gene PH01001990G0350
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001990:198446 - 202976(+ stand)   Name
Alternate name Locus tag PH01001990G0350
Length of gene 4531  bp Length of CDS 1800  bp
Product information
Feature type
CDS
Product name
DUF1399 containing protein
Alternate name
Molecular weight
(predicted)
68234.1989200002  kDa
Isoeletric point
(predicted)
8.77518081665039
Length
599  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_156180 2
Please click OG5_156180 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G56230.1
Protein of unknown function (DUF1399)
Protein of unknown function (DUF1399); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prote
7E-132
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g24480.1 DUF1399 containing protein, putative, expressed 3E-162
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 203591 1 73 8.66E-21 pfam07173 DUF1399 cl06275 N
superfamily 203591 1 73 8.66E-21 cl06275 DUF1399 superfamily - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001990G0350 gene.
ATTTCCGTAAGTAACTAGATTTGTTATTTCACACTTACATTAGCCAAAAACTACGTTAACGTGGACCTTCTCTCCCCTTTGTCCGCGCTTTGCGGAGGGCCGACGCACGCAACGACTGCGGTAGCTGGACTCATCAGCTCGCTCCCCGTGTCGAAATAATTGATGCGAAGCGAAGCAGGTGGCAGCCAATCAAATCGCTCCAAATTACAAGTCCAAACACGTCGATAAGTGACATCCTCATCAATCATTCTCCTACATGAACGTGACCCAACAATAACCAAATGGTCGGTCCGTTCCGTCAAAAGCATCCATAATCCATCCGCTGTTGGCACACGTCTCTCACCCCTCTCGGCCAACCACTCCGCACTAGCGCCCACCACCATCAGCTGACACCTAAATCTCGCAGCAAGAAAGCGAATGCCCTCTGCAGCGGAGGCGTCGGAGCCCTCCGCCTCCGCCTCCGCCTCCGCCGTCGCCTCCGCATCCATGACCTCCTCCTCAGGCTCCCGTGGGCAGGCGGGACCCGTGTTCTCCGTCGACCTCGCCGCCGCCGCGCGCCGGCGGCGGCCGGCGGAGGCGTGGCTCCGAGGTCCGTGCGCAGGTACGAGGAGCTCTGGCTGCCGCTCGCGGCGGAGGCGGCGATGCTGGTGCCGCCGCCCGACGTGCAGCTCGTCTGGCTCTGCCACTGCTTCCACCATGTGAGCCTTCTTTGCCACCTTATGTCTTTACTGATCGCGTGAGATCTTGGGGAATTACTCAGTTTTTAGGGGTCGTTTAAAAATGGCAAACTCACGTGGTTTAATCAGTAAATAGTGCTGGGCCAAGCTTAAACGATTGTCTGTTAATTATACTGTGATCTTTAGAAAAAATAGACAGTTTACTGTGTATGGAAAACAACGTTTTGGGAAAATTCGGTAATGGTCTATTCACCGTACAAATAGCTTATACTTTTGGAAAAATCTACAATTTAAAATTAATCTCTGGGCTGGGCTTCATCTTTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGTTCAAAGTTATGCTGGCCTAGCAGCTCGCTTTGCCTCGCCCTACGTCTCGGAAGGCGTCTACCATGTTGCTGCAAGGCGGCGATATGTGTATTTCCTGGACCTAATCAAGAAGGCTGTGTGCACAACTAAAGAACACACACGGCTGGTGCCTAGCCTGGACATATTACTAATGTGGCTTGCTCACCAGAGTTTTCCAGTGAGCTATGCGACGGACACGGCAGCAATGGCCATCAGGGACAATATTGTGAAAGTGGTGGTGGGTTATGGGGAGGTGGTGAGTGAGGAGGTGGTGCAGAGGACAAGGGTGTTGTGGGAGGAGGCCTATGATGAGCCATATGATGCGGCTGGATCAGAGGTTGATGCGGCAGCAGTTAGCGCAGCGAGGGAAGCATTCTATTGGGAGGCTGCAGCATCAGAAGAGAATGCCAACCGTCTGTACAAGGGGTTGCAACCTAGGTTTCTTATGGAGGTATATGTGTTCTTGAAAGGAGAATTTGACAGTGAACATATCAGCAAGGAATTCCTACGGTTGCGAGCACAGAGGTGTCACAGATCACTAAAGCTCAACAAATCAATGTCCAATTTATCCTGCAAAAACTGGCAGAAAACATGGCATCTGTACTGTGAATTTGCAACCCGGGGCCTCACCATTGAGGTCAGGCGCAGCACGAGTGGTTGCTTCAGGAACAGCAAGCTCCTCAAGCATATATCATTCTCATGGAGTGATATGTTGCATGAGAAAGCCCTCACTCTTACAGGGGAGCTCGATGTCAGGATGAGAGCGATGGCATCTATTACCCCTCCAATTCAAGCACCATACTTGTTGAAGTGTGTACCTGACCGAGTCACTGATGATGGTGGGGCCATGATTTCTGATGTCATATTGCGCATGAGAAGTTACCGTCCGCAAGAAGGACGGTGGCTGACCCGCACGGTGCTTGATCACGGTGGGAAAGAATGTTTCGTCATTCGAATAAGAATAGGCAGAGGAATTTGGCGGAGAGGCGCTGAAACTCCCGTGGCAGTCAAATGGGAGGACAGGATCATTGAAGTCCGAGAAGGCTCATGGTCATACATTGCAAGTGCAACATCCGTTGGTTATGCTCCTGGTAACTTCAGTATGCAGAATAATTGGTTCATGTCAGTATCATATCTTGCCTTAAGAGGAGAGAAGGTAGTGGGCACAGCAACACCAACGAAAGATCAACAGGAGAATAAGGTGGTTTGGTGCTTTTCAACTGGAGATGTACTGACAGTGCGGTTGGGAGATGACCTCAACTTTCTGCTACAAAACGAGAGCTCAGAACAGGAGGCAAGGCTGCTTGTAGGAAGGAGATTGAGCTACAGAATAAACAAGGATAGCACATCAAATAACCGCAATGAGGAGGAGCAATACCTCACCCTTGTCCGTACATCACCCGATCATCCTAGTGGCAGAGCAACCATGCTCCTAAACTGGAAATTACTTGCAGTAGAGTTCTTACCTGAAGAGGATGCAGTTTTTGTGCTTCTCCTATGCATGGCAATCGCACGGACCATGACAGAAATCAGAAGAGAAGATGCGGCTGGGCTTTTGTTGCGACGAAGAATACGTGAAGCGCGGGTAGGGCAGAGAGACTGGGGTTCAGTGATGCTTCCAAACTCACCTTCCCTTGATCCCCATTTGCAGCCTTGGTATCGGAATGCATCAGATGTTTTGAGCTCTGCAGAAACGGTATCTAACGGAGTGATGCTCACCAAGTACTCACCTGCTGATGGCAAGGATGAGTTGTACAGGCAAGCTCTTAGACCTTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001990G0350 gene.
TTAAAAGGTTCCATTCCTTTGAGTACATTGTAAGTCTAAAGGATATGAAGGATTCAGGGTTGCAGGTTTGAAAGGGTTTCAGAATATGTTTGGCATTGTAGTTGCTCACTTCATTAATGAAGGTTCATCTCATGCAATTTTTCTGGGGAAAATCTCATGCATTTTAGAACAAGTGTAACTTACATTCCCTTTATGATGTCACACTGTAATAGCAGGCTCTTAATTTCACATTGAGTATAAATTAACAACCAGACCTTCCAAATCATGCTAATCAACTTCAATTTGACACCTAATTGCACAACATCATGTTCCAGAAATGAGCTACATAAGTTAAAATTTAGGTATGGACGTATAGCACAGTTTGCTCCGAAAAGAGTCATCTATGGCAAGACCTGGTTGCAATGCATAGCGCAGTTTGCTCTGAAAAGAGTCATCTATGGCAAGACCTGGTTGCAATGCATGCATTAGACGTAGCATCAAAACCCTTCTATGAGCGACTGTGATTTCTGCGTTGGGCTGTCGCTGCCGCCCCGCCCAGCCTTCATTGCCTCTATTGCCTTCTGTATCTCCAAGGTCATTGCGGTGTCTACGCTTCCCGATGATATCTTCCGGTGTGCCTTCTGCAGGTGGAGCTTCAGTGAGCTGCTGCTGAGCCCAGCATTCTTGCCACAGATGGGGCACACCTTCATTGCAGGCTTCTTGTGCTGCCATTCCATGGAGATTTTCCCGTGAAGCTTCTTGTCAAGATCCAACAAGACCTTGGCGAAGCCATCATTGGGGTGCGCACGCCGGTGCACCTTCTTCAGCATGTTCCATGCTTCTAGAAGAGTACATTTTCTGTAAGAAACATGAAACAGAGTAAATCAATGAGTCCAACAGAGTAGTAAAACGAAACATGTGGCTTTCACCCATAACTGATGAAATAAGTGGTGAGTTTTATGAGCTCGCACGCATGATTCCTTTCCCGAGTAGATGTTATCTGGATTAGCAGCTCCTAAGTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001990 Download
Protein sequence
Protein sequence
MVQSYAGLAARFASPYVSEGVYHVAARRRYVYFLDLIKKAVCTTKEHTRLVPSLDILLMWLAHQSFPVSYATDTAAMAIRDNIVKVVVGYGEVVSEEVVQRTRVLWEEAYDEPYDAAGSEVDAAAVSAAREAFYWEAAASEENANRLYKGLQPRFLMEVYVFLKGEFDSEHISKEFLRLRAQRCHRSLKLNKSMSNLSCKNWQKTWHLYCEFATRGLTIEVRRSTSGCFRNSKLLKHISFSWSDMLHEKALTLTGELDVRMRAMASITPPIQAPYLLKCVPDRVTDDGGAMISDVILRMRSYRPQEGRWLTRTVLDHGGKECFVIRIRIGRGIWRRGAETPVAVKWEDRIIEVREGSWSYIASATSVGYAPGNFSMQNNWFMSVSYLALRGEKVVGTATPTKDQQENKVVWCFSTGDVLTVRLGDDLNFLLQNESSEQEARLLVGRRLSYRINKDSTSNNRNEEEQYLTLVRTSPDHPSGRATMLLNWKLLAVEFLPEEDAVFVLLLCMAIARTMTEIRREDAAGLLLRRRIREARVGQRDWGSVMLPNSPSLDPHLQPWYRNASDVLSSAETVSNGVMLTKYSPADGKDELYRQALRP
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above