gene PH01001863G0110
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001863:71406 - 75393(- stand)   Name
Alternate name Locus tag PH01001863G0110
Length of gene 3988  bp Length of CDS 2496  bp
Product information
Feature type
CDS
Product name
BRASSINOSTEROID INSENSITIVE 1 precursor
Alternate name
Molecular weight
(predicted)
89363.4221200001  kDa
Isoeletric point
(predicted)
5.84160232543945
Length
831  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_156588 2
Please click OG5_156588 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G24230.1
Leucine-rich repeat protein kinase family protein
Leucine-rich repeat protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylat
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os08g17410.1 BRASSINOSTEROID INSENSITIVE 1 precursor, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 100 200 300 400 500 600 700 831
Detailed signature matches
    1. SSF56112 (Protein k...)
    1. PS50011 (PROTEIN_KI...)
    1. PF07714 (Pkinase_Tyr)
    1. SM00369 (LRR_TYP)
    1. PF00560 (LRR_1)
    2. PS51450 (LRR)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PF13504 (LRR_7)
  2. PR00019 (LEURICHRPT)
  3. PTHR24420 (FAMILY N...)
  4. SSF52058 (L domain-...)
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0005515 protein binding
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173623 528 743 1.43E-32 cd00180 PKc cl09925 -
superfamily 245201 528 743 1.43E-32 cl09925 PKc_like superfamily - -
non-specific 173624 528 821 2.25E-31 cd00192 PTKc cl09925 -
non-specific 132954 520 750 1.07E-21 cd06623 PKc_MAPKK_plant_like cl09925 C
non-specific 173659 522 773 4.58E-21 cd05122 PKc_STE cl09925 -
non-specific 173724 521 752 8.73E-21 cd06606 STKc_MAPKKK cl09925 C
non-specific 133179 528 749 2.65E-20 cd05048 PTKc_Ror cl09925 C
non-specific 173731 521 752 5.72E-20 cd06627 STKc_Cdc7_like cl09925 C
non-specific 133180 528 749 1.02E-19 cd05049 PTKc_Trk cl09925 C
non-specific 173631 521 816 7.89E-19 cd05045 PTKc_RET cl09925 -
non-specific 173626 528 755 1.66E-17 cd05034 PTKc_Src_like cl09925 C
non-specific 173637 528 820 1.93E-17 cd05059 PTKc_Tec_like cl09925 -
non-specific 173657 528 818 2.12E-17 cd05113 PTKc_Btk_Bmx cl09925 -
non-specific 133248 528 749 2.29E-17 cd05148 PTKc_Srm_Brk cl09925 C
non-specific 132963 524 816 4.97E-17 cd06632 STKc_MEKK1_plant cl09925 -
non-specific 133165 528 752 1.74E-16 cd05033 PTKc_EphR cl09925 C
non-specific 133171 523 755 3.34E-16 cd05039 PTKc_Csk_like cl09925 C
non-specific 173628 528 745 1.48E-15 cd05038 PTKc_Jak_rpt2 cl09925 C
non-specific 173771 528 749 1.52E-15 cd08529 STKc_FA2-like cl09925 C
non-specific 133199 528 755 3.81E-15 cd05068 PTKc_Frk_like cl09925 C
non-specific 173636 520 749 4.24E-15 cd05057 PTKc_EGFR_like cl09925 C
non-specific 133243 528 779 1.09E-14 cd05112 PTKc_Itk cl09925 -
non-specific 132957 524 749 2.16E-14 cd06626 STKc_MEKK4 cl09925 C
non-specific 133178 520 822 4.40E-14 cd05046 PTK_CCK4 cl09925 -
non-specific 132956 521 752 5.30E-14 cd06625 STKc_MEKK3_like cl09925 C
non-specific 133194 520 752 6.37E-14 cd05063 PTKc_EphR_A2 cl09925 C
non-specific 173649 528 749 8.09E-14 cd05093 PTKc_TrkB cl09925 C
non-specific 173732 524 756 8.48E-14 cd06628 STKc_MAPKKK_Byr2_like cl09925 C
non-specific 173755 521 749 1.05E-13 cd08215 STKc_Nek cl09925 C
non-specific 173723 528 753 1.40E-13 cd06605 PKc_MAPKK cl09925 C
non-specific 173658 528 817 1.91E-13 cd05114 PTKc_Tec_Rlk cl09925 -
non-specific 173640 528 822 2.15E-13 cd05067 PTKc_Lck_Blk cl09925 -
non-specific 173672 520 749 2.24E-13 cd05581 STKc_PDK1 cl09925 C
non-specific 132991 520 753 2.39E-13 cd06917 STKc_NAK1_like cl09925 C
