gene PH01002190G0080
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002190:70250 - 74860(+ stand)   Name
Alternate name Locus tag PH01002190G0080
Length of gene 4611  bp Length of CDS 1833  bp
Product information
Feature type
CDS
Product name
cytochrome P450 domain containing protein
Alternate name
Molecular weight
(predicted)
68099.3941200002  kDa
Isoeletric point
(predicted)
8.34366226196289
Length
610  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
(0 result)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os09g21260.1 cytochrome P450 domain containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. PR00385 (P450)
    2. PF00067 (p450)
    3. SSF48264 (Cytochrom...)
    1. PR00463 (EP450I)
    1. PS00086 (CYTOCHROME...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24286 (FAMILY N...)
  2. PTHR24286:SF7 (SUBF...)
GO term prediction

Biological Process

GO:0055114 oxidation-reduction process

Molecular Function

GO:0005506 iron ion binding
GO:0009055 electron carrier activity
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037 heme binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Metabolism Metabolism of terpenoids and polyketides Limonene and pinene degradation  
Metabolism Biosynthesis of other secondary metabolites Stilbenoid, diarylheptanoid and gingerol biosynthesis  
Metabolism Xenobiotics biodegradation and metabolism Aminobenzoate degradation  
Metabolism Xenobiotics biodegradation and metabolism Bisphenol degradation  
Metabolism Xenobiotics biodegradation and metabolism Polycyclic aromatic hydrocarbon degradation  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K00517 EC:1.14.-.-
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 177847 157 593 1.52E-75 PLN02196 PLN02196 cl12078 -
superfamily 245864 157 593 1.52E-75 cl12078 p450 superfamily - -
non-specific 215171 153 582 8.35E-73 PLN02302 PLN02302 cl12078 -
non-specific 215276 147 591 7.69E-61 PLN02500 PLN02500 cl12078 -
non-specific 178373 154 592 5.35E-56 PLN02774 PLN02774 cl12078 -
non-specific 215689 158 566 1.66E-49 pfam00067 p450 cl12078 -
non-specific 215086 144 569 3.74E-22 PLN00168 PLN00168 cl18321 -
superfamily 215086 144 569 3.74E-22 cl18321 PLN00168 superfamily - -
non-specific 215354 359 569 9.01E-20 PLN02655 PLN02655 cl18330 N
superfamily 215354 359 569 9.01E-20 cl18330 PLN02655 superfamily - N
non-specific 178524 393 571 1.84E-18 PLN02936 PLN02936 cl12078 N
non-specific 173595 396 565 1.22E-16 PTZ00404 PTZ00404 cl12078 N
non-specific 215371 147 569 3.48E-14 PLN02687 PLN02687 cl12078 -
non-specific 215627 357 569 6.34E-14 PLN03195 PLN03195 cl12078 N
non-specific 215235 356 550 1.65E-13 PLN02426 PLN02426 cl18327 N
superfamily 215235 356 550 1.65E-13 cl18327 PLN02426 superfamily - N
non-specific 177725 398 571 1.09E-12 PLN00110 PLN00110 cl12078 N
non-specific 215583 358 569 6.78E-12 PLN03112 PLN03112 cl12078 N
non-specific 215221 393 543 4.62E-11 PLN02394 PLN02394 cl18326 N
superfamily 215221 393 543 4.62E-11 cl18326 PLN02394 superfamily - N
non-specific 177826 376 569 3.60E-06 PLN02169 PLN02169 cl18090 N
superfamily 177826 376 569 3.60E-06 cl18090 PLN02169 superfamily - N
non-specific 178592 387 570 7.04E-06 PLN03018 PLN03018 cl18100 N
superfamily 178592 387 570 7.04E-06 cl18100 PLN03018 superfamily - N
multi-dom 215600 152 564 2.21E-61 PLN03141 PLN03141 - -
multi-dom 166628 153 564 6.69E-64 PLN02987 PLN02987 - -
multi-dom 225035 165 569 9.07E-49 COG2124 CypX - -
multi-dom 215393 377 569 1.71E-20 PLN02738 PLN02738 - N
multi-dom 215164 358 567 1.02E-16 PLN02290 PLN02290 - N
multi-dom 165828 391 569 8.80E-16 PLN02183 PLN02183 - N
multi-dom 178550 153 569 1.15E-12 PLN02966 PLN02966 - -
multi-dom 178773 152 569 1.99E-11 PLN03234 PLN03234 - -
multi-dom 166612 386 567 1.86E-08 PLN02971 PLN02971 - N
multi-dom 215350 371 518 1.35E-06 PLN02648 PLN02648 - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002190G0080 gene.
