gene PH01001844G0390
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001844:239245 - 243205(+ stand)   Name
Alternate name Locus tag PH01001844G0390
Length of gene 3961  bp Length of CDS 2769  bp
Product information
Feature type
CDS
Product name
PPR repeat domain containing protein
Alternate name
Molecular weight
(predicted)
102707.81052  kDa
Isoeletric point
(predicted)
7.4595832824707
Length
922  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_190199 2
Please click OG5_190199 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os08g21561.1 PPR repeat domain containing protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 600 700 800 922
Detailed signature matches
    1. PF13812 (PPR_3)
    2. PF13041 (PPR_2)
    3. PF01535 (PPR)
    4. PS51375 (PPR)
    5. PF12854 (PPR_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24015 (FAMILY N...)
  2. PTHR24015:SF0 (SUBF...)
  3. SSF81901 (HCP-like)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213555 466 500 2.35E-06 TIGR00756 PPR cl03252 -
superfamily 214131 466 500 2.35E-06 cl03252 PPR superfamily - -
specific 213555 256 290 7.15E-06 TIGR00756 PPR cl03252 -
superfamily 214131 256 290 7.15E-06 cl03252 PPR superfamily - -
specific 213555 396 430 1.73E-05 TIGR00756 PPR cl03252 -
superfamily 214131 396 430 1.73E-05 cl03252 PPR superfamily - -
specific 213555 292 325 2.48E-05 TIGR00756 PPR cl03252 -
superfamily 214131 292 325 2.48E-05 cl03252 PPR superfamily - -
specific 213555 536 570 3.22E-05 TIGR00756 PPR cl03252 -
superfamily 214131 536 570 3.22E-05 cl03252 PPR superfamily - -
specific 213555 641 675 3.88E-05 TIGR00756 PPR cl03252 -
superfamily 214131 641 675 3.88E-05 cl03252 PPR superfamily - -
non-specific 144943 292 321 5.39E-05 pfam01535 PPR cl03252 -
non-specific 144943 466 496 6.85E-05 pfam01535 PPR cl03252 -
non-specific 205985 255 288 7.70E-05 pfam13812 PPR_3 cl03252 -
non-specific 205985 465 498 0.000102903 pfam13812 PPR_3 cl03252 -
non-specific 144943 256 286 0.000108464 pfam01535 PPR cl03252 -
specific 144943 606 636 0.000155418 pfam01535 PPR cl03252 -
superfamily 214131 606 636 0.000155418 cl03252 PPR superfamily - -
non-specific 213555 606 639 0.000167698 TIGR00756 PPR cl03252 -
specific 213555 361 395 0.000418771 TIGR00756 PPR cl03252 -
superfamily 214131 361 395 0.000418771 cl03252 PPR superfamily - -
non-specific 144943 536 566 0.000530616 pfam01535 PPR cl03252 -
specific 213555 572 605 0.000630157 TIGR00756 PPR cl03252 -
superfamily 214131 572 605 0.000630157 cl03252 PPR superfamily - -
specific 213555 676 709 0.00106854 TIGR00756 PPR cl03252 -
superfamily 214131 676 709 0.00106854 cl03252 PPR superfamily - -
non-specific 205985 290 323 0.00110246 pfam13812 PPR_3 cl03252 -
non-specific 205985 395 428 0.00138044 pfam13812 PPR_3 cl03252 -
non-specific 144943 361 391 0.00141475 pfam01535 PPR cl03252 -
non-specific 144943 642 671 0.00191019 pfam01535 PPR cl03252 -
non-specific 144943 396 426 0.00270511 pfam01535 PPR cl03252 -