non-specific 173648 528 749 2.77E-13 cd05092 PTKc_TrkA cl09925 C
non-specific 173638 527 752 3.35E-13 cd05065 PTKc_EphR_B cl09925 C
non-specific 132962 524 750 3.46E-13 cd06631 STKc_YSK4 cl09925 C
non-specific 173634 525 817 5.68E-13 cd05053 PTKc_FGFR cl09925 -
non-specific 133191 528 752 5.89E-13 cd05060 PTKc_Syk_like cl09925 C
non-specific 173726 530 758 6.05E-13 cd06610 STKc_OSR1_SPAK cl09925 C
non-specific 173641 528 822 7.59E-13 cd05072 PTKc_Lyn cl09925 -
non-specific 173650 528 749 2.15E-12 cd05094 PTKc_TrkC cl09925 C
non-specific 133201 528 755 2.24E-12 cd05070 PTKc_Fyn_Yrk cl09925 C
non-specific 173639 527 749 3.67E-12 cd05066 PTKc_EphR_A cl09925 C
non-specific 133200 528 822 7.07E-12 cd05069 PTKc_Yes cl09925 -
non-specific 173670 531 757 1.10E-11 cd05579 STKc_MAST_like cl09925 C
non-specific 133212 527 811 1.68E-11 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 -
non-specific 133181 528 749 1.79E-11 cd05050 PTKc_Musk cl09925 -
non-specific 133220 527 745 1.89E-11 cd05089 PTKc_Tie1 cl09925 C
non-specific 132979 574 757 1.98E-11 cd06648 STKc_PAK_II cl09925 NC
non-specific 133202 528 822 2.63E-11 cd05071 PTKc_Src cl09925 -
non-specific 132951 528 752 2.63E-11 cd06620 PKc_MAPKK_Byr1_like cl09925 C
non-specific 133167 525 823 3.55E-11 cd05035 PTKc_Axl_like cl09925 -
non-specific 173761 562 817 4.40E-11 cd08221 STKc_Nek9 cl09925 -
non-specific 88330 527 745 5.09E-11 cd05047 PTKc_Tie cl09925 C
non-specific 132949 650 749 5.71E-11 cd06618 PKc_MKK7 cl09925 NC
non-specific 173772 521 749 6.32E-11 cd08530 STKc_CNK2-like cl09925 C
non-specific 132960 524 753 6.39E-11 cd06629 STKc_MAPKKK_Bck1_like cl09925 C
non-specific 173629 527 816 8.36E-11 cd05041 PTKc_Fes_like cl09925 -
non-specific 173733 522 757 8.79E-11 cd07829 STKc_CDK_like cl09925 C
non-specific 173630 527 768 8.90E-11 cd05044 PTKc_c-ros cl09925 -
non-specific 132952 528 763 9.20E-11 cd06621 PKc_MAPKK_Pek1_like cl09925 C
non-specific 173757 566 749 9.64E-11 cd08217 STKc_Nek2 cl09925 C
non-specific 173633 528 755 1.10E-10 cd05052 PTKc_Abl cl09925 C
non-specific 173760 521 748 1.22E-10 cd08220 STKc_Nek8 cl09925 C
non-specific 173654 520 763 1.24E-10 cd05108 PTKc_EGFR cl09925 C
non-specific 173625 528 822 1.68E-10 cd05032 PTKc_InsR_like cl09925 -
non-specific 173702 670 781 1.74E-10 cd05611 STKc_Rim15_like cl09925 N
non-specific 173642 525 767 1.96E-10 cd05075 PTKc_Axl cl09925 -
non-specific 133172 527 749 2.05E-10 cd05040 PTKc_Ack_like cl09925 C
non-specific 133214 525 755 2.36E-10 cd05083 PTKc_Chk cl09925 C
non-specific 132942 528 755 2.84E-10 cd06611 STKc_SLK_like cl09925 C
non-specific 143333 528 757 4.66E-10 cd05118 STKc_CMGC cl09925 C
non-specific 173729 650 749 5.00E-10 cd06617 PKc_MKK3_6 cl09925 NC
non-specific 173728 519 822 5.63E-10 cd06614 STKc_PAK cl09925 -
non-specific 133232 525 817 7.58E-10 cd05101 PTKc_FGFR2 cl09925 -
non-specific 173660 548 749 8.05E-10 cd05123 STKc_AGC cl09925 C
non-specific 132982 521 749 8.10E-10 cd06651 STKc_MEKK3 cl09925 C
non-specific 143338 527 757 1.00E-09 cd07833 STKc_CDKL cl09925 C
non-specific 133228 528 745 1.05E-09 cd05097 PTKc_DDR_like cl09925 C
non-specific 173769 520 753 1.24E-09 cd08229 STKc_Nek7 cl09925 C
non-specific 132961 521 753 1.40E-09 cd06630 STKc_MEKK1 cl09925 C
non-specific 133246 528 749 1.52E-09 cd05115 PTKc_Zap-70 cl09925 C
non-specific 133216 527 742 2.03E-09 cd05085 PTKc_Fer cl09925 C
non-specific 173632 521 757 2.17E-09 cd05051 PTKc_DDR cl09925 -
non-specific 132987 522 755 3.29E-09 cd06656 STKc_PAK3 cl09925 C
non-specific 173655 520 749 3.57E-09 cd05110 PTKc_HER4 cl09925 C