GCATCTCCTTATATAGGGCACATGACGGATCCTATCTGAACATGTTTGTTCTAGCTTGTTAAGTGTATGACCCTGTAGGTTCATGCGTAATCAGATGTGACTCGAAAATCCTTTTCGACCATGAGTCGTTAGCGGTTCCTAGTAGGACGTAACGATTCCCGAATACACACAAATTATATCAAACGAATTTTAATGCAATATAATCTACGATCAGGTCCTTATCACTAACGACCAGCTCGTATCTCTATACAACTAGTTCATATTTAGTCTAGACCAGTTCGTAACTCTTTACAAGCAGGTTTCGACCACTTAGTGATTATGTTCGACCAGTTTATGACCAGCTCGTATCTGATCGAACTTAACGACCTTCTCATGTATTCTCCCTTTGCCTCACAATATCTGGTTAAACTCCAGATGAGATATTATGTTATCCATAGACTGTTCAATACTTTCTCGATGGAGTGTCGGATAACTTCATGTGGTCGAACTCTTCGACCACTAGTGGCATGGTCATGCACTTTCTTTATCCGACCACATCGAGGGGCCCAGAGATATCTCTCCTGTTATATTAGAAGGGGGGAAATCCCATATCCTACCAGTCACATTCCTCCACATGTTTCATAGCATACCGAAAGCTACCTTTATTACTACCGAGTTACGAGTACCGTTTAGCAATCCCTAAGTGTACTATTACACATGTAGAAAACCATGTTGATCTCAGGTCTAAGGATTATACATCATCATTGCTTGAGACCAACTTATGACACATAGAATCATAACAATCTCAACGGTGTCTCAAGGTGGGTCAATCCAACACCATGTTCTCTAACATGTGTGCACATTATTGATTTGATATCATTATATCCATAATTGGTGAAACATGGTCATCAATCAATACATGTGCTAGTTGATAAGTCACTAGTGACATTCGACCAGGGATACATTTAGAACAACATCATATAAGTTAAAGAGCTTCACCAACAAGTCACATACTTGTTGAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGGAGAAGAGGAGAGAGAGCACGCCATGGACATGGGAGGCCGGTCGGACCTCTGGAGAGGTCATGGTGGCGCAGCGCCAGACATCGTGGCAAGCCACGTGACGGGGCCAAAGAAGAATCCGTGTGCGGCGTGGCCACGAGGGGAGTGAACGACCTCGCCTACTGGGGCCTCGACTACCCGCCCCTCTCTGAGGAGGAGGGCGTGGAGGCGGCTCTGTGGAGTCCATCTGACAAAGAAAATTCTCACCAGCTAGACATTGCAGAGTCACTACCTAATCCATTGCATGCTCTCGATCGACCATTCACGCCAGCTGAGAAATTAATGGACGCTTCCTCCATCTTGGCAGCTCTTGCAGCAGTAATCCTTGCTGCAATTGTCGCATCGCTCCCGGTGTTGCACCACCACAAAAGGCGGCAGCACTCAGCAGCTGATCATCGCGTCGGCGACGACAAGAAGCGGCGCCAGCTGCCCCCCGGCTCCTTCGGGCTGCCCGTCGTCGGCCAGACGCTCGGCCTGCTGCGCGCCCTCCGCGCCAACACCGGCGAGGAATGGCTCCGGCGGTGGTCCGCCGCGTACGGTCCCGTGTCGAGGCTGTTGCTCTTCGGCTGCCCGACGGCCTTCCTCGTCGGCCCCTCGCTCAACAAGTTCCTCTTCGCCAGCGCCGCGCTGACCGCCAAGAACACGCCGTCCTTCAATCGGATGGTCGGCTGGCGGACGATCCGGGAGGTGACCGGCGACGAGCACCGCCGCGTCAGGGCCATGATGGTCCAGTTCCTCAAGCTGGACGCAGTCAAGAGGTACGTTGGCAGCATGGACGACGAGGTACGGCACCACCTCCGCACCTGCTGGCGCGGCGGGGGCACCGTCGCGGTGATGCCGTCGATGAAGTCGCTGACGTTCGACATCATGTGCACCGTCATCTTCGGGCTTGGGAGGGGAGCCCATGACGCCGTCAGGCGGGAGCTGTCGGTGGAGTTCCAGCAGCTGGTGAGGGGCATCTGGGCGATCCCGGTGAACCTGCCCTTCACCACCTTCGGCAAGTGCCTCGCCCGGCGGACCGTCGCCGGGGTAATAAAGGAGAGGCGGGCCAAGCTGGAGCTCGGGGAGAGCTCGCTGGCAGACGACATCGTGACCCACATGCTCGCCGAGGGCCTCCCCGACGAGGAGATCATCGACAACGTCATGTTCCTGATGGTGGCCGCGCACGACACCACCGCCATCCTCCTGACCTTCCTGATCCGGCAGCTGGACAGCAACAGGGACGCCTACGCCAGAGTGGTGCAGGAGCAGGAGGAGATCGCGAGGTGCAAGGTTGCAGGGGAAGCTCTGACATGGGACGACCTTGGCAAGATGAGGTACACATGGGCGGCGGCGATGGAGACGCTGCGGATGGTTCCCCCCCTGTTCGGCCTCTTCAGGAGAGCGCTCGATGACGTGGAGTTGGACGGCTACCTGATACCCAGGGGATGGCAGGTGATGTACGCGATGAACATGACGCAGTGGGACCCGGCCATCTTCCCGGAGCCCGGCAGGTTCGAGCCGGCGCGGTTCGAGAACCCGTCGGCGTCGGCGATACCGCCCTTCAGCTTCGTGCCGTTTGGCGGAGGCGTGCGCGTGTGCCCCGGGAACGAGTTCGCGAGGGTGGAGACGCTCGTGGCCATGCACTACATCGTTACCGAGTTCAGATGGAAGCTCGCCGCCGGCTGCGACGGCAGCTTTTCCAGGTACCCGCTGCCGTACCCGTCTCAGGGCCTCCTCATCGACATCGAGCCAAAGGAAACAAGCACTGCACTGCATGACCGAACGTATGATTCCGATTCAGTTAATTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002190G0080 gene.
