGGGCTCATGCTCTATTGGCAGCGCAGCGAGCTTGTCTCCATATCAGCATGGCGGTGCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002325G0040 gene.
GTTACCAATTTGATATGAGGTTCGTCCTTTCTTATAGCCAATTGGAAATCGAGTACCCAAAAAAAAAACAGCTTAATTCATATGTAGTAACTGATTTCTGTGTTGTGGGAATTAAACACTACAAAACATTTAAAGAGTTCTCATTCCAGCAAAAGGAAGAGTAGCATGTAAGTGTTGTCTAGAGCTTTCTCTTTTTTAGTAAAATAACGAACTGCTTATGTTGGTTTTCCCCTATTTTGTGCACACCTGCTGCTTGCCTGTAAATGGTAGACACCGAATATTGTCTTTCCCATGATACCTATTTTTTATTTTGGCCTTCCTCGTAATTTGCTTGAATCCATGCAATACGTGTGCATGCAGTAATCAAACACATTATTGAACTTTTGTCTTTTGTCACTCACATGTTTCTAGACGAGCTTATTGATATCAAATTGCGCCAATTGTTCATAACTTTTTCTTATCAGATCATCTGATCATGTATATTGTCTTGTGGCAGTAGGGTACTACTCTCTTCCAAAGGATTAATAATAGGAATTGTTGTTCAGTGATTCATTAGCTCAACTAAGTAACTAATAGCTTTATATCCATGCAGTTGTTAGTGTTTAAATCACAGGTGGGCATATTTGGTGTGGATGTCAGTGGTGACAGGGAGCCACAATAATGTGACAGTTAATCTTAGGTCACATCATGAATTTCCAGCATGTTATGCAATATACCATGATGCCTGCCCCCTTATAAAATTTCCCTGATAGAGTGGTTGTCAAGTCAGATTCAAATGTCCTGTGCTTATAAGATTGACATAAGATAGTAGTGTTAGTCCTATTAAGAAGGCATTTTTTCTAGCTCTCCTCAACCAAAAGCTAGGATTACTCAAGAGTCGGGACCTAAGTAAGATGATTGTCTGTTAGCTCTGCACGTCATTGTTCCTGTAAATTTGTTATTCTGCGCCCGCTGTTGGAGCTTATTAAGCTTGTTCAGTAGTTTTAAAGCGCACAATCAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002325 Download
Protein sequence
Protein sequence
MSLVQLKERRGAMGSAYAKGTKRVAGAAQAKGRRGATEFGCEDDASEGVEEGAEWVKGRRPLGAIAVERRSHTHTHQGETVGAVQQQLLGELAAAAKAAEAGNSIDAREILARLNHQLPPLGKPFLRSASYFKEALLLALADGNHGASRLTSPLDVALKLAAYKSFSDLSPVTQFANFTATQALLDEIAGSPAACIHVVDFDLSVGGQWASFLQELAQRRGSGGVALPLLKLTAFVSSASHHPLELHLTQDILSQFAADLGIPFEFNVVSLDACSLADLISPAGNEVVAVSLPVGCSARAPPLHVILRLVKQLSPKIVVAMDHGGDRADLPFSQHFLSCFQSCVFLLDSLDAAGIDADSACKIERFVIQPRVEDAVLGWRKADKAMAWRNVFAATGFTPVPLSNLAEAQADCLLKRVQVRGFHVEKRGGGLMLYWQRSELVSISAWRC
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above