non-specific 133186 521 822 4.24E-09 cd05055 PTKc_PDGFR cl09925 -
non-specific 173627 528 759 5.21E-09 cd05037 PTK_Jak_rpt1 cl09925 -
non-specific 133189 527 756 5.73E-09 cd05058 PTKc_Met_Ron cl09925 C
non-specific 132985 522 755 6.72E-09 cd06654 STKc_PAK1 cl09925 C
non-specific 133168 521 757 6.80E-09 cd05036 PTKc_ALK_LTK cl09925 -
non-specific 173647 528 749 7.36E-09 cd05091 PTKc_Ror2 cl09925 C
non-specific 133229 525 817 7.72E-09 cd05098 PTKc_FGFR1 cl09925 -
non-specific 132947 650 755 7.75E-09 cd06616 PKc_MKK4 cl09925 NC
non-specific 132943 522 755 8.14E-09 cd06612 STKc_MST1_2 cl09925 C
non-specific 173765 521 750 8.86E-09 cd08225 STKc_Nek5 cl09925 C
non-specific 133240 527 749 1.02E-08 cd05109 PTKc_HER2 cl09925 C
non-specific 173768 520 753 1.42E-08 cd08228 STKc_Nek6 cl09925 C
non-specific 132986 544 755 1.63E-08 cd06655 STKc_PAK2 cl09925 C
non-specific 132989 575 757 1.63E-08 cd06658 STKc_PAK5 cl09925 NC
non-specific 133227 547 744 1.64E-08 cd05096 PTKc_DDR1 cl09925 C
non-specific 132984 521 749 1.85E-08 cd06653 STKc_MEKK3_like_1 cl09925 C
non-specific 132973 522 755 2.17E-08 cd06642 STKc_STK25-YSK1 cl09925 C
non-specific 173759 556 750 2.71E-08 cd08219 STKc_Nek3 cl09925 C
non-specific 133221 528 749 3.02E-08 cd05090 PTKc_Ror1 cl09925 C
non-specific 173725 522 756 3.45E-08 cd06608 STKc_myosinIII_like cl09925 -
non-specific 133219 527 745 4.59E-08 cd05088 PTKc_Tie2 cl09925 C
non-specific 143346 521 757 5.76E-08 cd07841 STKc_CDK7 cl09925 C
non-specific 132980 650 759 6.17E-08 cd06649 PKc_MEK2 cl09925 NC
non-specific 132971 522 755 6.66E-08 cd06640 STKc_MST4 cl09925 C
non-specific 132953 528 816 7.52E-08 cd06622 PKc_MAPKK_PBS2_like cl09925 -
non-specific 133175 527 749 7.70E-08 cd05043 PTK_Ryk cl09925 C
non-specific 132983 520 749 8.13E-08 cd06652 STKc_MEKK2 cl09925 C
non-specific 173744 522 759 8.22E-08 cd07847 STKc_CDKL1_4 cl09925 C
non-specific 133247 528 749 9.92E-08 cd05116 PTKc_Syk cl09925 C
non-specific 133204 528 822 9.98E-08 cd05073 PTKc_Hck cl09925 -
non-specific 173742 520 750 1.02E-07 cd07845 STKc_CDK10 cl09925 C
non-specific 132972 522 755 1.17E-07 cd06641 STKc_MST3 cl09925 C
non-specific 143371 518 747 1.18E-07 cd07866 STKc_BUR1 cl09925 C
non-specific 173669 658 773 1.32E-07 cd05578 STKc_Yank1 cl09925 N
non-specific 173656 519 749 1.51E-07 cd05111 PTK_HER3 cl09925 C
non-specific 132978 574 755 1.82E-07 cd06647 STKc_PAK_I cl09925 NC
non-specific 132990 544 757 1.86E-07 cd06659 STKc_PAK6 cl09925 C
non-specific 133205 522 823 1.92E-07 cd05074 PTKc_Tyro3 cl09925 -
non-specific 173730 519 749 2.19E-07 cd06624 STKc_ASK cl09925 C
non-specific 173644 528 745 2.20E-07 cd05079 PTKc_Jak1_rpt2 cl09925 C
non-specific 143354 520 757 2.78E-07 cd07849 STKc_ERK1_2_like cl09925 C
non-specific 173764 519 753 3.01E-07 cd08224 STKc_Nek6_Nek7 cl09925 C
non-specific 143361 544 750 3.23E-07 cd07856 STKc_Sty1_Hog1 cl09925 C
non-specific 132988 574 815 3.42E-07 cd06657 STKc_PAK4 cl09925 N
non-specific 132968 657 755 3.53E-07 cd06637 STKc_TNIK cl09925 N
non-specific 132964 528 750 4.35E-07 cd06633 STKc_TAO3 cl09925 C
non-specific 132966 528 750 4.80E-07 cd06635 STKc_TAO1 cl09925 C
non-specific 132967 657 755 4.86E-07 cd06636 STKc_MAP4K4_6 cl09925 N
non-specific 173651 528 745 5.05E-07 cd05095 PTKc_DDR2 cl09925 C
non-specific 238064 84 268 5.10E-07 cd00116 LRR_RI cl15309 N
superfamily 246925 84 268 5.10E-07 cl15309 LRR_RI superfamily - N
non-specific 132946 650 759 5.43E-07 cd06615 PKc_MEK cl09925 NC
non-specific 173758 561 747 7.64E-07 cd08218 STKc_Nek1 cl09925 C
non-specific 173664 520 765 1.23E-06 cd05573 STKc_ROCK_NDR_like cl09925 C
non-specific 173727 528 755 1.27E-06 cd06613 STKc_MAP4K3_like cl09925 C
