gene PH01002297G0180
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002297:130278 - 132651(+ stand)   Name
Alternate name Locus tag PH01002297G0180
Length of gene 2374  bp Length of CDS 1536  bp
Product information
Feature type
CDS
Product name
pentatricopeptide
Alternate name
Molecular weight
(predicted)
57612.4888200002  kDa
Isoeletric point
(predicted)
8.72193527221679
Length
511  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_189806 1
Please click OG5_189806 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G31430.1
Pentatricopeptide repeat (PPR-like) superfamily protein
Pentatricopeptide repeat (PPR-like) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: SLOW GROWTH 1 (TAIR:AT2G22410.1); Has 41733 Blast hits to 13930 proteins in 242
5E-151
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os06g39650.1 pentatricopeptide, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 50 100 150 200 250 300 350 400 450 511
Detailed signature matches
    1. PF13812 (PPR_3)
    2. PF13041 (PPR_2)
    3. PF01535 (PPR)
    4. PS51375 (PPR)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24015 (FAMILY N...)
  2. SSF48452 (TPR-like)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213555 238 271 3.23E-05 TIGR00756 PPR cl03252 -
superfamily 214131 238 271 3.23E-05 cl03252 PPR superfamily - -
specific 213555 107 140 0.000151012 TIGR00756 PPR cl03252 -
superfamily 214131 107 140 0.000151012 cl03252 PPR superfamily - -
non-specific 205985 106 139 0.000266003 pfam13812 PPR_3 cl03252 -
non-specific 144943 238 268 0.000729213 pfam01535 PPR cl03252 -
non-specific 144943 179 206 0.0016414 pfam01535 PPR cl03252 -
superfamily 214131 179 206 0.0016414 cl03252 PPR superfamily - -
non-specific 144943 107 137 0.00259793 pfam01535 PPR cl03252 -
non-specific 238112 181 261 0.00754803 cd00189 TPR cl02429 -
superfamily 243034 181 261 0.00754803 cl02429 TPR superfamily - -
multi-dom 205222 235 282 1.27E-07 pfam13041 PPR_2 - -
multi-dom 205222 336 384 4.31E-07 pfam13041 PPR_2 - -
multi-dom 215561 8 501 4.06E-89 PLN03077 PLN03077 - N
multi-dom 215563 18 503 2.58E-75 PLN03081 PLN03081 - C
multi-dom 215561 9 471 8.49E-59 PLN03077 PLN03077 - C
multi-dom 215561 58 439 5.16E-41 PLN03077 PLN03077 - C
multi-dom 215561 120 441 3.37E-31 PLN03077 PLN03077 - C
multi-dom 215563 8 355 8.37E-31 PLN03081 PLN03081 - NC
multi-dom 215636 64 417 3.99E-14 PLN03218 PLN03218 - NC
multi-dom 215636 149 507 4.81E-14 PLN03218 PLN03218 - NC
multi-dom 215561 241 501 1.90E-12 PLN03077 PLN03077 - C
multi-dom 215636 118 503 2.08E-10 PLN03218 PLN03218 - NC
multi-dom 205222 179 217 4.36E-06 pfam13041 PPR_2 - -
multi-dom 205222 107 143 1.37E-05 pfam13041 PPR_2 - C
multi-dom 205222 310 348 0.00337182 pfam13041 PPR_2 - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002297G0180 gene.
