gene PH01001722G0380
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001722:241354 - 248451(- stand)   Name
Alternate name Locus tag PH01001722G0380
Length of gene 7098  bp Length of CDS 2757  bp
Product information
Feature type
CDS
Product name
DnaK family protein
Alternate name
Molecular weight
(predicted)
101209.17302  kDa
Isoeletric point
(predicted)
5.13039779663085
Length
918  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127167 5
Please click OG5_127167 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G79930.1
heat shock protein 91
encodes high molecular weight heat shock protein 70 not a HSP90 homolog, mRNA is constitutively expressed but transiently induced after heat shock
heat shock protein 91 (HSP91); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g08840.1 DnaK family protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. PF00012 (HSP70)
    2. PR00301 (HEATSHOCK70)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR19375 (HEAT SHO...)
  2. SSF100920 (Heat sho...)
  3. SSF100934 (Heat sho...)
  4. SSF53067 (Actin-lik...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 212670 2 381 0 cd10228 HSPA4_like_NDB cl17037 -
superfamily 247684 2 381 0 cl17037 NBD_sugar-kinase_HSP70_actin superfamily - -
non-specific 212689 2 381 5.70E-129 cd11739 HSPH1_NBD cl17037 -
non-specific 212687 2 381 6.98E-127 cd11737 HSPA4_NBD cl17037 -
non-specific 212688 2 381 3.20E-117 cd11738 HSPA4L_NBD cl17037 -
non-specific 212682 5 378 1.96E-115 cd11732 HSP105-110_like_NBD cl17037 -
non-specific 212672 4 375 2.78E-103 cd10230 HYOU1-like_NBD cl17037 -
non-specific 212667 4 378 1.91E-96 cd10170 HSP70_NBD cl17037 -
non-specific 212675 4 381 7.36E-93 cd10233 HSPA1-2_6-8-like_NBD cl17037 -
non-specific 212681 2 376 2.34E-86 cd10241 HSPA5-like_NBD cl17037 -
non-specific 212684 2 380 4.30E-77 cd11734 Ssq1_like_NBD cl17037 -
non-specific 212683 3 380 9.49E-76 cd11733 HSPA9-like_NBD cl17037 -
non-specific 212676 3 380 1.77E-72 cd10234 HSPA9-Ssq1-like_NBD cl17037 -
non-specific 212680 2 378 2.61E-67 cd10238 HSPA14-like_NBD cl17037 -
non-specific 212674 2 376 3.60E-62 cd10232 ScSsz1p_like_NBD cl17037 -
non-specific 212678 3 375 7.38E-59 cd10236 HscA_like_NBD cl17037 -
non-specific 212677 4 374 5.45E-53 cd10235 HscC_like_NBD cl17037 -
non-specific 212679 3 380 3.47E-49 cd10237 HSPA13-like_NBD cl17037 -
non-specific 212673 110 376 1.89E-11 cd10231 YegD_like cl17037 N
non-specific 212668 141 374 5.48E-05 cd10225 MreB_like cl17037 N
multi-dom 215656 3 389 2.03E-143 pfam00012 HSP70 - C
multi-dom 223520 1 385 2.50E-88 COG0443 DnaK - C
multi-dom 240227 4 381 5.13E-86 PTZ00009 PTZ00009 - C
multi-dom 233830 3 381 2.62E-72 TIGR02350 prok_dnaK - C
multi-dom 234715 1 381 1.11E-65 PRK00290 dnaK - C
multi-dom 184039 3 381 2.72E-64 PRK13411 PRK13411 - C
multi-dom 240403 3 380 3.46E-61 PTZ00400 PTZ00400 - C
multi-dom 233673 3 375 8.80E-57 TIGR01991 HscA - C
multi-dom 140213 3 374 2.47E-56 PTZ00186 PTZ00186 - C
multi-dom 184038 3 381 9.81E-56 PRK13410 PRK13410 - C
multi-dom 235360 4 380 1.92E-55 PRK05183 hscA - C
multi-dom 214360 3 381 9.85E-55 CHL00094 dnaK - C
multi-dom 215618 3 381 2.05E-50 PLN03184 PLN03184 - C
multi-dom 234955 3 376 1.06E-26 PRK01433 hscA - C
multi-dom 215656 653 753 5.69E-14 pfam00012 HSP70 - N
multi-dom 223520 651 753 1.77E-07 COG0443 DnaK - N
multi-dom 240227 651 749 3.72E-07 PTZ00009 PTZ00009 - N
multi-dom 129982 142 372 6.53E-05 TIGR00904 mreB - N
multi-dom 184403 126 254 0.000263178 PRK13929 PRK13929 - NC
multi-dom 115385 142 373 0.00204588 pfam06723 MreB_Mbl - N
multi-dom 233830 651 754 0.00887295 TIGR02350 prok_dnaK - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific nucleotide binding site G9,N10,E11,S12,K68,D200,G202,H203,A204,S205,G231,E269,K272,K273,S276,G339,S340,G341,R343,V344 20 20 212670
specific HSP70 interaction site A18,R21,G22,I23,D24,D29,E30,S31,K32,R33,A54,S55,T57,M58,V138,D139,Y184,R263,K273,S276,A277,N278,N284,E286,C287,R343,R361,T362,M363,N364,E367,R371,L375,A378,I379,L380,S381 37 37 212670
specific SBD interface K44,Q45,R46,P78,F112,Q116,A119,M120,S123,A127,D150,L151,R153,R154,D158,I162,R169,L170,H172,K219 20 20 212670
 
DNA sequence
Upstream 1000 bp region from PH01001722G0380 gene.