non-specific 132975 528 749 1.30E-06 cd06644 STKc_STK10_LOK cl09925 C
non-specific 173691 670 765 1.31E-06 cd05600 STKc_Sid2p_Dbf2p cl09925 NC
non-specific 173663 658 759 1.65E-06 cd05572 STKc_cGK_PKG cl09925 NC
non-specific 132970 519 755 2.12E-06 cd06639 STKc_myosinIIIB cl09925 -
non-specific 143345 530 750 2.12E-06 cd07840 STKc_CDK9_like cl09925 C
non-specific 132981 650 763 2.14E-06 cd06650 PKc_MEK1 cl09925 NC
non-specific 133211 528 823 2.73E-06 cd05080 PTKc_Tyk2_rpt2 cl09925 -
non-specific 238064 186 391 2.99E-06 cd00116 LRR_RI cl15309 -
superfamily 246925 186 391 2.99E-06 cl15309 LRR_RI superfamily - -
non-specific 173673 655 775 3.01E-06 cd05582 STKc_RSK_N cl09925 NC
non-specific 143356 657 757 4.32E-06 cd07851 STKc_p38 cl09925 NC
non-specific 132965 528 750 4.56E-06 cd06634 STKc_TAO2 cl09925 C
non-specific 173766 635 752 5.13E-06 cd08226 PK_STRAD_beta cl09925 NC
non-specific 173709 527 750 5.32E-06 cd05619 STKc_nPKC_theta cl09925 C
non-specific 133187 525 749 5.47E-06 cd05056 PTKc_FAK cl09925 C
non-specific 143364 544 750 6.04E-06 cd07859 STKc_TDY_MAPK_plant cl09925 C
non-specific 238064 85 381 7.19E-06 cd00116 LRR_RI cl15309 -
non-specific 132969 651 755 9.96E-06 cd06638 STKc_myosinIIIA cl09925 N
non-specific 133213 528 755 1.18E-05 cd05082 PTKc_Csk cl09925 C
non-specific 173707 650 771 1.27E-05 cd05616 STKc_cPKC_beta cl09925 NC
non-specific 143383 657 757 1.39E-05 cd07878 STKc_p38beta_MAPK11 cl09925 NC
non-specific 133233 525 823 1.49E-05 cd05102 PTKc_VEGFR3 cl09925 -
non-specific 173756 572 752 1.63E-05 cd08216 PK_STRAD cl09925 C
non-specific 173706 650 771 1.86E-05 cd05615 STKc_cPKC_alpha cl09925 NC
non-specific 173682 527 762 1.92E-05 cd05591 STKc_nPKC_epsilon cl09925 C
non-specific 173683 658 764 1.99E-05 cd05592 STKc_nPKC_theta_delta cl09925 NC
non-specific 173747 657 750 2.05E-05 cd07852 STKc_MAPK15 cl09925 NC
non-specific 132950 528 755 2.18E-05 cd06619 PKc_MKK5 cl09925 C
non-specific 173661 527 749 2.55E-05 cd05570 STKc_PKC cl09925 C
non-specific 132974 528 749 2.71E-05 cd06643 STKc_SLK cl09925 C
non-specific 133193 528 745 2.71E-05 cd05062 PTKc_IGF-1R cl09925 C
non-specific 173674 658 761 3.00E-05 cd05583 STKc_MSK_N cl09925 NC
non-specific 143368 531 757 3.87E-05 cd07863 STKc_CDK4 cl09925 C
non-specific 173676 670 753 3.89E-05 cd05585 STKc_YPK1_like cl09925 NC
non-specific 173671 520 757 4.00E-05 cd05580 STKc_PKA cl09925 C
non-specific 173713 671 753 4.08E-05 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 173703 520 756 4.71E-05 cd05612 STKc_PRKX_like cl09925 C
non-specific 88519 658 757 5.46E-05 cd05618 STKc_aPKC_iota cl09925 NC
non-specific 173763 552 747 5.72E-05 cd08223 STKc_Nek4 cl09925 C
non-specific 173699 655 750 6.96E-05 cd05608 STKc_GRK1 cl09925 NC
non-specific 173749 544 757 7.08E-05 cd07855 STKc_ERK5 cl09925 C
non-specific 143376 528 747 8.31E-05 cd07871 STKc_PCTAIRE3 cl09925 C
non-specific 173668 670 749 0.000101632 cd05577 STKc_GRK cl09925 NC
non-specific 133192 528 822 0.000112976 cd05061 PTKc_InsR cl09925 -
non-specific 173684 527 753 0.000133694 cd05593 STKc_PKB_gamma cl09925 C
non-specific 173687 671 753 0.000142884 cd05596 STKc_ROCK cl09925 NC
non-specific 173666 656 749 0.000153441 cd05575 STKc_SGK cl09925 NC
non-specific 132938 531 750 0.000178713 cd06607 STKc_TAO cl09925 C
non-specific 88524 671 753 0.000193597 cd05623 STKc_MRCK_alpha cl09925 NC
non-specific 173688 671 749 0.000196611 cd05597 STKc_DMPK_like cl09925 NC
non-specific 173677 658 750 0.000223798 cd05586 STKc_Sck1_like cl09925 NC
non-specific 173737 657 757 0.000269057 cd07834 STKc_MAPK cl09925 NC
