gene PH01002128G0250
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01002128:177905 - 189622(+ stand)   Name
Alternate name Locus tag PH01002128G0250
Length of gene 11718  bp Length of CDS 2766  bp
Product information
Feature type
CDS
Product name
lipase
Alternate name
Molecular weight
(predicted)
101132.30232  kDa
Isoeletric point
(predicted)
8.92177963256836
Length
921  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_187389 2
Please click OG5_187389 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g49380.1 lipase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 600 700 800 921
Detailed signature matches
    1. PR00111 (ABHYDROLASE)
    1. PF03398 (Ist1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PF12697 (Abhydrolase_6)
  2. PTHR11614 (PHOSPHOL...)
  3. SSF53474 (alpha/bet...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 217533 452 617 7.88E-77 pfam03398 Ist1 cl04048 -
superfamily 217533 452 617 7.88E-77 cl04048 Ist1 superfamily - -
specific 221442 119 197 6.45E-22 pfam12146 Hydrolase_4 cl18607 -
superfamily 221442 119 197 6.45E-22 cl18607 Hydrolase_4 superfamily - -
multi-dom 215216 34 352 3.30E-170 PLN02385 PLN02385 - -
multi-dom 165939 100 351 7.07E-61 PLN02298 PLN02298 - -
multi-dom 215352 105 351 9.83E-26 PLN02652 PLN02652 - N
multi-dom 225176 102 352 1.60E-22 COG2267 PldB - -
multi-dom 165193 112 350 6.30E-18 PHA02857 PHA02857 - -
multi-dom 221720 139 249 4.99E-14 pfam12697 Abhydrolase_6 - C
multi-dom 223669 113 353 5.52E-13 COG0596 MhpC - -
multi-dom 221718 138 244 2.16E-11 pfam12695 Abhydrolase_5 - C
multi-dom 184875 130 244 9.98E-08 PRK14875 PRK14875 - NC
multi-dom 162444 164 348 2.43E-07 TIGR01607 PST-A - N
multi-dom 201306 165 354 9.47E-06 pfam00561 Abhydrolase_1 - -
multi-dom 216224 141 235 0.00064234 pfam00975 Thioesterase - C
multi-dom 182697 164 246 0.000668955 PRK10749 PRK10749 - NC
multi-dom 224561 134 351 0.000780866 COG1647 COG1647 - -
multi-dom 223730 129 264 0.00159767 COG0657 Aes - NC
multi-dom 225856 138 228 0.00306662 COG3319 COG3319 - C