non-specific 213555 502 535 0.00273509 TIGR00756 PPR cl03252 -
superfamily 214131 502 535 0.00273509 cl03252 PPR superfamily - -
non-specific 213555 222 255 0.00360004 TIGR00756 PPR cl03252 -
superfamily 214131 222 255 0.00360004 cl03252 PPR superfamily - -
non-specific 213555 431 464 0.00888064 TIGR00756 PPR cl03252 -
superfamily 214131 431 464 0.00888064 cl03252 PPR superfamily - -
multi-dom 205222 253 302 3.53E-18 pfam13041 PPR_2 - -
multi-dom 205222 533 582 4.35E-16 pfam13041 PPR_2 - -
multi-dom 205222 603 650 2.77E-15 pfam13041 PPR_2 - -
multi-dom 205222 393 441 8.65E-15 pfam13041 PPR_2 - -
multi-dom 205222 464 512 1.00E-14 pfam13041 PPR_2 - -
multi-dom 205222 323 371 1.71E-14 pfam13041 PPR_2 - -
multi-dom 205222 673 720 1.70E-10 pfam13041 PPR_2 - -
multi-dom 205222 218 267 1.77E-10 pfam13041 PPR_2 - -
multi-dom 205109 636 667 1.87E-05 pfam12854 PPR_1 - -
multi-dom 205222 186 232 0.00205097 pfam13041 PPR_2 - -
multi-dom 215636 202 650 5.57E-32 PLN03218 PLN03218 - N
multi-dom 215636 289 709 1.72E-30 PLN03218 PLN03218 - NC
multi-dom 215561 182 701 3.32E-30 PLN03077 PLN03077 - C
multi-dom 215636 173 512 1.01E-23 PLN03218 PLN03218 - NC
multi-dom 215563 236 662 4.08E-23 PLN03081 PLN03081 - C
multi-dom 215636 568 921 1.30E-21 PLN03218 PLN03218 - NC
multi-dom 215561 224 695 1.64E-19 PLN03077 PLN03077 - C
multi-dom 215563 397 737 9.98E-19 PLN03081 PLN03081 - C
multi-dom 215561 287 694 1.29E-14 PLN03077 PLN03077 - C
multi-dom 205222 568 617 1.87E-14 pfam13041 PPR_2 - -
multi-dom 205222 498 547 3.12E-12 pfam13041 PPR_2 - -
multi-dom 205222 428 477 5.72E-12 pfam13041 PPR_2 - -
multi-dom 215563 208 438 6.09E-12 PLN03081 PLN03081 - NC
multi-dom 205222 358 403 3.39E-11 pfam13041 PPR_2 - -
multi-dom 215636 174 325 4.23E-11 PLN03218 PLN03218 - NC
multi-dom 215561 364 708 8.34E-11 PLN03077 PLN03077 - C
multi-dom 205109 285 316 4.05E-10 pfam12854 PPR_1 - -
multi-dom 205222 638 685 4.51E-10 pfam13041 PPR_2 - -
multi-dom 205109 249 281 5.93E-09 pfam12854 PPR_1 - -
multi-dom 215561 209 499 1.10E-08 PLN03077 PLN03077 - N
multi-dom 205109 529 562 5.48E-08 pfam12854 PPR_1 - -
multi-dom 215563 161 427 7.05E-08 PLN03081 PLN03081 - N
multi-dom 205109 601 632 1.93E-07 pfam12854 PPR_1 - -
multi-dom 205109 354 387 1.02E-06 pfam12854 PPR_1 - -
multi-dom 205109 460 492 3.35E-06 pfam12854 PPR_1 - -
multi-dom 205109 564 596 6.56E-05 pfam12854 PPR_1 - -
multi-dom 205109 389 422 0.000102868 pfam12854 PPR_1 - -
multi-dom 215636 168 333 0.000152147 PLN03218 PLN03218 - N
multi-dom 205109 494 527 0.000165227 pfam12854 PPR_1 - -
multi-dom 205222 842 884 0.000813401 pfam13041 PPR_2 - -
multi-dom 205109 215 245 0.00102034 pfam12854 PPR_1 - -
multi-dom 215561 574 907 0.00105717 PLN03077 PLN03077 - C
multi-dom 205222 872 915 0.00288639 pfam13041 PPR_2 - -
multi-dom 205109 425 456 0.00289454 pfam12854 PPR_1 - -
multi-dom 205109 669 701 0.00292063 pfam12854 PPR_1 - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001844G0390 gene.