non-specific 173708 658 750 0.000311267 cd05617 STKc_aPKC_zeta cl09925 NC
non-specific 173711 670 750 0.000311839 cd05621 STKc_ROCK2 cl09925 NC
non-specific 173705 670 761 0.00033699 cd05614 STKc_MSK2_N cl09925 NC
non-specific 173675 527 753 0.000337678 cd05584 STKc_p70S6K cl09925 C
non-specific 143382 657 757 0.0003591 cd07877 STKc_p38alpha_MAPK14 cl09925 NC
non-specific 173767 651 752 0.00037027 cd08227 PK_STRAD_alpha cl09925 NC
non-specific 173692 671 767 0.000426085 cd05601 STKc_CRIK cl09925 NC
non-specific 173680 528 764 0.000481407 cd05589 STKc_PKN cl09925 C
non-specific 173679 658 757 0.000496952 cd05588 STKc_aPKC cl09925 NC
non-specific 173753 522 750 0.000524801 cd07864 STKc_CDK12 cl09925 C
non-specific 173762 563 743 0.000573401 cd08222 STKc_Nek11 cl09925 C
non-specific 173695 656 750 0.000578758 cd05604 STKc_SGK3 cl09925 NC
non-specific 143367 528 757 0.000642111 cd07862 STKc_CDK6 cl09925 C
non-specific 132976 528 755 0.000671092 cd06645 STKc_MAP4K3 cl09925 C
non-specific 173678 650 759 0.000678122 cd05587 STKc_cPKC cl09925 NC
non-specific 173719 669 750 0.000705756 cd05630 STKc_GRK6 cl09925 NC
non-specific 173710 659 760 0.000737916 cd05620 STKc_nPKC_delta cl09925 NC
non-specific 173712 651 750 0.000884482 cd05622 STKc_ROCK1 cl09925 NC
non-specific 173662 658 749 0.000899383 cd05571 STKc_PKB cl09925 NC
non-specific 173704 670 773 0.000978419 cd05613 STKc_MSK1_N cl09925 NC
non-specific 133195 527 752 0.00100305 cd05064 PTKc_EphR_A10 cl09925 C
non-specific 173770 658 822 0.0010225 cd08528 STKc_Nek10 cl09925 N
non-specific 143380 670 757 0.00116527 cd07875 STKc_JNK1 cl09925 NC
non-specific 173681 658 764 0.00120304 cd05590 STKc_nPKC_eta cl09925 NC
non-specific 173700 658 757 0.00169597 cd05609 STKc_MAST cl09925 NC
non-specific 173720 669 810 0.00171886 cd05631 STKc_GRK4 cl09925 N
non-specific 143363 657 757 0.00184638 cd07858 STKc_TEY_MAPK_plant cl09925 NC
non-specific 173721 655 750 0.00197174 cd05632 STKc_GRK5 cl09925 NC
non-specific 143378 528 750 0.00198653 cd07873 STKc_PCTAIRE1 cl09925 C
non-specific 173722 670 750 0.00200772 cd05633 STKc_GRK3 cl09925 NC
non-specific 143377 528 750 0.00205009 cd07872 STKc_PCTAIRE2 cl09925 C
non-specific 173693 656 750 0.00234065 cd05602 STKc_SGK1 cl09925 NC
non-specific 132977 657 755 0.00240717 cd06646 STKc_MAP4K5 cl09925 NC
non-specific 133235 656 821 0.00274063 cd05104 PTKc_Kit cl09925 N
non-specific 173697 655 749 0.00352846 cd05606 STKc_beta_ARK cl09925 NC
non-specific 173745 565 759 0.00364892 cd07848 STKc_CDKL5 cl09925 C
non-specific 173696 655 749 0.00366325 cd05605 STKc_GRK4_like cl09925 NC
non-specific 173698 670 752 0.00383223 cd05607 STKc_GRK7 cl09925 NC
non-specific 143385 657 757 0.00454122 cd07880 STKc_p38gamma_MAPK12 cl09925 NC
non-specific 173686 658 750 0.00458037 cd05595 STKc_PKB_beta cl09925 NC
non-specific 173746 670 757 0.00540826 cd07850 STKc_JNK cl09925 NC
non-specific 173741 521 750 0.00679266 cd07843 STKc_CDC2L1 cl09925 C
non-specific 173694 656 750 0.00728128 cd05603 STKc_SGK2 cl09925 NC
non-specific 133238 671 823 0.00781925 cd05107 PTKc_PDGFR_beta cl09925 N
superfamily 245201 671 823 0.00781925 cl09925 PKc_like superfamily - N
multi-dom 219530 528 820 5.88E-32 pfam07714 Pkinase_Tyr - -
multi-dom 206026 327 385 0.000411798 pfam13855 LRR_8 - -
multi-dom 206026 160 219 0.000639602 pfam13855 LRR_8 - -
multi-dom 206026 230 288 0.0016305 pfam13855 LRR_8 - -
multi-dom 206026 88 145 0.00284347 pfam13855 LRR_8 - -
multi-dom 215061 50 395 9.76E-33 PLN00113 PLN00113 - C
multi-dom 214568 528 820 1.83E-31 smart00221 STYKc - -
multi-dom 215690 522 817 2.06E-31 pfam00069 Pkinase - -
