gene PH01002197G0180
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002197:136072 - 138850(+ stand)   Name
Alternate name Locus tag PH01002197G0180
Length of gene 2779  bp Length of CDS 1797  bp
Product information
Feature type
CDS
Product name
vegetative storage protein
Alternate name
Molecular weight
(predicted)
64586.2188200003  kDa
Isoeletric point
(predicted)
6.20951461791992
Length
598  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_242721 1
Please click OG5_242721 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g26940.1 vegetative storage protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 598
Detailed signature matches
    1. PF13812 (PPR_3)
    2. PF13041 (PPR_2)
    3. PF01535 (PPR)
    4. PS51375 (PPR)
    5. PF12854 (PPR_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24015 (FAMILY N...)
  2. SSF48452 (TPR-like)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213555 317 351 1.21E-05 TIGR00756 PPR cl03252 -
superfamily 214131 317 351 1.21E-05 cl03252 PPR superfamily - -
specific 213555 419 452 0.000238585 TIGR00756 PPR cl03252 -
superfamily 214131 419 452 0.000238585 cl03252 PPR superfamily - -
non-specific 144943 419 448 0.000278025 pfam01535 PPR cl03252 -
specific 144943 114 144 0.000283128 pfam01535 PPR cl03252 -
superfamily 214131 114 144 0.000283128 cl03252 PPR superfamily - -
non-specific 144943 317 347 0.000375293 pfam01535 PPR cl03252 -
non-specific 144943 216 245 0.00352462 pfam01535 PPR cl03252 -
superfamily 214131 216 245 0.00352462 cl03252 PPR superfamily - -
non-specific 213555 114 147 0.00362072 TIGR00756 PPR cl03252 -
multi-dom 205222 314 363 1.21E-09 pfam13041 PPR_2 - -
multi-dom 205222 416 462 3.58E-07 pfam13041 PPR_2 - -
multi-dom 205222 450 500 0.000153822 pfam13041 PPR_2 - -
multi-dom 205222 213 259 0.00274981 pfam13041 PPR_2 - -
multi-dom 215561 15 598 2.29E-111 PLN03077 PLN03077 - -
multi-dom 215563 99 596 2.67E-76 PLN03081 PLN03081 - -
multi-dom 215561 87 511 1.08E-73 PLN03077 PLN03077 - C
multi-dom 215563 43 378 2.28E-48 PLN03081 PLN03081 - C
multi-dom 215563 8 422 3.05E-25 PLN03081 PLN03081 - N
multi-dom 215636 269 532 3.80E-13 PLN03218 PLN03218 - NC
multi-dom 215636 99 530 4.79E-13 PLN03218 PLN03218 - NC
multi-dom 215636 8 426 3.03E-06 PLN03218 PLN03218 - NC
multi-dom 205222 114 158 5.40E-05 pfam13041 PPR_2 - -
multi-dom 205109 483 515 0.000520862 pfam12854 PPR_1 - -
multi-dom 205222 486 514 0.00365089 pfam13041 PPR_2 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002197G0180 gene.