CACGTTCCGGGCTTCAACGGTGGTCGTACTTGGGAATGGGGAGAACTCTCTCTTCTGGGAGGATCGCTGGCTAGACGGTAGATCAATCCAAGGCCTGGTGCCTTCCATTGTCAACATGGTCAAACCATCGACTCGAAAGCAAAGAACGGTAGCTTGCGCCCTTACAAGCAACGGTTGGGTCTCAGACATTTCGGGCTAGCCTGAAGACATCAACATCTCAGAATTTCTGCGTCTATGGGATGCTTTGCAGCCAATACAGCTAGCACCAGGAGTGGTCGACAATGTTCTTTGGAGATGGGAACCTTCAGGATGCTACTCCTCTAAGTCCATTTACGTAGCTTTCTTTAGTGGATCGTTGAGGTTCCCTTACGCTGAGGCCATTTGGAAGTCGTGAGCTCCGCTCAAATACAAAATCTTCATCTGGCTCGCAATCCGCCGTCGTTGCTAAACGGCCGACCGCTTACAGCGTCGTGGGTTGCAAAACCAAGGAGTTTGTGTCTTCTGCGGGCAAGGGCTTGAAACCATCGATCATCTCCTTGTGGGGTGCGCAGTGACATCACAAGTTTGGGGGGTGATTCTTATCTAAGGTTGGTCTTAACTGCGCCATCCCCGCCGATCAGGCCACTCTTCAAGACCATTGGATTGCCGCCAGGAACTCCCAACCTAAGCATCAGAGGAAGGATATTGATCCTAGCATAATTCTACTCTCTTGGATGATCGCGCAACCAGAGGATTTTCAACAGTGTCGCTTCTACCATTGACCAACTCCTTCTTCGTATTATTGATGAGAACCACCATTGGCGCATGGCAGACTCGACTTTAGTGGAAGCGCCCAATTGACCAGTTCTAGTCATTCGTTCTCAGGTCATCGCTTTTCACCGTCTTGTGTTTGTCGAATAGCTTCGGCAGCCTCCCCCCCCCCCCCCCCTCGTGGTTTGTAGCGTTTGCCTAGCATGCCTTGTGGTCTTTCTCTTGTGGGCATTTTGGTTCGCTTTGTCTTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGCGTGGTTGGGTTTGATCTCGGCAATGAGAGCGGCATTGTGGCCGTGGCGCGGCAGCGTGGCATTGATGTCGTCCTCAACGATGAGTCAAAGCGGGAGACTCCCGCGATTGTCTGCTTTGGCGACAAGCAGCGGTTCATCGGCACGGCTGGTGCTGCTTCCTCCACCATGAACCCGAAGAACTCCATCTCTCAGATCAAGCGGCTCATTGGGCGGAAGTACTCTGATCCTGAACTCCAGAGCGATCTGGCTTCATTCCCCTACCGTGTCTCAGAGGGACCTGATGGTTTCCCACTCGTGCATGTTCGGTACCTCGGAGAGGAGCACGTGTTCACCCCCACACAGCTCCTGGCCATGGTGCTCTCAAATTTGAAGGCTATTGCAGAGAGTAACCTCAAAGCTGCTGTTGTTGACTGCTGCATTGGCATCCCAGTGTACTTCACCGACCTCGAGCGTAGGGCTGTGCTTGATGCTGCTACTATTGCTGGTCTCCGCCCATTGAGGTTGTTCCATGAGACAACTGCGACAGCCTTGGCATATGGAATTTACAAAACCGATCTTCCGGAGAATGACCAACTGAATGTTGCTTTCGTGGATGTTGGGCATGCCAGCATGCAGGTTTGCATTGCTGGTTTCAAGAAGGGACAGCTCAAGGTCCTGTCACACACATACGACCGGTCGCTTGGAGGGAGGGATTTCGATGAGGTCCTGTTTAAGCACTTTGCCGCAAAGTTCAAGGAGGAGTATAAGATAGACGTTTACCAGAATGCCCGTGCCTGCATTAGGCTGCGCGTGGCTTGTGAGAAGCTCAAGAAGGTGCTGAGTGCTAACCCAGAGGCACCAATGAACATTGAATGCTTGATGGATGAGAAGGACGTGAGAGGTTCTATCAAAAGAGACGAGTTTGAACAAATTAGTGCCCCGATACTGGAACGTGTGAAGGGGCCACTGGAGAAGGCTTTAGCAGAAGCTGGTCTAACAACAGAGAATGTCCACTTTGTTGAGGTTGTTGGGTCAGGCTCTCGTGTTCCTGCCATAATTAAGATACTCACAGAGTTTTTTGGGAAAGAACCAAGGCGGACAATGAATGCCAGCGAATGTGTTGCCAGGGGGTGTGCCCTGGAGTGTGCTATTCTCAGTCCCACCTTTAAAGTACGAGAATTCCAGGGTAAAAATGTAAGGGTAGAGCCTGCATTCTCGTCCTTTTTACATGTTAAGACTGCTTTAAGCTGCTCGCTGATGGAAGCGTTTACTTCCTTAGCATCTTTAAATGACCTTCATTATTGGGGCATTTACCTTGTTCTTGCCAGTAACAGCAATTTTCTTGACAATTTAGTCTTAATACTGAACATAACTCTAGTTAACGATGGCTTTCCTTTCTCAATTGCCATGTCTTGGAAACCAGATTCTCAGAATGGTGACAACCAACAGACTGTTGTATTCCCCAAAGGGAATCCAATGCCCAGCATTAAAGCTCTGACGTTCTATAGGTCCAATACATTTGCGGTAGATGTCACATATGTTGATACTGGTGATTTGCCTATTCCTCCAAAGATCAGCACTTACACGATTGGTCCTTTTCAACCCAGCAAAGGCGAGAAAGCAAAACTGAAAGTGAAAGTCCGCCTTAACATCCATGGGATAGTCTCAGTTGAATCCGCAACTATGTTGGAGGAGGAGGAAGTGGAAGTTCCAATTGCAGCTACAAACGAGCCACAGAAGGATTCCACTAAGATGGAGACAGATGAGGCACCCAGTGAGTCTGCTTCTGGAACTGATGTAAACATGCAAGAAGCCAAAGCTTCTGCAGATGCTGCTGGGGAGGGTGCTGAAAATGGTGCACCAAATTCGGAGGAAAAATCTGTTCCAATGGAAACTGATGCCAAGGTTGAGCCATCAAAAAAGAAAGTCAAGAAAACTAATGTTCCAATTGCCGAGTTAGTTTATGGTGCATTGGAGACTAAAGAGTTGGAGAAGGCTGTGGAGAAAGAGTTCGAAATGGCTCTTCAGGATAGAGTGATGGAAGAAACAAAGGACAAGAAGAATGCTGTGGAGGCTTATGTTTATGACATGCGTAACAAGCTGTACGACAAGCACAATGATTTTGTGACATCTGAAGAAAAGGAAGCATTCGTCGCGAAGCTTCAGGAGGTTGAGGATTGGTTGTATGAAGATGGTGAGGACGAGACCAAGGGAGTGTATGTTGCCAAGCTTGAAGAACTCAAGAAGGTCGGAGACCCCATCGAGGCACGGTACAAGGAGTGGGTGGACAGAGGTCCTGCCATTGACCAACTTGTTTACTGCATCAACAGTTTCAGAGAGGCTGCCTTGTCCAAAGATCCGAGGTTTGATCACATTGACATAGAGGAGAAGCAGAAGGTCGTAAATGAGTGTTCAGAAGCAGAAACCTGGCTGAGAGAGAAAAAGCAGCAGCAAGATGCGCTACCCAAGCAAGCTAACCCTGTCCTCCTTTCTTCTGATATAAAGAAGAAAGCTGAAGCGCTTGACAGGTTCTGCAAACCAATAATGACGAAACCGAAACCAGCTCCTAAGCCACAAACCCCGCCGACCCCTCCAACGGAGACCTCAGCACCCCAAACACCAGAGCAGCAATCCCATGGCGCTGAAGCAGCCGGCGAGCCCACAAGCGAGCCGACCACCGAGGGCGGTGCAACCGAATCTGCTGGCGGCGAGCAAATGGAGATGCAAATGGAGACGGACAAACCGGAGGGCGCTGGCGCACCCTCGGCGTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001722G0380 gene.