multi-dom 197581 528 820 7.06E-31 smart00219 TyrKc - -
multi-dom 214567 522 758 2.24E-27 smart00220 S_TKc - C
multi-dom 215061 78 385 1.18E-26 PLN00113 PLN00113 - NC
multi-dom 215061 509 811 9.88E-25 PLN00113 PLN00113 - N
multi-dom 223589 521 817 4.13E-23 COG0515 SPS1 - C
multi-dom 215061 89 227 5.21E-19 PLN00113 PLN00113 - NC
multi-dom 215061 78 295 2.66E-18 PLN00113 PLN00113 - NC
multi-dom 215061 88 217 1.10E-13 PLN00113 PLN00113 - NC
multi-dom 178695 116 223 3.42E-13 PLN03150 PLN03150 - N
multi-dom 178695 113 179 1.57E-12 PLN03150 PLN03150 - N
multi-dom 227223 188 386 1.50E-11 COG4886 COG4886 - NC
multi-dom 178695 286 393 4.28E-11 PLN03150 PLN03150 - N
multi-dom 227223 86 287 4.61E-10 COG4886 COG4886 - NC
multi-dom 240344 629 753 1.54E-08 PTZ00283 PTZ00283 - NC
multi-dom 215036 520 751 1.90E-08 PLN00034 PLN00034 - NC
multi-dom 178695 306 386 3.38E-08 PLN03150 PLN03150 - N
multi-dom 178695 139 226 1.37E-07 PLN03150 PLN03150 - N
multi-dom 178695 53 156 1.39E-07 PLN03150 PLN03150 - N
multi-dom 234389 544 747 1.11E-06 TIGR03903 TOMM_kin_cyc - C
multi-dom 177557 657 824 1.46E-06 PHA03209 PHA03209 - N
multi-dom 165473 651 750 2.26E-06 PHA03207 PHA03207 - NC
multi-dom 140293 658 759 5.07E-06 PTZ00267 PTZ00267 - NC
multi-dom 178695 189 268 4.14E-05 PLN03150 PLN03150 - N
multi-dom 227223 84 289 4.82E-05 COG4886 COG4886 - N
multi-dom 165478 657 750 6.35E-05 PHA03212 PHA03212 - NC
multi-dom 223069 650 758 0.00011493 PHA03390 pk1 - NC
multi-dom 173502 669 750 0.000347422 PTZ00266 PTZ00266 - C
multi-dom 140289 659 755 0.000373176 PTZ00263 PTZ00263 - NC
multi-dom 165291 728 749 0.000641081 PHA02988 PHA02988 - NC
multi-dom 206026 185 241 0.000708704 pfam13855 LRR_8 - -
multi-dom 240233 670 757 0.00102037 PTZ00024 PTZ00024 - NC
multi-dom 227223 81 220 0.00129994 COG4886 COG4886 - N
multi-dom 206026 302 360 0.0018645 pfam13855 LRR_8 - -
multi-dom 206026 78 121 0.0030049 pfam13855 LRR_8 - N
multi-dom 173616 670 755 0.00745239 PTZ00426 PTZ00426 - NC
multi-dom 206026 112 171 0.00979061 pfam13855 LRR_8 - -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific active site L528,A529,E530,G531,R532,V536,A548,K550,V579,Y595,E596,Y597,M598,N602,H604,D674,K676,S678,S679,Y681,D692,L695,S711,P712,G713 26 25 173623
specific ATP binding site L528,A529,E530,G531,R532,V536,A548,K550,V579,Y595,E596,Y597,M598,N602,D674,K676,S678,S679,Y681,D692 20 20 173623
specific substrate binding site R532,N602,H604,D674,K676,S678,L695,S711,P712,G713 11 10 173623
specific activation loop (A-loop) S691,D692,F693,G694,L695,S696,M697,S711,P712,G713 11 10 173623
generic Substrate binding site A96,Y144,H168,G216,D235,S237,D259 10 7 238064
generic Leucine-rich repeats L89,L92,L94,N97,L99,L113,L116,L118,N121,L137,L140,V142,N145,F147,L161,L164,A166,N169,F171,L186,M189,L191,N194,L196,L209,L212,L214,N217,L219,L231,I234,L236,N239,F241,L255,L258,L260,N263,L265 59 39 238064
generic Substrate binding site S192,G193,N238,S310,V357,N379,S381 10 7 238064
generic Leucine-rich repeats L186,M189,L191,N194,L196,L209,L212,L214,N217,L219,L231,I234,L236,N239,F241,L255,L258,L260,N263,L265,F285,L288,M290,N292,L294,L303,V306,L308,T311,L313,L328,L331,L333,N336,L348,L353,L355,N358,L360,M375,F378,F380,N383,L385 59 44 238064
generic active site D674,K676,S678,S679,Y681,D692,L695,A715,P716,P717,E718 26 11 133238
generic ATP binding site D674,K676,S678,S679,Y681,D692 20 6 133238
generic substrate binding site D674,K676,S678,L695,A715,P716,P717,E718 11 8 133238
generic activation loop (A-loop) S691,D692,F693,G694,L695,S696,M697,A715,P716,P717,E718 11 11 133238
 
DNA sequence
Upstream 1000 bp region from PH01001863G0110 gene.