CACACTGAGGTAGAGGAAACTGAAGTCCACTTTTCACAAATTAATTTTAAGAGATTACTTTATTAAATTTTTAATGGCTATCTACTTGATATTATCCATGTGTAATGGATCTAAGCATACAATATTTTAATTCACTTGTTCTCTTTGTTTCCGAGAGAGGGGGTTCACCGTCGGCTACTCTACGGAGTCTACGAATTCGGTCTCCAATGCTAACCGGTGAGGTCGCCAGGGGTAAACTTGTTGATGTCTCTGTTTGGGGGCATTGGCGAGAGCGGTGACGGCATTTGAAACAAGGGATGAGGTCTCCATACCTAGCAACACCATGTTGTATTGTACATTTTCCATCGCCAATGAGGTCTCCGTCCCCGGCGAGGACTTCATCTGGTGAGATTTACTTCCATGTTCTTTTTAGTTTTTAGTAGATGTTAATCTTTTGCATTCCATATTTCCATTCCAGTCTGACAGAGTATCACAGTTGTTTTGCATTCCAGTCAAGTAGAAAGCTGCTGCACTATCCGGTCACAAAACAAAATACCATTTGAATTTGTTTTGCATTGTCTTGTGTTGAGCTTTTACAAAATACAACTGTTTTACATTCCAATCAAGTAGGAGGTTTGAGAGGTACTGCTTCATTCATTCTGTTTAGTTCTGTAGTTGGGCATCATTCATCAAACATATTTGAGAGGTACTGCTTCATTCACTCTGTTTAGTTCGGTAGTTGGGCATTAGTGAGATTTCTTAAGCAATTAATGAGAAAGGTACTACCTCCGTTTCTAAATACTTGTCATCTTTGACTTTTCACGGTCTCCAGAGTTAAATGTTGATTCTTAATTTTGTACTAATACATTTATAAAATTTTATAGGAGTATAATATTATGAAAATATTCCTTACGACAAAACTAACAGTACCATTTTAATACGACAAATCTAAATATTTTAGGAAAATACCATTGGTCAAAGATTACCAAGTTTGACTGCTCAAAATCAAAAGGGTCAAATAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGCAACCCCGCCCCGACGCCGACGACCACCCTGCGCCACTGGAACCGCCTGATCCAGCTCGCCGCCGCGTCGGGTTCCTACTCCCACTGCCTCCGCCGCTACGCCTCCCTCCTCTCCGAGGGCTTCCGCGGCGACGCCTCCACCTTCCCTTCCCTCGCCAAGTCCTGCGCTGCGCTCCGCCTCCCCCGCCTCGGCCGCGCCCTCCACGCGTGTGCCCTCCTCGCGGGCGTAGCCTCCGACGTCTTCGTCCGGACCTCGCTCCTTGACATGTACGCCAAGTGCGCCTGCCTCCCCGATGCGCGCCGCCTGTTCGATGAAATGCCGCGCCGGACCCTGGTCTCCTGGAACTGCATGGTCACAGCATATAGCAAGAGCTCTCGGGTTGATGAGGCTGTCGCGATGTTCAACGCAATGCGGGGCATTGGGGTGAGGCCCAGTGGGGGCACGCTTGTCGGTGTTCTATCGGGGTGTGTGGACTCCATGTCCACTAGCAATCTTGGCTTGTGCGTGTACGGATACAGCGTGAAATCTGGGCTTGACGCGGATTTGACTGTCTTGAACTCGGTGCTCACCATGCTTGTCCGTGGCAGCCAGCTGGACGCTGCATGGTTGCTGTTTGATTGTATGGACAAGAAGTCTGTAGTTACTTGGAGTGCAATGGCGTCGGGTTATTTGCAGATGGGGGACTATGCGGAAGTGTTTGATCTGTTCAACCGCATGCAGGGAGTTGGGCACAATTTTGATTCAGTGGCGCTTGTTAATCTGATCTCCGCAGCTGTTCTGTTTGGAAACTTGTTGGTGGCCAAGGGTGTGCATGCTCTTGTGATCAAGGGTGGTTTTGAATCCAAGGAAGTTCTTGTGGCATCATTGGTAAACATGTATGCAAAGTGTGGGGATCTTAAGGCTGCTCGAGAGGTGTTTGATGCAGTTCACTGGAAGAATGTAGTGCTGTGGACTGCAATGATAAGTGGATATGTTGAAGGTGGTTGTCCGGACAAGGCATTGTCAATGTTCGATAGCATGTTGCACGCAAACATAGAGCCAAATGAAGCAACTGTTTCATCAATTCTTTCAGCTTGTGCCAATTTAGGATCTGCTGTTCTGGGGAAAAAGGTTGAGGAGCATGTGACAGCAATCGGACTGCAATCAGATCTGCGAGTTGCTACTGGGCTGATAGACATGTACTGTAAGTGTGGGAGCATCGAGCTGGCTAGGATAATATTTGATGGTGTTACCAGTAGAGACTTAGCTATCTGGAGTGCCATGATTAATGGATATGCTTGCAATGGAGAAGGCAGTCAGGCTCTTGTCCTTTTCAACGAGATGCAAAATGAAGGTGTTCTTCCAGATGCCATTGTCTTTACTCATCTATTAACAGCATGCAACCATTCTGGTTTAATAGATGAAGGTCTTCAGTGCTTTCACAGCATGACAGTAGAATATGGTATCGAGCCATCTACTGAGCATTACATGTGCATGATTGATTTGCTATGTAAAGCTGGTCATCTTAGTAACGCTATGAAGTTCTTTAAGCAGATGCCTATTCAATTACAAAATCAGGTCTTGGCTCCTATAATTAGTGCATACAGTGCTCATTGTGCCGATTCATTGCTAGAGTTGGTACCAGAGGAACTACTTAACCTGGACTCTCAAAATTCTGGTCACTGTGTCCTGATGGCTAATATGCTCAGTTGTTTAGGGAAGTGGAAGAAGGCCACAAGTTATAGGAGTCTAATAAACAAGCAAGGATTAGTCAAGGAACCTGGATGGAGCTGTATTGAGCTGAGTGGCTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002197G0180 gene.
