gene PH01001986G0070
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001986:47884 - 50601(- stand)   Name
Alternate name Locus tag PH01001986G0070
Length of gene 2718  bp Length of CDS 552  bp
Product information
Feature type
CDS
Product name
bZIP transcription factor domain containing protein
Alternate name
Molecular weight
(predicted)
20017.5774199999  kDa
Isoeletric point
(predicted)
8.97967147827148
Length
183  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_215826 2
Please click OG5_215826 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os06g50830.1 bZIP transcription factor domain containing protein, expressed 1E-67
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 20 40 60 80 100 120 140 160 183
Detailed signature matches
    1. PF00170 (bZIP_1)
    2. SM00338 (BRLZ)
    3. PS50217 (BZIP)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22952 (CAMP-RES...)
  2. SSF57959 (Leucine z...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213400 88 131 1.31E-05 cd12193 B_zip1 cl02576 C
superfamily 243100 88 131 1.31E-05 cl02576 B_zip1 superfamily - C
non-specific 197664 87 135 1.29E-12 smart00338 BRLZ cl02576 C
non-specific 201054 87 137 1.65E-10 pfam00170 bZIP_1 cl02576 -
non-specific 203738 87 138 5.62E-08 pfam07716 bZIP_2 cl02576 -
multi-dom 237616 113 178 0.00284097 PRK14127 PRK14127 - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001986G0070 gene.
CATGCCTAAGCACAAAAATGGAACCCCCATACTCTAACGTTGCTCCTGGCACCACCTAGTGTAGGGATCGACCCTCGCCGCAAGCGAAATCGTGGCCGCCGTCTTTTTCCCTGCTCGGCTGCCATCGAGCCAGCTCCAGCTCACTTGAGATGGCGGTGGGCCGCGTGTCTTGCTGGACCGCCGAAGCGAGCCGCCAAAGCCAGCTCGAAAGGCTTTTGGGCTTGGCAAACCCGAAACTGTGCCATTTTTCGCATGTACACTGTACATAGGCCGATTTGGAAAACCCATTACTGTTAAACCCATTAACACCTGACTCGGCCTATTACTATTTATAGAACCCGATCCAATGTTGTTTATGCAACCCGTTACTATTCCATTCGAATCCATTAGTTAATAGTACAAGCCCTGTTACTGTTTATCTCAATCCATTACTAATCATCCGAGTCCCAAAAGGGCCCACTATATCCATTTCAACCGTTTTGAGCTCGTGAAACCCATTTTCGCCTCGGTTTAACCTAACCAAGCACCCAATTAATCCCAAGCACCCACACCACCTCTCTTTGCATTTTTTTTTTCTTCCAAATTTCTTTATTTCATTTTGTTCCCGGCTCGCTCATTGTTGAGTCTAGACTTATTTATTTAATTTTTTTAAACGTTATAACCCGAATTTATTGATCAAAGTCCAGAAGAACTTTATCCAAATGCAGGAGAATTAAATTCATTCAAAGACCGCCAATGAGACGGCAAGTTACATTCTTCGATCATGTTTAGCACAAATTTCAAATATTTATTATTATTATTTTCATTTACGGTATTTATGCCAAGTACTTCTTTAAAGAAATAATACTTTAGAATGTCGTAATGAATAGTTAGTACATATCACCCCATATACAAACCCACCTATTCTATATGTTATTTAATGGTTCCCTCATTTAATTTCATGCCCAAAGTCCAAACTAACAAATATGGAGTATGGTCGATTTACGGTACTGGATACGAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCAACTACCACCACTACCAGATGGCTGTGCACTCCGCGGCGGCGGCGGCTGCTGCTGCGTGGAGGGAGCCGGACAGCCCGCAGCTGAGCATCATGAGCGGCTGCAGCTCGCTCTTCTCCATCTCCACCCTGCGGGACGACGACGACGGCGCCGTCGTCCTCGCCGGCCACGCGCTGCCCGCCACGCCGGTCTCGCTCGCCGGGTTCGCCGGCGACGAGGTAGAGATGGATGTGCGCCAGAGCGGCGGCAGCGGCGACGACCGGAGGACCATCAGGATGATGAGGAACCGGGAGTCCGCGCTACGCTCCAGGGCAAGGAAGAGGGCATACGTGGAAGAACTAGAGAAAGAGGCTCGTCGTCTGGTGGATGAGAACCTGAAGCTGAAGAAGCAGTGCAAAGAGAGCACTTGTTCTCACTGGACAGCTGAAACTGGAAGTGGCTGCACTAGTCCTGCCTACCAAGAGCTCACTGCGACGAACCTCATCAACTCAATTCTGAAGGGCCAAAGAAGCAGAAGGGTATTTGGCAGTACAAAATTAAGAGGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001986G0070 gene.
GACCAAACCGTTGCACTGCTGGAGTATTTATAGATTACATGTACATAGATTACTTGACACACAAGAAGTAATGCTTTCGTACAAGACTAGAAGATGTACATGTTAGTGATATGCTCTATAGGTAATCACATAGATTATTGTATCGCTTTTATGTTTGTGAACTTTTAAATAGTATGCTATTTGGTCCCTTGAATAAAATATCATTTATTGTTTGTGAAACTCTTTATTTATATTTACGATGCCATGCTAAACATCTCTGATCTTATGTCATTACGTGAGACACTTATGATTTATGGATCAACACTTGTACCGATTGATTATCACATTTCATGGATCATGGATATGAGATATCAAATCAATAATTTGGACATATGTTGGAGAATATAGTGTTAGATTTTCCCATCTTAAGACATTGCAAGAATTGTTATATTCTTAAATGTCATCAGTTGGTCTCATACATAATGTATGTGAGATCCTTAGATCTGAGGTCATCATGGTTTTCTACATATGTAATAGTTTACTTAGAGATTGTTAAACATTACTCCGTAAATGGGTAGTCACAAAGGTACCTTTTGGGTTTACTACGAAAATGGGTAGTCACAAAGGTACCTTTCGGGTTTACTACGAAACACGCAAAGGAATGTGAGCGATTAAGATGGATTTTGCCCCTCCTATTTAACGGGAGAGATATTTCTGGCCCCTCGATGTGGTTGGAATAAGAAAATGTATGGTCATACCGAATATGGTTGAGGAGCCAACTACAGCTAAGTAATCCATTGCAATATCGAGTGAAGGATCGAGCTATCATAGGATGGCATGCATCTCATCTTGAGTTCGATCTGGTATCATGAGGCAAAAAGATCAGCAGATGAGCTTTATAAAGGTTCGTTCGATATAATCTTTATGTGTATTCAGGAATTGCTATTTCTTGCTAGGAACCGCTACCGACTTGTGGATCAAAAATGAGTTTCCGGGTCACGACAGATTATGCATGAACATAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001986 Download
Protein sequence
Protein sequence
MANYHHYQMAVHSAAAAAAAAWREPDSPQLSIMSGCSSLFSISTLRDDDDGAVVLAGHALPATPVSLAGFAGDEVEMDVRQSGGSGDDRRTIRMMRNRESALRSRARKRAYVEELEKEARRLVDENLKLKKQCKESTCSHWTAETGSGCTSPAYQELTATNLINSILKGQRSRRVFGSTKLRG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above