TCCGATGAGGAATTCTGTGTATATGAGGAAGCATACAAGAAGTTCAACTCATCTTGTTGTGCATACATTATGTCAAGCTAGTAACCTGTCCCATATAAACATCTCCTGTGTAATGCCCCAAATGTTTGAGTTGCCATTTGATTTGTCTGATATTGGATAAGAACTCGTGAACCAAGAATAGTTGTTGACGGAATTATCTTCTCTACCACTCCATAGGAAGAAAAAACCTTGTGGATCTCCTCCATGGTTATAGGCTGTAGCAGGTGATGAATAGTAATAGAAAGCACTCGCATGTTTAAACTTGGACTTTTGTTGAGAACTTGGTGAGCATATCCTCCGACACTTCCTTGGCTTCACTCGGGATGATGCCCAATGGAATTCCTACTCTAATACAAATTATATGAGCTTTGTGTTACTGTTGACGGGTTGTTGTGGCTTCCCTGGGCATACCCATACCCATACCCATAGCCAGAGTATGGCATTTCTTCAAACACTTGGTGACCATAATAACTGGCTGCTCCTTGACACCACCCTTGTTACTGCCCATAAGAAATCTTGTTCACAAATGAAGAGTAGGGTTCTTGCGTTGTTGTTGAGGAAAAGCTCCGTGTGTTTCCATACCCATAGCCCGGGCATCGCATTTCGTCCAACACCTTGTGGGTGTAACTCCCGCAGGTGTTTGCCTTGTGCAGCCCCCATGGCAGTCTACCAGCGCCACTGTCTCCTGCTGCCAAGGAAACCGTGGTGGTGAAGCTATTGTATCCCTCTGTCGAGAATGTCGCTCGAGAATACATCGTTGCTTCGGTCCTCAGATGAAACTCCACCACCGACTTCAAGCCAAATCGATAGAGGGATTTTATAAGTGAACTAGTCACCAACCCTAACGATTCAGCAAGAATCACTTCACCAAGGATTGAACTGGTGCTCTGATACTTTTGTCAAGACCCAATCGAATTCGAGTGGAATCCGACTAAAATCGCATATAGATTTGATGGATTTGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGACGGCGTGCCACCACGGCATGCCGCTGCGCGACTGCAACCTGTTGATCAGGACCCTCGCAAGGCGCGGCAGCTTCGCGCGCGTCATGGAGGTGTACTACGACCTCCGCGCCCGCGGCCTCATCGCCGACAGCTTCACCTACCCGTTCGTGCTCAAGCTGTCAGTCGAGGGCCGCAAGGCGCACAGGGCGGCCGTGAAGACCGGGTTCCGGTGGGACACGTACACCGCGAGCTCGATGATGGCGATGTACACGATGCTGGGCCGTGCGGATGTCGCGCGGAAGTTGTTCGACGAAATGCCGCACAGGGCGCTGGTGCTGTGGAATATGATGATCAGGTGCTACGTCAGGTGCGGGCGATACGCATCAGCAGTTGCTTTGGCTGAGGAGATGGAGAGAAGCGGTCTCACACCCGATAGGGTGACGTTGGTTAGCGCGGTGACCGCGTGCTCCAGAGCAGGGGACCTGAGCTTGGGAAGGAGGATTCATGACTACATGGATGGGGTCTTCGGGTTCAGCCTGCCACTTGCAAATGCGCTGCTGGACATGTACATGAAGAATGGTTGCTTGGAAGAGGCGGTGAAATTGTTTAAGCAAATGCCGGTGAGAAACATCATTTCTTGGACTATACTTGTGTCGGGATATGCCCTTGCTGGGCAGCTGGACAAGGCGAGAGTACACTTCTACCAGTGCACAGAGAAGGATCTAATTCTGTGGACTGCAATGATCAATGCATGTGTGCAACATGGATGCTTCGAGGAGGCTCTGTCATTGTATCGATACATGCAGATGCAACGGATTGAGCCAGACAGGTTCACTGTTGTCACTCTCCTGACATGCTGTAATCTTGGTGCTCTTGATCAAGGTGAATGGATCCACCAGTATGCTGAAGGTAGGAAAATGAAGATTGATGCAGTTCTTGGCACAGCGTTGATTGACATGTACGCAAAGTGTGGGCATGTGGAGAAGTCACTGGAGGTCTTTGAACGAATGCAAGGCATAGACACCGTGGCCTGGACTGCCATCATCTGCGGTCTGGCCACAAATGGTCAGGCAGGTAGAGCTCTCCAATTGTTTGAGGATATGCAGAGAAGCAAAGGTAAGACTGACAACATTACGTTCATCAGGGTGCTGACTGCATGTTGCCATGGTGGCTTGGTTGATGAAGGGCGGAAGCAGTTCCGAACAATGAAGGAGGTTTATCGGATAGAACTGACAGTCGAACATTATAGCTGCCTTGTCAATCTTCTAGGTCGCGCCGGTCTACTTGATGAAGCTGAGAAGTTTATCAGTGAGATGCCAATTGACAAGGACACTATGCCACTGTTTGGTGCACTCCTCACTGCTTGCAAGGCTCATGGCAATGTTGAGATGAGCGAACGATTGACCAAACAAATTGGCGAGCAAGATTACCAAATTCCTGGCGTGAATTTGCTCATGTCTAATGTATATGCAACAGCAAATCGATGGGAGGATGCGATAAGAGTAAGGAGCAAGATGACACGCCCCACTGTCAAGAAGGCTGCGGGGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002297G0180 gene.