GGATTTTGAGGCTGCTATCATAATCTGAACCAGAAAGTAAACTCACCCTAAAAAGCATAAGATTACATTAGGAGCTCTTCTAGAATATGGCTAGTTGGCTACATGTGTAAGCACCTTGTGTGATGAATTTTCTAAGATTGTATTAGGTGCATTATTGTGTCATGTTCAGTATTAGTATTCTAATAGCAACATGTTGCAATCTCAAACTAGCTAGAAGAAAACAATGCTTCACTTTTACTATCCAATTTTCAGAATTCTGAGGTGGCTGAGAGACGAGGAACAACGACAGCAGGAACAGAAGCTACCCCGAATTGAGTTTCTGATTGTTGAGCTATCACGTAAGAGCAAAGTGGATTTATTTTCTATACAAAATACAACAGAGAATTTTCATTGATTTACACCTATTGGTTGATAACACTGATCTTCAACAGCGGTAATTGACATCGACACAAGTGGAATCCACACCCTGGAGGGTTTGTTAAGAGTACTTGAAAAGCGCCAAATTCAGGTAAAGCACCAAAACTACTGTTAGAATTATACAACTACTAGCATGCTACTGCTAATGCAAAACTCTTCACTAAGAACAAAATCCATGTGTGTCACTTACAGCTGATTCTTGCCAATCCCGGGCCGGCAGTAATCCAGAAGCTCCGTGCAGCGAAATTCACAGAACTCATTGGTGAAGACAAGATATTCCTGACAGTTGGTGACGCAGTGAAGAAATTTGCTCCAAAGGTGGCGGAGATTAATGTCTGAAGAAGATGCTCCAAGTTCTAACTATTCTTTTGCAAGCTCCATGTTTGCAAATGTGATTTTATAGAGCAGAGCAGAATGGAAGTAAATACCGTAGTTTGCAAAATGGTAATAATTAAAGAATGTGCGCCGGAGTTGGAGCGCATCAGGTTATCCATCATAACAGAAAAAAAAGGTCTGGGTTTTCAGCTTTTGCATCTCTATGGTTGTATCTGTTAGTATTTCCCCCTTCTTTGTACTTTCAGGCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCCGCCCCTCCCGTCGCCTACTCCTCGCCTCCGCCCCCTCTCGCTCCTCCCACGCGCCGCCCCCTTCAGGCCGCTCCTCCCTCCCCTCCTCTCCGCCGCCCTCTCCGCCTTCTCTTCCTCTCGAGAGCGGAGTGGCCTGGGATCTGAGCAGCCACCGCCCGGTGGCCCCGGGGGTAGCGGCAGATGGAGGCGGCAGCAGCCGCACACCTCCCTGATTATGCACGCGCACCGGAATCTGGCGCAGCCGGATTGGCACCGCAGCACCTTGCTGGCCGCTCTCACGCCCGCGCAGGCCGCCTCCGTGGCAGCCTCGTACCCGGTCGCCGCCCGCGCGCTCCAGCTCCTGCTCTTCCTCTCGCGGGAGCATTCCCACAGATACCTGCCGGACACGTTCGGGGCGCTCGCCATGCGCCTTCTGGAGTCCCGCGAGTACGCCGCCTCGGGACGCGCCCGCATCCACATGATCAAGTCCTGCCGCAGCAAGGAGGCGATGATGCGGACGATGAGTTACTTGGATATGCTTAGCCAAAGAGGGCTCAAGATGGGCCTTTTCGCATATAGCTCCCTGTTGATCCATCTGAGCAGGCTCGAATTGACTAAAGCTGTCATGGACAGGTACCACAAGATGCTCAGAGAGGGTGTGCAGCCAAATTTACTTATCTATAATACCGCGATCAATGTGTTGTGCAAGGATGGCAATGTTAGGGATGCAGAGTCAATCATGAAGAAGGTGTTCGAGTCTGGGATGAAGCCCGACACATTTACCTACACGTCGATGATTCTTGGATACTGTAGGAACCATGACTTGGATTCAGCATTTGAGGTTTTCGATCATATGGGTAAGGAGGGCTGTGAGCCAAACACCGCAACATACTCGACACTAATCAATGGGCTCTGCAATAGTGGGCGGGTGAATGAGGCGTTGGATTTGATTAGGGAGATGACACAGCGTGGTGTTCTGCCGACAGTGTACACTTTTACTGTCCCTATTGTTGCATTATGTGACATGGGGTGTAATGAAGATGCCTGGAAGTTGCTTGTCGATATGAAAAAGAAGGGTTGCGAGCCAAATGTGTATACATACACGGCACTTATCAGTGGGCTGTGTGTGTCAGGGATGCTCAAGGTGGTCATTGGACTGTTTCATAGGATGTCTAGAGATGGTGTGCTCCCTAATACAGTGACGTACAATGCTTTGATAAACGTTATGGTGGAGAACAGGAGAATTGAATCTGCATTTGTTGTTTTTAATATGATGGAGAGACATGGTTTTTCACCGAACACCAGGACATACAATGAAATGATCAAGGGCTATTGCATTATTGGTGATACCGAGAAGGCAATGTTAATGCTGACCAATATGTTGAAGGCAGGACATTCAGCTAATCTCGTGACATACAACACCATCATCAAAGGATACTGTGACTCAGGAAATACTTCGAGTGCTCTTAGGATTCTAGAGCTTATGAAGGCTAATGGGTGTGAACCTGATGAGTGGTCGTACACTGAACTGATTTGTGGGTTTTGCAAGATAAGTAAAATGGAATTGGCTTCTGGAATGTTCAATGAAATGGTAGATCGTGGCTTATGCCCAAATGAAGTTACCTGCACTGCACTCATAAATGGATACTGCAAGAATGAGAAATTGGACTGTGCAACAGCGATGTTGGAACACATGAAGAAAAGTGGTTGCAGACCAAATGTTCAGACTTACAATGTTCTAATCCATGGTCTGGCTAAGCAGAATAATTTTTCTGGTGCAGAGGAACTGTGTAAAGTGATGCTTGAAGAAAAGATATTCCCAAATGTTGTCACTTACACTGCACTGATTGATGGGCTGTGCAAAAATGGTGCCACATCTTTGGCTCTTGAAATGTTCAACAAGATGGTTGAACAGAGCTGTTTGCCTAATCTGCATACATACAGTTCTCTTATCCATGCTCTGGGTCAAGAAGGCAAGGTAGCGGAAGCTGAGGAAATGTTTTCAGAATTGGAGAAGCAAGGGCTTGTTCCTGATGAAGTTACTTATGTTAAGATGATTGAAGCGTATATAATGTCGGGCAAAGTTGATCATGCCTTTGATTTTCTGCGCAAAATGATAAATGCTGGATGTCAACCAACCTTGTGGACATATGGTGTTTTGATTAAAGGCTTGCAAAATGAGTACCTGTTAGTGGACCAGAAACTTGCGGCTTTGCCAGATGCAATCTCAAGCTGTAGTTTTGACGAACAAGTTATTAATAACGATGCCGTTTCTGTCTTGTCTGCAAAGTTGGCAGATCTGGATTCTGACCTATCTGTTCAGTTGTACAACGCAATGGTGTCTAGCTTAAGTACAAGTGGGAGATGGTTTGAGGCTAATGAGCTGTACAGAATTATGGTTGGTCAGGGTTTATGTCCAAACAAGGAGGCAAACAATTCCCTGTTGCTTTCACTTTTGAGAGCCCTGAAAGTTGACCTTGCTATGGATGTATTCGAACGTATGTCTGCTCGACGTTGTGAGCTCCACCTTGCTGGTTATAAAGCACTAATATGTGCTTTATGCCAATTACACAGAAGGAAAGAAGCCCAAATTATTTTCGAAAACATGCTCACGAGGACTTGGAATCCTGATGATGTTGTATGGACTGTGCTCATTGATGGACTGCTTGGGGCCGGATACAAAGACTTGTGCATGGAATTTCTGCACATCATGGAAACAAGTCATTGCAAGCCTAGTTTCCAGACGTACATCATTGTAGCAAGGGAAGCATCGAAAGGGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001844G0390 gene.