multi-dom 225749 166 240 0.00525759 COG3208 GrsT - C
multi-dom 223489 150 266 0.00579743 COG0412 COG0412 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01002128G0250 gene.
GGCCCCTACTTCCGCTGCATGTGTCCGTTGCAGTCCTTGTCGTGACCTTCCCTATCATTCATTTTCTTCTGTTGCCAAATGTTACTGTTCTGTATTAATGGTCAGTAAGTTGGCTTAGGGCCTGCCTGCCTACCCGTGTAGTATGTAGTGTTATATATTATAGGTACGTGGTTGGACGTGCCGAATTACTAGAGGTATAGGGCAGCATTCTATATTATGCCTTTTGTTACCATGTTTTGTGCATTTCGGACTCATATATCTTATCTGTAATTAAAATGATACGGGAAATTTAGTACGAGAGGCCTTGGCTGTCTGATCGAAAGTCAATGCTTAGGATTGTAGGGGTGAGGTATTCGATGTTTCTCTGGAATATTTGTGCACCTCAAATCCTTACTAGTTAGCCCTGCTCGTGCCTTAGATTGTAGGACAAAATACAGTCTCTTGTCGAGTGTGTATATTGATTGACTACTGGTATTTGATCGCCACTCTAGTTTGCAATGGCTGAAAGTTTTTGTCTATGGAGTAGGTATTTAAATTAAGCTAATAGGTTGGTTCCCCTTGTTAGATTCGCTCTCCTTTTCACCTGCTGTCTGGATGAGCACCCGATGTAATGTCCGTTTTGTCGAGTTTAGGAAGTTAAGAACATCCAGCATCCGCATCAACCCCTGTCGAGCGGCTAATTATTTAACATGGGCCAATAAATAAATGAATCAGGTGAGAGGTGCAGGCATGCTGAGCTAGCTAGCTTAGCTAGCGGTGCAAGTTGTACAGCAGAAACAAACGCTGATCTCATCAGAAATCAAAACCTTCACCGAAACATGTCAAGTTGCAGACGGTACGTTCGAACTAATTAAAACAGGGTCAATGATACAACAAGTGTCGCGATAGAAAAAGGAGAAGAAAAACAAAAGGAAGGATGTGGAGTACATACATGGTACAAAATCGCATCTTCATCGCATTAACCAAACCAACGGGGGAAAAATCAAAGCTGCTGGTTGAGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCCTCACATGGCAGCGATCTCGCAGCGGATCGCGGGGCCGCGCCACGGCGGGGTGCCGCGGCCGGGGAGGGGCGCGGCGGCCGCGGCCAACACGACGCGGAGGCTGGAGGGCGCGAGCGGGGAGCTGAGGGCCGCCGCGGCGCAGTGCCTCGACTGGGCGCCGGCGCGCCGGCGCGTGCGCGGCGCCTTCGTGCCCGTGCTCCCCACACTCGAGCACTGCCTGTTCAAGGTCTCGTCTCTTGGTCCCTTCGGCTTGGGTGGCTTGCTGGGTTTCATACTTGGAATAATCAATTATGATTTCATGGCTCCCAAGGGAATCCAGATGGAGGAGAATTTTGAGACCAATTCAAAGGGAGTTGAGATATTCTGGAAGAGCTGGCTGCCTAGAGAGGGCACTGCCACCAAGGCAGCGCTTTTCTTCTGCCATGGGTATGGAGATACCTGCACTTTCTTTTTTGAAGGTATTGCTAAGAGAATAGCCGCCGCTGGATATGCAGTATATGCTATGGATTATCCTGGTTTTGGTCTGTCATATGGTCTTCATGGCTACATCGCAAGTTTTGATGGAATGGTAGACCATGTCATTGAACAATATGCACGAATAAGAGGCAGGAAGGATGTGCGTGGGCTCCCACACTTTCTCTTGGGGCAGTCAATGGGAGGTGCGGTTGCTCTTAAAGTACACTTGAAGCAACAAAAAGAATGGGATGGAGTGCTTCTTGTTGCGCCTATGTGTAAGACTTTGACTTCTATTGGCAAGATTGCAGAAGATGTAACACCACCAGCGCCAGTATTGAAGGTACTGAGCATATTGTCATGTCTTCTTCCAGAAGCGAAGTTATTTCCGCAGAAAGATATAGGAGATTTGGCATTTAGAGATCCAAGGAAAAGAAAAGTAGCTGAGTACAACGTCATCTCATATACTCACCAAATGAGGTTGAGGACAGCAGTTGAACTTTTGAAGGCTACAAAGGACATTGAATCCCAGCTGGAGAAGATTTGCTCCCCATTGCTGATTCTTCATGGAGCAGCAGACATGGTGACCGACCCTCACACTTGCATTGTGGTTAACTGTGCTGCTCTGAGGATCCAGAGCGAGAGCTCAGCCCATCCCAAGTCAGAAAGTGAGCCCATCCCAAGTCAGAAAGCCGACCTTGAGAAGGCAGGTGGCAACTCTAAGCTCGAAAAACAATCAAGTCAAGGGGTATACCTGCAAAAATACACACATCTTCTTTCCCCTACTCCCCTTGCCTGGAGTGCTAGACCTCGCCGGGTGGATCAGCGGCCGAGGCTACTGACGATGTCGTCCCTCAACTCGCTCTTCAACCGCTCCACCTTCGGCACCAAATGCAAAACATGCTTGAATTTGATCATTTCGAGGATCAAGCTGCTGCGCAATAGGAGGGAGTTGCAACTGATAAATATGCGCAAAGAGATGGTTCAGTATCTTCAGACAGGCCAGGAATCGATTGCAAGGATTCGAGTGGAGCATATCATTCGGGAGCAAAATATATTGGCTGCTTACGAGATTGTAGAGCTTTTCTGTGAATTTATTCTGGCACGAGTCCCTATTGTTGAGGTCCAAAAGGAATGTCCCTTAGAATTGCGAGAAGCAATAGCTAGTATAATCTTTGCATCTGGAAGATGTTCAGACTTGCCTGAGCTAATGCATCTCCGTAATTTGTTTACCACCAAGTATGGGAAGGAGTTTGTTGCTGCTGCCATGGAATTGCGCCCAGACAGCAGTGTTAATCGTACAATAATTGAGAAGCTTTCAGTCAAGGCTCCATCAGCTGAATCAAAGCTGAAGGTTTTGAAAGCTATTGCTCAAGAGTACAATCTTGAGTGGGATTCATCTAATACCGAAACTGAGTTCAATAAGAAATACGAAGATCTGCTGGATGGCTCAGGACCTTCAGCCCACCAAGGCCAGGCACCTATAATTAAGAGCTCTCCAGTTGCTTCCGTTTCCAGACATAAGCCATCGGTGTCCATTTCACCAGTCGAGGACACAGGAAAACATGGAGCTCCCGAGTCTCCAAGCTCACCTGCTGGGAGTGCAAGAACATACGCCGCCGCTAAGAGTAATGTGGCGAGCCAAGAGCATCACTCCCCTGCCAAGGAGATATCCTGCACTAGCCCAAGTTCATCAGACGTTCTTGAAAAAGCCCGAGCTGCCATCGCTGCAGCCAACCGCGCATCCGCCTCTGCCCGTGCTGCAGCAGACCTTGTAAAGACCCCTGCTGAGAGAGTGAAAGCAAAGATGAAGCTTCAGCTTTCAGAGACAGCTTCAAAAGATTCCACCCTTAGAACTGCCACTGTGGGGTGGGAAAGATTTGAATTCAACAAGGATGCTCCACTTGATGAAGATGACAATGATGTTGAAGTTGCTAATGATGATGCTTCACTGGTGAAGCACATAGGAAAGAGCTTCCGACTTTCTGCTGTGGAGTCAAAGCATGAAGATATAGTCAGAGATGCACATGATGAGGCTATATTTGGTGTGCCTACATCTTCGATTGTTGATACTGAAACTGCTGAGGATGAGCTTAAAACTAACGATGAGGGTTCTGGCAATGCAAAAAGGGTCATGGAGAGAAAGGGCTCAGAAGTTGCGGCAGGATTCAAATACATGAAGTTTATCCTTGCTGAAGTTTCCATATCTGCTGTTCTACCAAATTTTGACTTCACCAGTGGTCTAGTGGTGATTCCGATGATGTTCAGATCGTCAAGAAGGAAGTCTACAATATTCAATTGGCAGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01002128G0250 gene.