TTAAATATGATACTAGGAGGTATTTTTGGGCCACTCCCTTGATTTGGTGCAACAAAATGCAACATCCAATCAGGAAACAATTGGCTTGGATTGAGGCTTAACGAGGGTCAGCTTCCCGGCCCTCCTACAGGTTAATGGCTATAATCTTATAAACAAAACTCTGCAAACGAAGAAACATGAAAATACACTCATTATCTTCTTCAAGATAGCATCATTGAATCTACCCAGAGTTGAATCCTATGGTACAGTATTGCATATGAGTTGAATTAAAGATTTGCACTGATTTCAATTATTAGTTCAGTCCAAGTACTATTAAGTTTTAAATTAGCTTCTAGTGAGAGATATAGTAACTAGTGTAAGTTTTGCATTTAGGTACTAGGCAGTGCAGCATTTACAACAAAGTAAGATTATTCATGTATTCTTGTAACTTACAGAGTACACATTAGATGCTAAACTGTTGCTTTGAATTTTATTTCTATGGCCGAAAGGAGCATTTCCTTAAATAAATTCTCTCCAGTTATTGTAGAATTGCTGCATGAAATGAAATAAACTCCAAATGGCACCACATTTAGACCAAAAAGAACATCAAGTTCCAAGCATCTTCACATTTAGGATTCATAATTTGTGTTCTAAGATTTGTTGTATTGGAGGAACCAGAAAAGGCGGCCTTGTGAACTTAAAATCATAAAAGTTCATCTTTATGGTCGTCTCATTCAGTTTGTCCCTTTTGGTAATGATTTCTCATTGTCTCTTATTATAAAAATATGAGTAAATTTAACAAAACTACACTATTTAGGAACCATTTCACATAACCACACTAGCTATTGCGTAACGTTTCCGTCCATTCCCGTATACCTGACGACTTGGGCCCAGATGGCAGCCACAGAACCCTGTCTGGCCTGTTATGCTGATGTGGACTTCCTTGCCACGTGCGTACGTTTTAAGGAACCACACTTCCGTCATTCCCGTATACCTGACGACTTGGCTGCCACCTAGTCTTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002197 Download
Protein sequence
Protein sequence
MSNPAPTPTTTLRHWNRLIQLAAASGSYSHCLRRYASLLSEGFRGDASTFPSLAKSCAALRLPRLGRALHACALLAGVASDVFVRTSLLDMYAKCACLPDARRLFDEMPRRTLVSWNCMVTAYSKSSRVDEAVAMFNAMRGIGVRPSGGTLVGVLSGCVDSMSTSNLGLCVYGYSVKSGLDADLTVLNSVLTMLVRGSQLDAAWLLFDCMDKKSVVTWSAMASGYLQMGDYAEVFDLFNRMQGVGHNFDSVALVNLISAAVLFGNLLVAKGVHALVIKGGFESKEVLVASLVNMYAKCGDLKAAREVFDAVHWKNVVLWTAMISGYVEGGCPDKALSMFDSMLHANIEPNEATVSSILSACANLGSAVLGKKVEEHVTAIGLQSDLRVATGLIDMYCKCGSIELARIIFDGVTSRDLAIWSAMINGYACNGEGSQALVLFNEMQNEGVLPDAIVFTHLLTACNHSGLIDEGLQCFHSMTVEYGIEPSTEHYMCMIDLLCKAGHLSNAMKFFKQMPIQLQNQVLAPIISAYSAHCADSLLELVPEELLNLDSQNSGHCVLMANMLSCLGKWKKATSYRSLINKQGLVKEPGWSCIELSG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above