gene PH01001892G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001892:309 - 6708(- stand)   Name
Alternate name Locus tag PH01001892G0010
Length of gene 6400  bp Length of CDS 2343  bp
Product information
Feature type
CDS
Product name
START domain containing protein
Alternate name
Molecular weight
(predicted)
85551.2696200003  kDa
Isoeletric point
(predicted)
5.93645095825195
Length
781  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_137066 9
Please click OG5_137066 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G52150.3
Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein
Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation.
ATHB-15; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Lipid-binding START (InterPro:IPR002913), MEKHLA (InterPro:IPR013978), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein m
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g43930.2 START domain containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 600 700 781
Detailed signature matches
    1. SSF46689 (Homeodoma...)
    1. PS50071 (HOMEOBOX_2)
    2. PF00046 (Homeobox)
    3. SM00389 (HOX)
    1. SM00234 (START)
    2. PF01852 (START)
    3. PS50848 (START)
    1. PF08670 (MEKHLA)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24326 (FAMILY N...)
  2. SSF55961 (Bet v1-like)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 176884 145 359 1.84E-71 cd08875 START_ArGLABRA2_like cl14643 -
superfamily 246681 145 359 1.84E-71 cl14643 SRPBCC superfamily - -
specific 238039 5 65 1.33E-15 cd00086 homeodomain cl00084 -
superfamily 241599 5 65 1.33E-15 cl00084 homeodomain superfamily - -
non-specific 216740 150 359 7.56E-51 pfam01852 START cl14643 -
non-specific 214575 151 359 5.62E-38 smart00234 START cl14643 -
non-specific 176851 188 355 1.68E-17 cd00177 START cl14643 -
non-specific 200956 5 63 1.72E-16 pfam00046 Homeobox cl00084 -
non-specific 197696 5 62 2.58E-15 smart00389 HOX cl00084 -
specific 197664 57 111 4.79E-05 smart00338 BRLZ cl02576 N
superfamily 243100 57 111 4.79E-05 cl02576 B_zip1 superfamily - N
non-specific 201054 57 102 5.02E-05 pfam00170 bZIP_1 cl02576 N
non-specific 176877 198 329 0.000887891 cd08868 START_STARD1_3_like cl14643 N
non-specific 176883 201 355 0.00128029 cd08874 START_STARD9-like cl14643 N
non-specific 176878 213 320 0.00941482 cd08869 START_RhoGAP cl14643 N
multi-dom 219964 681 781 4.18E-45 pfam08670 MEKHLA - C
multi-dom 227863 4 100 3.88E-10 COG5576 COG5576 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative lipid binding site M173,P174,S182,A197,A199,V210,L214,P218,L221,R222,D223,C224,Q247,Y249,A250,P251,T252,A255,R258,F260,L262,E278,G299,M301,L302,P303,S304,F306,I318,V320,D322,M324,L326,P328,R336,L338,Y339,E340,S342,A343,M344,Q347,K348,M351 44 44 176884
specific specific DNA base contacts K5,R8,V52,Q55,N56,C59 6 6 238039
specific DNA binding site K5,Y6,V7,Y9,K26,R32,Q49,K51,V52,Q55,N56,R58,C59,R60,K62,Q63 18 16 238039
 
DNA sequence
Upstream 1000 bp region from PH01001892G0010 gene.