ATAAATTCTTCTTCTTACTCGCATGGGAAGCGCGAAGCAACCACTAAAAAGCATCAACAGAGCACAATGTGAGGTCACATAAAACCACCAAAGCAGTACAGAAACATTTCATCAAACACATGGAGTGTGATCAGCATCACCTCACCAGATCATGATGGAGCCGGTCAGGCACTGCAGGATGGTGAGGTGAGGCGTAGGGTGTCCACATCGAGTCTCCCCCATGTGTGAACTCCCGGAGGAGCAGCAGCGCAACGTGACCTATGGCTGGAGGTCCACACCACCACAGGTGCAGCCGATGTAAGAGGATGCGACGACACCTATCCAGAGCTTCTCGAACCCCTTGGCGACGGCCTCCCCGCAGGACAGGCTCCGCGTCACAGATAGGCTCTGTGTTGCAAAGAGGCTGAGGGCCTCTAGCACGGTGCTCGACGCTGCCCCACATCCACACCGTGGGAGGAGAGCCAGATTTGGAAGTCCTATAGCGAGGATTTCAAGGGCGCAGACTCTATGGCGGCACGATGAGAGAGGGGAATCGACGCACTTCAAGATAGGTGAGTGGTGTAGGGGAGATCATGAGACGGGGACCATGACTCCACGCGGCTCACCAGTGTCATCGCCATTGGTGTGGGGGAGAGGAGAAGCCGCCATGCGTGCTGGTGTCAGAGGCCATGAGCGTATTGCAGAACATGTGCGGCATCTACACGAAGAGCTTCTTGACAGTCTCCCCATCCTCGGTGTCACTACTGCTCCCGTAGTCCGTCCCTTCACGCAGCCGCCTCACCACTTCGCACGAAGGAGGATGGACGACCACCAACTCGTATTTTTAAGTAGTAGAGAAAATAATCACTTCATTGTACAACTTTGTTGTTTAGAACAAAAATGAAGTTGAAATCTGAAACCGCTTGATACTGAGGATGGATGGCAGTTTGTCACTAATACATCATCTAATGCTTCAACATCGGAATGATTAAAACAACCATTGGCTTGAGTGAATCGCATTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002297 Download
Protein sequence
Protein sequence
MATACHHGMPLRDCNLLIRTLARRGSFARVMEVYYDLRARGLIADSFTYPFVLKLSVEGRKAHRAAVKTGFRWDTYTASSMMAMYTMLGRADVARKLFDEMPHRALVLWNMMIRCYVRCGRYASAVALAEEMERSGLTPDRVTLVSAVTACSRAGDLSLGRRIHDYMDGVFGFSLPLANALLDMYMKNGCLEEAVKLFKQMPVRNIISWTILVSGYALAGQLDKARVHFYQCTEKDLILWTAMINACVQHGCFEEALSLYRYMQMQRIEPDRFTVVTLLTCCNLGALDQGEWIHQYAEGRKMKIDAVLGTALIDMYAKCGHVEKSLEVFERMQGIDTVAWTAIICGLATNGQAGRALQLFEDMQRSKGKTDNITFIRVLTACCHGGLVDEGRKQFRTMKEVYRIELTVEHYSCLVNLLGRAGLLDEAEKFISEMPIDKDTMPLFGALLTACKAHGNVEMSERLTKQIGEQDYQIPGVNLLMSNVYATANRWEDAIRVRSKMTRPTVKKAAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above