GGTGGCTCGTGGCGCTCGGGTGTTTTCTAGAACCATCTATTCTCTGCCGTGGTAGTCGAGGGTGAGATCCGCATCGTCGGATGGAGGGAGCGGACGGCTGCGATCGGGGCCGGCTTTGAACCAGTGGGGTTAGGGAAAATTGCCCAGGGGAGTTCTTCTGGCGCGCGGGCCCCGCAGTTGGAACGTTCAGACGGGTCTGGAAAAGTGGACGGTGGCGGGCGGCGGGCGGCGGGCGCTCTGGGAGAGTCTCCGGTGCGAGCGGGTTCCAGAAGGATCCGTTGGCTCCCGGAAACACCGAGCGGGTTCCAGAAGGATCCGTTAGGCTCCGGGAAATGCTTTAGGGGTTGTTTGTACAAACCATACTAAATTTTGGCACTATAAAAGTTTGGTCAAGGAATTATTGACCTTAGTTTTGGCTTAACTTCAACAAAATGAATTCGAAATCCAATGAAAACAAGAATCTTGCCAAAGTTTAGGTTTACATCGCTAACAAACCAAATGAATACCAAATTTGATCAAGTTACCAACATTGGTAACCCAAATTGTGACATAAATTGGCTTAGAACCAAACGGCTCATTGCTCTTCCCAAGGTATCCAAGGAAACCTATCAGTTCGTGCATCTAATATGGGCCTATTCGGCGCGGTACTTACTAGTACACCTCTCCTGCGCAAAACTTTTGTAATCATCTCTGTTGGTTGTAGCCTTGTAGGGTTGATTACAATCAGCTTGCATGCATCGAGGTAGGCATAATGGTGTATTGTACTACCCGTACAACTACTTCCAAGGGTGGAACGGACAAACAACTACTTCCAAGGGTGGAACCGACAAGCAGGGTGGCTGTCTCGGGTCTCTTAGGCGGACCCCTCCACCCTCGCCTGGCCAGCCCGTCGCCAAGCCTCGTGGCGCCATGAGAGTGCAAGTGCTACGCTATAGTCCTCGCACCGCGTTGGTCGTGTGCCAAGATGCTGAGTAAAAGTCGGTCCGGTTGTAGCTCAAACC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001722 Download
Protein sequence
Protein sequence
MSVVGFDLGNESGIVAVARQRGIDVVLNDESKRETPAIVCFGDKQRFIGTAGAASSTMNPKNSISQIKRLIGRKYSDPELQSDLASFPYRVSEGPDGFPLVHVRYLGEEHVFTPTQLLAMVLSNLKAIAESNLKAAVVDCCIGIPVYFTDLERRAVLDAATIAGLRPLRLFHETTATALAYGIYKTDLPENDQLNVAFVDVGHASMQVCIAGFKKGQLKVLSHTYDRSLGGRDFDEVLFKHFAAKFKEEYKIDVYQNARACIRLRVACEKLKKVLSANPEAPMNIECLMDEKDVRGSIKRDEFEQISAPILERVKGPLEKALAEAGLTTENVHFVEVVGSGSRVPAIIKILTEFFGKEPRRTMNASECVARGCALECAILSPTFKVREFQGKNVRVEPAFSSFLHVKTALSCSLMEAFTSLASLNDLHYWGIYLVLASNSNFLDNLVLILNITLVNDGFPFSIAMSWKPDSQNGDNQQTVVFPKGNPMPSIKALTFYRSNTFAVDVTYVDTGDLPIPPKISTYTIGPFQPSKGEKAKLKVKVRLNIHGIVSVESATMLEEEEVEVPIAATNEPQKDSTKMETDEAPSESASGTDVNMQEAKASADAAGEGAENGAPNSEEKSVPMETDAKVEPSKKKVKKTNVPIAELVYGALETKELEKAVEKEFEMALQDRVMEETKDKKNAVEAYVYDMRNKLYDKHNDFVTSEEKEAFVAKLQEVEDWLYEDGEDETKGVYVAKLEELKKVGDPIEARYKEWVDRGPAIDQLVYCINSFREAALSKDPRFDHIDIEEKQKVVNECSEAETWLREKKQQQDALPKQANPVLLSSDIKKKAEALDRFCKPIMTKPKPAPKPQTPPTPPTETSAPQTPEQQSHGAEAAGEPTSEPTTEGGATESAGGEQMEMQMETDKPEGAGAPSA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above