GACCAAAGTTCAAGTTCTAGTGCTGTTGTCATTTGGATTTAATTTTTTGACCTCTTCACAGCCTACTTCTAAGTGCGCTGGCTCCCCTACTGGATTTTGTTTTTGACGATTACTCCGTCTCTACACAAAAGGGATTATTGAAGTTTTGCCATTAAGTTTATGTACAATTGCCAGAATGTCACTCCATATCTCAATGACACGTGAGTCTCGGGGCCATATGTTATTGAGATATTGAGTGACATTCTGGCAATTGGGCATAAAGTTATGTGGCAAATATGTGCAAGTTGCATTTAACTTTGAGTAATGAAATAAACAAGCGTGATACAGGAAACATGCACGTACTGGTTAGTTGGCATCATAAGACTCCCACAAAAGCACACTACTGGAGCCACTTTAATTAATTGAACTACGCAACTGTGATCTGAACCTGATGTCTTAACTAATTCCAATTTGGCCGATTTCTTTCCTGCCTGTTTACTTTTCTTGGCATACCGTTTGCATGATTGCGCTTGGGATGGACAATCAGTCCACCTCCCCCTAAATCACGACGCTAATCCGCGCAAAATGCCCAAATTTATGATGTTGACACAAGTCACGCAGCTACCATCTTCTCATCGGAAATGAGCTATTGACAGGTGCCACACCAGTTAGACTACCCAATACTTGACGCTCTCTTTACACTTTCAACACAAGTTTTCTAGGATGCAAAGCTTTTTTTTCAAGCATTTTTCTCCCTTACCATCACCCAAATGTCAGTAAAAACAAGTTTTTACATGCACCAATCACCTCAACTTTACACGAAACAGAAGCACAATGACCAAGAATAGCGCGCATGCATAATAGGGATTTCGATTTTCAGTCAAGAAAGCGATCGAGTTGTTTGCAGTGATGGCCTCCAAAAGCCATCACACTCGCAGCCGCGCATGGCACGACACCATTATTAATGTACCTAGATAGCGTAACCCGGACAAGAGCAGGTTTGGTTTGCAAACCTGCCCCTC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGCCATGGCGGTGTCCACGCCTCCCTCCTCCTCTTCTTGGCCGTGGCCTGCTGCACGGCGGCGCAGGAGCCAAACACGGACGCCTACTTCGTCTCCAAGTTCTTCGCCAAGATGGGCCGCCCGGCGCCGTCGGCGGGCGGCGCGGTGTGTGCTTGGTCTGGGGTGTCCTGCGACGGCGAGGGCCGGGTGGTGGCGTTCGCGGCCGCCGGGATGGGGCTGGCGGGGGCCATCCCGGAGGACACGGTGGGGAAACTCGCGAGGCTGCAGGCCCTGGACCTCAGCGCCAACCGCCTCACCGCGCTCTCCAACGACCTGTGGGACTTGGGCGCGTCGCTGCGGCGGCTCGACCTCTCGCGCAACACCATCCGCGGCGAGCTCCCCAACAACGTCGGCAACTTCGCGCGGCTCCAGGCGCTCGACGTCTCCTACAACGGGTTCTCCGGCGCGCTGCCGCTGGCGCTCGGCTCCATCGCTGGCCTGCAGGTCCTCAACGCCAGCCACAACCAGTTCCAGGGGCAGGTCCCGGGCAACGTCGTTCTTGGCTGCGGGAGCCTCGTATCCATGGATCTTTCCGGCAATGCGCTGGACGGCGACTTGCCGGACTTATCGCCGCTCCGGTCGCTGGCCTATCTCAACCTGTCCGGCAACCTGCTCCGGGGCTCCATCATCGGGGCGTTCCAGGAGCAGCTGAGGGTCATAGACCTCAGCAACAACCACTTCTCGGGGTTAAATTTTAGCGGTGGGTATGCTGGCTCGTCTTTGATGTATCTCGACTTGTCAAGCAATGAGCTTTTGGGGGAATTCGGTGTTGCTGGCCGGTTCCGGAACCTGAGGCATGTGAATCTTGCATTCAACCAGTTGTCCATGGGAAATTTGCTCGCTTCCATGGGTGAGATCTATGGATTGGAATATGTCAATTTGTCAAGCACTGGGTTGCATGGCCAAATCCCTGGGGAGTTGTCTTCCCAATTGGTTGGTTTGAAGGTGCTAGATTTGTCGCGGAATGATATCAGCGGGGTAGTGCCGGACTTGAGCACCCTGCGGCTGCGGGTGCTGGACCTGTCGGTGAACAACCTTACTGGGGAGATCCCTGTGGCATTGGTGAATAAGTTGGCGTCAATGGAGCGGTTCAACTTCTCATACAACAACCTCACTGTTTGTGCCTCTGAGCTCTCCCCTGAGGCATTTGCAGCTGCGTTTGCCAGGTCCAGGAATGACTGCCCAATAGCTGTGAACCCAGACCGTATCAAGAAAAATGGGGAGAAGCGCAAGGGGATGAAGTTGGCATTGGCCATCGTGCTCTCATTCTTGTTCTCAGTTCTTGGGCTGCTTTGCTTGGCAGTTGCTTGTCGGAGGCGGAGGAAGAGGTGTGATGCATTGCCCGCGGTTAAGCAGGTGTCATTCAAGGAGGAACCAGGGATGTCAGGGCCATTTGCGTTCCAAACCGATTCGACAACATGGGTTGCTGATGTGAAGGTTGCAACATCTGTGCCGGTTGTCATCTTTGAGAAGCCGTTGCTGAGTTTCACATTTGCCGACCTCTTGGCAGCGACATCGAACTTTGATAGGGGAACTCTGCTGGCAGAAGGGAGATTTGGGCCGGTGTATAGGGGATTCCTCCCTGGCGGAATTCAGGTCGCTGTGAAGGTGCTAGTCCATGGTTCAGTAATGGCAGATCAAGATGCTGCAAGAGAACTTGAACGGCTGGGACGTATCAAACATCCTAACTTGGTTCCTTTGACTGGCTACTGTCTGGCAGGGGACCAGAGGATTGCCATCTATGAGTACATGGAGAATGGCAACTTGCACAATTTACTGCATGACTTGCCACTAGGAGTTCAGACCACTGAAGACTGGAGCACCGACACATGGGAGGACAACAATGACGGTGTCGCCACTGAAAACATCACGCCGGAGGGCACCGCAACATGGATGTTTCGGCACAAAATCGCATTAGGTGCTGCAAGGGCACTGGCGTTCCTCCACCATGGCTGCATCCCGCAGATCGTCCACCGGGATGTGAAGGCAAGCAGCATCTACTTCGACTCTGCAATGGAGCCTAGGTTGTCTGATTTCGGGTTGTCAATGATCGCCGGGACTAGCACAGATGACGATCTCTTGCACCATTCCCCCGGCTATGCTCCGCCTGAGTTCTCCGACTCAGAGAATGCGATGGCAACGGCAAAGTCTGACATTTACAGCTTCGGTGTTGTGCTGTTTGAGCTGATCACCGGCAAAAAACCACTGGGTGATGAGTACCCTGATCAGAAGGAATCAAGCCTGGTGAACTGGGCCAGGGCAATGGTGAAGGCAAAGCTAGGGTCAAGCATCATCGACTTGAAGATCCGCGACACCGGGCTGGAGAGGCAGATGGAGGAGGCACTGAGGATTGCCTACCTGTGCACTGCCGAACTGCCATCCAAGAGGCCAGCCATGCAGCAGATCGTTGGCCTGCTGAAGGACATTGAGCCTAAAGTAGCAGATCATAACTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001863G0110 gene.