TTAAATGATATGGATGAGAGAGAGAGCAAAGAAAATTGAGTCGTCTCTCATGCAGTAGTCGATTATGACACAAGAAACAAGACACATTATATAAGGAGTTGTCTATAGAGATATGTAAAAAGACAATCTATTGTAGGAGCTGTCTTTAATGCTGTCTATAGATAACATAAAGAGATACGATAAACAACAGTTGTCTATACCATTATATATACCCCTTTTTTCTTGAAAGGAGGAAACCTGATTTTTTATAAAAAGCATATAAGAGTTCATACAAAAGATCATTGTACATGCCCTTACAAGCTACATACTAGCAAGTAGCCAGTAGCTACATTACGAGAAGGCGAACTGCAGCAACAGCAAGTATGTGATTATTGGTGACATACTGACACGCACTAATGTTGCACATCACATGCAATCTTGACACTCTAATAGCTTAGCTAGCTTACCAGCGGTGCAACCTCGATGGCCATCGCTCATGCGCGCGCGCGGGCCGGCGGCTAGAAGTGCGGCTCGGCACGGCGGACAATGAGGAAGCCCTTCAGCTTCCCCAAGGCAGAATCGGCCGCGGCTCTCCAGAAAGGTCGCGGACACAGCCGGTGAAAGGACAGCAGGAGGCCGAGGAGCCAGAGCAGGAAGCCCGCGAACGCGTGCTCGCTGCTGGCGGGGGATGGCCTCCCCCCGGAGCGCACCACGACCGACGCACCAGCCAGCATGAAGAACGCGGGGAGAACGAGACGGCCGCGGTCGCGGCGCGGGATCGGCACGCCTGCAAGCGGTGGAAGCACGGGGTGGTACCCTTCACGAGCCATGCGATGCTTTCACGAACCACGATGTAAGCAAGCGCGCGTGCCCGTGTGTGGTTACTGGTTTCCTGTTTGGGTGCACCTGAGGGCTGGGAACCTGCGGTTGTATTTATATGCACAAAGGCATCCTCCAGATGGAGTTTTGGCTCATATGATATGCTTTGAAACGATATATCAAATCTACTATCCCGTAACAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01002128 Download
Protein sequence
Protein sequence
MPHMAAISQRIAGPRHGGVPRPGRGAAAAANTTRRLEGASGELRAAAAQCLDWAPARRRVRGAFVPVLPTLEHCLFKVSSLGPFGLGGLLGFILGIINYDFMAPKGIQMEENFETNSKGVEIFWKSWLPREGTATKAALFFCHGYGDTCTFFFEGIAKRIAAAGYAVYAMDYPGFGLSYGLHGYIASFDGMVDHVIEQYARIRGRKDVRGLPHFLLGQSMGGAVALKVHLKQQKEWDGVLLVAPMCKTLTSIGKIAEDVTPPAPVLKVLSILSCLLPEAKLFPQKDIGDLAFRDPRKRKVAEYNVISYTHQMRLRTAVELLKATKDIESQLEKICSPLLILHGAADMVTDPHTCIVVNCAALRIQSESSAHPKSESEPIPSQKADLEKAGGNSKLEKQSSQGVYLQKYTHLLSPTPLAWSARPRRVDQRPRLLTMSSLNSLFNRSTFGTKCKTCLNLIISRIKLLRNRRELQLINMRKEMVQYLQTGQESIARIRVEHIIREQNILAAYEIVELFCEFILARVPIVEVQKECPLELREAIASIIFASGRCSDLPELMHLRNLFTTKYGKEFVAAAMELRPDSSVNRTIIEKLSVKAPSAESKLKVLKAIAQEYNLEWDSSNTETEFNKKYEDLLDGSGPSAHQGQAPIIKSSPVASVSRHKPSVSISPVEDTGKHGAPESPSSPAGSARTYAAAKSNVASQEHHSPAKEISCTSPSSSDVLEKARAAIAAANRASASARAAADLVKTPAERVKAKMKLQLSETASKDSTLRTATVGWERFEFNKDAPLDEDDNDVEVANDDASLVKHIGKSFRLSAVESKHEDIVRDAHDEAIFGVPTSSIVDTETAEDELKTNDEGSGNAKRVMERKGSEVAAGFKYMKFILAEVSISAVLPNFDFTSGLVVIPMMFRSSRRKSTIFNWQ
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above