GCTTTCTCGTACGACACCGCCCTGCCGACGCTCGACACGCACAGCCCGCCCGGGATGCAGGCGAATCCCTGCCAATGAACAACACGCCAAAACATAGTTAGACATTATTCAAATTAAACTGCATATGTATGCTGTCTGTTTCACTACATTACAAATGGAAATCGATGCTGCCATGTTATCTTTATGTAATAGTCTAGTCTATTTTTTGTTCAAACATAGCAATCAGGATTAATCCTGAATTCCTTTGGGTGATATACCGAGAAAGACATGCAGTTTCAGTCTGCGTGTGGTACTGAAGAAACACGTAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGACGCGAGCAAGTACGTGCGGTACACGCCGGAGCAGGTGGAGGCGCTGGAGCGGCTCTACTACGAGTGCCCTAAGCCGAGCTCGCTGCGCCGGCAGCAGCTCGTCCGCGACTGCCTCGTACTCGCCAACGTCGACCCCAAGCAGATCAAGGTCTGGTTCCAGAACCGCAGGTGCCGGGAGAAGCAGCGCAAGGAGTCGTCGCGGCTGCAGGCGCTCAACCGCAAGCTCACGGCCATGAACAAGCTGCTCATGGAGGAGAACGACCGCCTGCAGAAGCAGGTCTCCCAGCTCGTCTACGAGAACGGCTACTACCGGCAGCAGACGCATAGCACGGGGCTGGCGACGACGGACACGAGCTGCGAGTCGGTCGTCACGAGCGGCCAGCAGAACGTCGTGGCGCCGCCGCAGCCTCAGCCACGCGACGCGAGCCCTGCTGGATTGATGTCTATCGCCGAGGAGACATTGACGGTGTTTCTGTCCAAGGCCACCGGAACGACCGTCGAGTGGGTCCAAATGCCTGGGATGAAGCCTGGTCCGGATTCCATTGGAATCATTGCCATCTCGCATGGCTGCGCTGGTGTCGCTGCGCGAGCTTGCGGCCTCGTAGGCATGGAGCCTGCAAAAGTTGCCGAAATCCTCAAGGATCGGCCATTGTGGCTGCGCGATTGCCGGTCCATGGAAGTGGTGAATGTGCTGCCTGCTGGCAGCAACGGCACGATTGAGCTGCTCTACATGCAGCTCTACGCTCCGACGACACTGGCGCCAGCTCGCGACTTCTGGTTGCTGCGGTACACCTCCATTCTTGACGATGGAAGTTTAGTGGTATGTGAAAGATCTCTCAGTAGCAAGCAAGGAGGCCCAAGCATGCCTCTTGTCCAGCCTTTTATCAGGGGCGAGATGCTTCCTAGTGGGTTCTTGATCCGGCCTAGTGATGGTGGAGGCTCTGTCATACACGTCGTTGATCATATGGACTTGGAGCCTTGGAGCGTGCCTGAAGTTGTGAGGCCGCTGTATGAGTCTTCTGCCATGGTTGCCCAGAAGATGTCAATGGCGGCTTTGCGCTATCTCAGGCAGGTTGCTCACGAAGATACTCATTCTATAATCACCGGATGGGGAAGGCAGCCTTCAGCTTTGCGGGCTCTGAGCCAAAAGCTCACCAGAGGTTTCAATGAAGCTCTCAACGGGCTTGCTGATGATGGATGGTCCGTGATTGAGAGCGACGGAGTGGACGATGTTTGCATCTCTGTTAACTCATCCCCAAGTAAAGTGATCGGTTGCAATGCAACATTCAGTGATGGACTTCCCATAGTCAGTACCGGTGTTCTTTGTGCGAAGGTGTCGATGCTGTTGCAGGATGTTTCTCCACCTTCGCTCCTGCGATTTTTGCGGGAACACCGCTCACAGTGGGCTGACAGTAACTTGGATGCATTCTTTGCTTCCGCGATGAAACCTAATTTCTGCAATTTACCTATGTCTCGTCTTGGAGGATTTAGTGGTCAGGTCATACTTCCTTTAGCACACACATTTGACCCTGAAGAATTCCTGGAAGTTATCAAGTTAGGAAATGCTAGTAACTATCAAGATACACTCATGCATCGCGATCTATTTCTCTTGCAGATGTACAATGGAGTAAACGAGAACACTGTAGGCACTTGTTCAGAGCTTATATTTGCACCAATAGATGCATCGTTCAGTGATGATTCTCCACTGCTGCCGTCTGGTTTCCGCATCATTCCAATCGATTCTCCTGTTGACACATCTAGTCCGAATTGCACGTTGGACCTTGCATCTACACTTGAAGTCGGAACACCCCGAAGCAGGATAGGTGGTGGTTCTGGGAATGGTACCTGTGCTAATTCGAAGGCTGTGATGACAATTGCATTTCAGTTTGCTTTTGAGAGCCACCTGCAAGATAACGTTGCAGCCATGGCACGGCAGTATATGCGCAGCATCATCTCATCTGTTCAAAGAATAGCCCTGGCGCTCTCGTCTTCGCATCTCGTTTCTCGTGGCGGCATTCCTCTCGCACCTGTTAGTCCAGAGGCAGCCACACTCTCCAGATGGATTTGTCAGAGTTACAGATTTCATTTTGGGGCTGAACTTATCAAATCTGCAGATACCAACGGCAGTCAATCGGTCCTTAAAGCCCTTTGGCATCATTCGAGCGCTATACTCTGCTGCCTTCCGAAGGCCATGCCAGTGTTCACATTCGCAAACCAGTCTGGCCTGGACATGCTTGAAACAACTCTAGTAGCACTCCAGGATATAACTCTGGAGAAAGTCTTCGACGATCAAGGGAGGAAGAACCTATGTACAGAGCTCCCCAGCATCATGGAGCAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001892G0010 gene.