GAATACCTTTATTAAAAATCTTGTGGTTTTTTTTTATATATTTCCAACGATTCCTCATTTCAAGTAAATTTCCTAGTGTCCCAATCGGAGCGGGAGTGGTAGATCAGATCTTAAGGGTGGGATTTCTTTTCCTTTTATTTTGTTGTTTTATAATCTTACCGAATTTAGTACAGAGGAAAATTTTATAGCACTAGGTCTGAATTCACGATACTAGCAAATGTTATATAACACCTAGGAGTTTGATTGGACATTTTAAGTGCATCCACCCACGTCCGTTGTCACTTAGCACCGATGCCATAATTCTTAAGGGTGGGATTTCTTTTCCTTTTATTTTGTTGTTTTATAATCTTACCTAATTTAGTACAAAGGAAAATTTTATAGCACCAGATCTGAATTCACGATACTAGCAAATGTTATATAACACCTAGGGGTTTGATTGGACATTTTAAGTGCATCCACGTCCATTGCCATTTAGCACAGATGCCATAATTTTTTAAGGGTACAACCGCGCACAACTTTTATTCTGAAAAAGACTCGGAGATTCATCATGCACCTTTACAGCAGGCGATTGGAACTTCGTTCTCCTTTGTGTGAATCCACTGTGTGAAAGAACGTAAACAGCATGAAAAATAATCTCGTTCCCCAAAACACGGAGCATATTTTTGTCGATCGCAGTGTTCCTTGGAATCAAGGATGAGGGCGCGGCGGCGCCAGCAAGAAAAATTCTCAGCCGGCGAATGAAATGACACATTCTTGCCTCCAAAAATAAAAAGTAAACAGTGTTGACTGTGACTAATTCATACTCCTAAAATAAAAGAAAACTCAAGGGTGTAGATACGCACATGTGCTGCAAAATAAGTGCGGTATGATATGAAGTATACATGGATCGACCCTGGAGCCAGTCAAGCGTGATGACCAGGCACTAACATGTTTCGTACTAATATTCTAAGCGGATAACTACGTGATGGTATCCTAAAATAAAGAGACACGAGGTTGATTGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001863 Download
Protein sequence
Protein sequence
MGHGGVHASLLLFLAVACCTAAQEPNTDAYFVSKFFAKMGRPAPSAGGAVCAWSGVSCDGEGRVVAFAAAGMGLAGAIPEDTVGKLARLQALDLSANRLTALSNDLWDLGASLRRLDLSRNTIRGELPNNVGNFARLQALDVSYNGFSGALPLALGSIAGLQVLNASHNQFQGQVPGNVVLGCGSLVSMDLSGNALDGDLPDLSPLRSLAYLNLSGNLLRGSIIGAFQEQLRVIDLSNNHFSGLNFSGGYAGSSLMYLDLSSNELLGEFGVAGRFRNLRHVNLAFNQLSMGNLLASMGEIYGLEYVNLSSTGLHGQIPGELSSQLVGLKVLDLSRNDISGVVPDLSTLRLRVLDLSVNNLTGEIPVALVNKLASMERFNFSYNNLTVCASELSPEAFAAAFARSRNDCPIAVNPDRIKKNGEKRKGMKLALAIVLSFLFSVLGLLCLAVACRRRRKRCDALPAVKQVSFKEEPGMSGPFAFQTDSTTWVADVKVATSVPVVIFEKPLLSFTFADLLAATSNFDRGTLLAEGRFGPVYRGFLPGGIQVAVKVLVHGSVMADQDAARELERLGRIKHPNLVPLTGYCLAGDQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNDGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDSAMEPRLSDFGLSMIAGTSTDDDLLHHSPGYAPPEFSDSENAMATAKSDIYSFGVVLFELITGKKPLGDEYPDQKESSLVNWARAMVKAKLGSSIIDLKIRDTGLERQMEEALRIAYLCTAELPSKRPAMQQIVGLLKDIEPKVADHN
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above