gene PH01001697G0180
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001697:113241 - 115442(+ stand)   Name
Alternate name Locus tag PH01001697G0180
Length of gene 2202  bp Length of CDS 1068  bp
Product information
Feature type
CDS
Product name
WRKY transcription factor
Alternate name
Molecular weight
(predicted)
38673.08272  kDa
Isoeletric point
(predicted)
9.84831619262695
Length
355  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_156625 7
Please click OG5_156625 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G28650.1
WRKY DNA-binding protein 74
member of WRKY Transcription Factor; Group II-d
WRKY DNA-binding protein 74 (WRKY74); FUNCTIONS IN: calmodulin binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 1
8E-79
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os12g40570.2 WRKY94, expressed 2E-146
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 355
Detailed signature matches
    1. PF10533 (Plant_zn_c...)
    1. SSF118290 (WRKY DNA...)
    2. PS50811 (WRKY)
    3. SM00774 (WRKY)
    4. PF03106 (WRKY)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31282 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 214815 287 345 2.53E-36 smart00774 WRKY cl03892 -
superfamily 243565 287 345 2.53E-36 cl03892 WRKY superfamily - -
non-specific 145969 287 347 1.62E-33 pfam03106 WRKY cl03892 -
specific 192617 227 285 4.07E-13 pfam10533 Plant_zn_clust cl11166 -
superfamily 192617 227 285 4.07E-13 cl11166 Plant_zn_clust superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001697G0180 gene.
CTCATTAAGCATTAAGCATGTGTCATACTTTGTTGGCAACGTGGAAGCAATCCAAGGTAAGTTGGTTTTCATCCTACGGGTTAAAATCTAACTAATTTGCTAACAAAAAAAATCAGTCGAAAGATCTATAGACGCTCCCTTCTTAAGTACACAATGTGATGTAAGAATACTTCAAAAAAATACATATGAGTTAGGTAAAGTCCCCTCTTGTATCAAAATATTTTTTGAAAGGTATATTGTATCAAAACATTAGTTAGATGCCTTGTCCAAATCTGCCATCTTAAAATATGAAAGCACAAAGCGTAGGCATGTAAGAATTTCCATGTGAGCGTAGCAACGGTCAACAAAAACCACTTCACACTGACCCATGTCCTTGACATTTTGACCACAGAACAGCATCGACTCATTAAAAAATAATAAAGCCTCCCGCCCACAGCATAAAGCGGCGGCCTCGGCTGCGAAAAAGAAGGAAATGGGAATGAGAATTATTTTGCAATCTTCTGCGTCTGGTCTTCGTCGTCCTCTTCTTCGCCCCCTTCAGTTTCANNNNNNNNNNCTTCTTCGCCCCCTTCAGTTTCACGCCTTCCATTAGTCTCCGGTGGGGGACGACCGCCGCCTCCGAGCTCGCAGTCGCCGCGTCGAGATTCATCCCCCGGCCTCTCCAGATCCTCCCCGAGGTGAGTTCGCGAGCTCTCGCGGTTATTCTGGGTTGGGTTCGGGTTTGGCCGCCGTCTGCTGCTGTTTGCTTGGGCGGAATCTTTGGGGGAGGTGTCTGTGCGGGGCTCTTGCAGTGTTTTATGCGGTTGCACGCAAGAAATCCTCCACCCGGGTCGTTTCTTTCCGCGGCGGATCCCCCCCTCTCGGCTGTCAACGTCCGGCTTGGTGCCCACTCCTGCCGCTTCTGGGGTTTCTTGCGGAGACGGCTCCCCCCGTGATCCGGTCCCGAACCGCTTTCTTGGCCCGGAGCCTGATGCTTCTCCGATGGCCGTTGCGTTGTTGTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAGGAAGTGGAGGAGGCGAACAGGGGAGCCGTGGAGAGCTGCCACAGAGTGCTCGCCTTGCTCTCCCAGCCCCAGGACCCGGCGCAGCTCAGGAGCATAGCTTTGGAGACTGATGAAGCCTGTGCAAGGTTTAGGAAGGTGGTCTCCCTCCTCAGCAATGGAGGAGGAGGAGGGGTAGCAGCAGCGGGAGGAAGCCATCCTAGAGCTAAGGTTGTCAGCCGAAGACAGACCCCGGGGTTCTTGAGCCAGAAGGGCTTCTTGGACAGTAACACCCCGGTGGTGGTGTTGAATAGTGCTCATGCTTCGCCTAGTTCCGCGCAAGTGTATCCTAGAATGGGAATTTTGGATTCACCGAGTGGTCATCAGATTGGAGGACCTCCCAAGATGGTCCAGCCATTGTCTGCGCATTTCCAGTTCGGCAATGTATCATGCTACCAGTTTCAGCATCAGCAGCAGCAACAGAAGATGCAAGCTGAGATGTTCAAGAGGAGCAATAGTGGGATTAACTTGAAGTTTGACACCCCCAGTGGCACCGGGACAATGTCATCGGCGAGGTCCTTCCTGTCGTCTCTGAGCATGGAGGGTAGTGTGGCCAGTCTGGATGGCAAGTCTTCGTCATTCCATTTGATCGGTGGGCCTGCCATGAGCGACCCGGTGAATGCACAGCAGGCCCCAAGGAGACGATGCACAGGACGTGGGGAGGATGGGAATGGCAAGTGCGCTGCAACTGGCAGGTGCCATTGCTCAAAGAGGAGGTTGAACATCATCAGATGTTTTATGCGCTATTTTAGCAGGAAGTTGCGGGTGAAGAGATCAATTAAAGTTCCCGCCATCAGTAATAAAATTGCTGATATACCTCCGGATGAATACTCATGGAGGAAGTATGGGCAGAAGCCAATTAAGGGTTCCCCTCACCCTAGGGGTTACTACAAATGCAGCAGCGTGAGGGGCTGCCCAGCGAGGAAGCATGTCGAGCGTTGCGTAGATGACCCATCCATGCTCATTGTGACATACGAGGGTGAGCACAACCACACTCGGATGCCAACTCAGTCTGCACAGGCGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001697G0180 gene.
AAAAATTTCTTCTCCCTTAAGAAGGTATCAAATGATGACAGGGAAGAACAAGCTGTTAGATAGGACACCTGAGATTTTGCTCCGGAGGGAGTGAATAGTTGGAAGGGAAGATAGAAGTTGGGCAGAAAAGACAGTTGTGTAAGCTTGGAAATTTCAGAAAATTTAGTACAACAAATCGTCTTGAATCACCCGCTCTCCCTCCCTCCTTTTGTACCAAGTGCGCAAAAGCTAGCTTAAAAAAAAGTGCAAAAAAAGTTTGTTTGCTATCATACCATCACATGGTCACACTAGAATAGCATTTTCCTTTTGGTCCTAAGGTTAAGGATATATGTTGCTCATTTATTTATGCCTAATCATCTAATGAGTTGCCACTAATTTTGCGTGTTTTATTTTCTTTATTATTTTTGGAAAAAAAACATTAAGCTGAACAGCTATGGGTAGCTTCTTTTCTAAGAGAAAGTAAGTAATGTCTATAGTCATGGGTAGAACATATTTTTTTTGGTGGGAAAATTGAAATCCTCCAATAATACTGCGTGGAAATGTCGGGTTATATATGCGTGGATGTTACGTGAATCTTAAACATGTACGTGGATCGCTGCGAAATTTGATTCGCTGAGCTTAGTTAAGCAGCTGAGATTTACTACTCAGTTTTTTTTACTCGACGTACTAGAATCCGTGCGGCTAAGCATTCTAAAGTTTTACCACCAATATGTTTAAAATTATCTAGATTGGCTATATGAAAATTATATCATTAGAATTGTTGTCAAAAATATTTTTATAATATTATAATTTTATTAATATATGTTAATGTAAATGTATAAAAAGTACCGGTCAAAGTTGTATCTCGGAAATCATGAAAATAAAAAATATCAAGTAAAAAAGAACATAGGAAGTACTTCTTGGTTCGGGGTGCTCCAGGTTGACTTGGTGCTTCATTTGAGTTTAAGATTTGGATGAGCTATTATTTGTTTTCGGGACAGAGAAATGTCAGGTTGGCCTTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001697 Download
Protein sequence
Protein sequence
MEEVEEANRGAVESCHRVLALLSQPQDPAQLRSIALETDEACARFRKVVSLLSNGGGGGVAAAGGSHPRAKVVSRRQTPGFLSQKGFLDSNTPVVVLNSAHASPSSAQVYPRMGILDSPSGHQIGGPPKMVQPLSAHFQFGNVSCYQFQHQQQQQKMQAEMFKRSNSGINLKFDTPSGTGTMSSARSFLSSLSMEGSVASLDGKSSSFHLIGGPAMSDPVNAQQAPRRRCTGRGEDGNGKCAATGRCHCSKRRLNIIRCFMRYFSRKLRVKRSIKVPAISNKIADIPPDEYSWRKYGQKPIKGSPHPRGYYKCSSVRGCPARKHVERCVDDPSMLIVTYEGEHNHTRMPTQSAQA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above