GGTTTGGTTGCACATTTCGCCTTTTTTTTTATAAGAAGCAATTCAATTTCATATGAGAATACAATTCTTTTGTACAGTATGGTTTATTGTTTATCTCAAAGTGACATCTCCTGGCCCCTAAGAAAACTTTTAAGGAGCTTAGCTTGTTTAGCACAACCCTTACTAAGCTGTGTTTTCCCCCTTTCTTGATATTTCCAGAATCTGACTAAAACGTAGCAGTACACATTGCTGCTTGAATTTTAATTCAAATGAATTGACACTGCAAGCTTATTTAGTATTTTCCACCTGTATAGCCTTGCAATGATACCGTATTAATACGGATACATCATACATGGTCGACCGAACCAGAAAGGGAGGTTGCAGGCTAGCAGCTTGATGACAGCTGCAAGCCAACCCACTATTGAATACTGGTCCACATGGCACTTGTCCAGACCACACTTTCTCTCATATCAAAACTCAAAGAGATACTACTCCATTTTTTCCCCTCTGAGGAGGAGCTTTTTTATTTTTTAATCTATTTTTTAAAAATATTTTAAAGATAATCTCTCCTTAACTTTATTTTCAATTCTAACCATTTTAATCACACTATGACCCATAGTATAACTAAACTATGCTATCACGTCACCGACCACGGCATGGCCGAATTTGTCACGATAGCTCTCCGAGTTAACGTGCGTCCGTTTTTAGGTTAAGTCCTATCATACCAAGAGGAGTAGCGTGACAACACTTGTTTGCCATGCCGAGATCCATGGCTAAACAACGTGCTTTTGCCATACCACGCGTTGTGACGTGACCAAAGAGGTCAGAATTGGAAATAAAGTTAGGGAGATGCTATCTTTAAAATATTTTTAAAAAATGGATTAAATAAAAAAAGTTTGACGAGAAGAGATACTCTGTGTTGCAAACATAAGAAAATGAAAAGATGGCCAAAGCTCAAAAGCTAGAGCTTGTCCTATCCCACTGCCAACCACTTACCTGGGTCTGACGTGTCATGGCCTAGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001892 Download
Protein sequence
Protein sequence
MDASKYVRYTPEQVEALERLYYECPKPSSLRRQQLVRDCLVLANVDPKQIKVWFQNRRCREKQRKESSRLQALNRKLTAMNKLLMEENDRLQKQVSQLVYENGYYRQQTHSTGLATTDTSCESVVTSGQQNVVAPPQPQPRDASPAGLMSIAEETLTVFLSKATGTTVEWVQMPGMKPGPDSIGIIAISHGCAGVAARACGLVGMEPAKVAEILKDRPLWLRDCRSMEVVNVLPAGSNGTIELLYMQLYAPTTLAPARDFWLLRYTSILDDGSLVVCERSLSSKQGGPSMPLVQPFIRGEMLPSGFLIRPSDGGGSVIHVVDHMDLEPWSVPEVVRPLYESSAMVAQKMSMAALRYLRQVAHEDTHSIITGWGRQPSALRALSQKLTRGFNEALNGLADDGWSVIESDGVDDVCISVNSSPSKVIGCNATFSDGLPIVSTGVLCAKVSMLLQDVSPPSLLRFLREHRSQWADSNLDAFFASAMKPNFCNLPMSRLGGFSGQVILPLAHTFDPEEFLEVIKLGNASNYQDTLMHRDLFLLQMYNGVNENTVGTCSELIFAPIDASFSDDSPLLPSGFRIIPIDSPVDTSSPNCTLDLASTLEVGTPRSRIGGGSGNGTCANSKAVMTIAFQFAFESHLQDNVAAMARQYMRSIISSVQRIALALSSSHLVSRGGIPLAPVSPEAATLSRWICQSYRFHFGAELIKSADTNGSQSVLKALWHHSSAILCCLPKAMPVFTFANQSGLDMLETTLVALQDITLEKVFDDQGRKNLCTELPSIMEQ
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above