ATAAAATGAATCAGTACATAGAAGTTCAGCTCTTCACACCTAGGTATATAAAAATGTTGCCAGTCTACAGCCAGAGGGATATATTTTCTTTAAGAGGAACAATATACTCCCTCCGTATGAATTTAATTGACGTCCTCTAGCTCTAAGGCTCACGTGGCGACGTCAAACAAACAAAACCGGAGGGAGTAATAGATTAAGAGGTACCAAATCACATCAATCATTATTACATCATATTAATCCCACACTCGTTGCTTCTGTCAAACATTGAAATTGAAGATACCAACAGTGCCCAAAGTCCAAAAAATGCAAGACCTGCTCATTAAAAATTCAGTTCCAAGAAGGAACAGAAACATGTTAATGTATGAAATGTAGTTATCTACTGAGAAGTTTTGTTAACTAGAGAATAGAGAGATCCACTCATACTTTGTTATTGAGAAAGATCTCAGTATATGTTGCATTATTTTCCAAATGTACTATCGCTGTGTAGTACAGGGATATCCACTTGGCATGTTATCTAGTGGACCATAGGCTCGCATCTAAGATTGTGTATCACATAGCTAAAGCACGTGACACTAATTCGGTAAGAACAATTCTGTTAAATTCAATTAAATGGTTGGAGGTTTGAAAGATAAATCCTTTTTTATAATCCATTTTGCGTTTTGTTATATACAATCGCCATCTAATATAACATTTTTCATGAAATAAGATAAATAATTTCAGGTAATGGTTTTCCTCCGACGAGCTTACTGTGTAGTATCATTTTTTCTCTTATTTGGTGTTACTTTCAAGAATTATCTAGATGTAGAGTTGACCTTATTCCATTTTGCGTTGGAAAATTTTTGCAGGATAAGCTCATACACAACATGGTTGTAGACAATGAAAACTTCTTTTTCGAGTTAGGCCCCTGATTTGTCGTCATTACAGAACACCGAGTTGCCAACCGCTCAAGAAAACTTACTTTCTAATGGGAGAGCGTGTTTTTTAAAGTCGCTCTTCAGAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001844 Download
Protein sequence
Protein sequence
MAPPLPSPTPRLRPLSLLPRAAPFRPLLPPLLSAALSAFSSSRERSGLGSEQPPPGGPGGSGRWRRQQPHTSLIMHAHRNLAQPDWHRSTLLAALTPAQAASVAASYPVAARALQLLLFLSREHSHRYLPDTFGALAMRLLESREYAASGRARIHMIKSCRSKEAMMRTMSYLDMLSQRGLKMGLFAYSSLLIHLSRLELTKAVMDRYHKMLREGVQPNLLIYNTAINVLCKDGNVRDAESIMKKVFESGMKPDTFTYTSMILGYCRNHDLDSAFEVFDHMGKEGCEPNTATYSTLINGLCNSGRVNEALDLIREMTQRGVLPTVYTFTVPIVALCDMGCNEDAWKLLVDMKKKGCEPNVYTYTALISGLCVSGMLKVVIGLFHRMSRDGVLPNTVTYNALINVMVENRRIESAFVVFNMMERHGFSPNTRTYNEMIKGYCIIGDTEKAMLMLTNMLKAGHSANLVTYNTIIKGYCDSGNTSSALRILELMKANGCEPDEWSYTELICGFCKISKMELASGMFNEMVDRGLCPNEVTCTALINGYCKNEKLDCATAMLEHMKKSGCRPNVQTYNVLIHGLAKQNNFSGAEELCKVMLEEKIFPNVVTYTALIDGLCKNGATSLALEMFNKMVEQSCLPNLHTYSSLIHALGQEGKVAEAEEMFSELEKQGLVPDEVTYVKMIEAYIMSGKVDHAFDFLRKMINAGCQPTLWTYGVLIKGLQNEYLLVDQKLAALPDAISSCSFDEQVINNDAVSVLSAKLADLDSDLSVQLYNAMVSSLSTSGRWFEANELYRIMVGQGLCPNKEANNSLLLSLLRALKVDLAMDVFERMSARRCELHLAGYKALICALCQLHRRKEAQIIFENMLTRTWNPDDVVWTVLIDGLLGAGYKDLCMEFLHIMETSHCKPSFQTYIIVAREASKG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above