ATAAATTAAACTAAAATTTCAGAAATTTTGTGGGGGAATTAGACCCCAACCCCCTATGGCCGCCACCCTCCCCCCCNNNNNNNNNNCCACCCCCCAAACTGGCCTCTACCCCCCTCTCCTCCCTTGCGCCTCCTCCCTGTCCAGCACCTCCCCTTGCAAGCCTTGTTATCCATCTCCATCCATTGGTGGTCTTCCCTCCATTGATGCCGGCCAAAGGAAGGAGGAAGAAGCCCCTATGTGCTGCCGGCCATGGTAGAAGAGAAGAGGAAGAGGGAGAGGGAAGGGAAAAAGAGGATCTTGTGGAGTTTTCAGTGAGTCAACATGTCTTCTAGGGTAATTTCGTTTCCCCAATAGCTAGTCTAATGTTTTGTCTAAGCGATTTGGGGTGGAATATCATATTTGTTCCTTGCTATCAGCTAATCGGCATTGCTGCAGTTCTGTTAATTTGTAAGGTTGAGTTAGTTCCAAGTGGATCCAACATTTAGGGTCTCCTAGAGTTATGTGGAGAATTACGTGGGATTTATGGAAAGTATTAATTAGCAATTTTTGGTTGGATAATGAATTAGTTATTATTTTTGCAAGTTTGGGTGCTTCTGCAGTCTCTGGATTCAGGCAGCGAGCGTAGTTCTGTGAATTAGGGTCTAGAGATGGACGAATCTGGTCAGTTGATCTGCATGATTTATGTAGATAACTTTATAATGGTTCCAGGTAGACCAAGATCATAATTTTTGGATATTTAGAACGAAAGTTATGAATTTTTGAAGTTATTGTTGTAGTCTGTCCTTCTGTTGTGGACAGTAGAGAAAGACTAGTTTGTTAGCAATCTTTGTTGCACATTGGGGAAAATCATAATAAATTTATTGAGGAAGCTAGTTCTTTGTAGTTTCCGGAATGGCTTAGAACATTGGGTTTGGATGTACCAATTAAGAGATACGAAATTCCTAAGTCGGTAGTACTAAAGATGATAGAACGGTCTTCGGGGATAAAAACAAAGACTTAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002190 Download
Protein sequence
Protein sequence
MGRRGERARHGHGRPVGPLERSWWRSARHRGKPRDGAKEESVCGVATRGVNDLAYWGLDYPPLSEEEGVEAALWSPSDKENSHQLDIAESLPNPLHALDRPFTPAEKLMDASSILAALAAVILAAIVASLPVLHHHKRRQHSAADHRVGDDKKRRQLPPGSFGLPVVGQTLGLLRALRANTGEEWLRRWSAAYGPVSRLLLFGCPTAFLVGPSLNKFLFASAALTAKNTPSFNRMVGWRTIREVTGDEHRRVRAMMVQFLKLDAVKRYVGSMDDEVRHHLRTCWRGGGTVAVMPSMKSLTFDIMCTVIFGLGRGAHDAVRRELSVEFQQLVRGIWAIPVNLPFTTFGKCLARRTVAGVIKERRAKLELGESSLADDIVTHMLAEGLPDEEIIDNVMFLMVAAHDTTAILLTFLIRQLDSNRDAYARVVQEQEEIARCKVAGEALTWDDLGKMRYTWAAAMETLRMVPPLFGLFRRALDDVELDGYLIPRGWQVMYAMNMTQWDPAIFPEPGRFEPARFENPSASAIPPFSFVPFGGGVRVCPGNEFARVETLVAMHYIVTEFRWKLAAGCDGSFSRYPLPYPSQGLLIDIEPKETSTALHDRTYDSDSVN
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above