gene PH01001634G0140
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001634:76646 - 80944(+ stand)   Name
Alternate name Locus tag PH01001634G0140
Length of gene 4299  bp Length of CDS 1053  bp
Product information
Feature type
CDS
Product name
protein kinase domain containing protein
Alternate name
Molecular weight
(predicted)
38294.4692200001  kDa
Isoeletric point
(predicted)
6.61235427856445
Length
350  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP07097000 PH01001634:76826 G G_A
PH01SNP07097010 PH01001634:76934 A A_G
PH01SNP07097020 PH01001634:76964 C C_G
PH01SNP07097030 PH01001634:77000 C C_G
PH01SNP07097040 PH01001634:77368 A A_G
PH01SNP07097050 PH01001634:78062 C C_T
PH01SNP07097060 PH01001634:78161 C C_T
PH01SNP07097070 PH01001634:78286 G G_C
PH01SNP07097080 PH01001634:78317 G G_C
PH01SNP07097090 PH01001634:78332 C C_T
PH01SNP07097100 PH01001634:78354 T T_A
PH01SNP07097110 PH01001634:78388 C C_T
PH01SNP07097120 PH01001634:78572 A A_C
PH01SNP07097130 PH01001634:78600 G G_T
PH01SNP07097140 PH01001634:78664 G G_T
PH01SNP07097150 PH01001634:78693 T T_G
PH01SNP07097160 PH01001634:78717 C C_T
PH01SNP07097170 PH01001634:78735 G G_A
PH01SNP07097180 PH01001634:78767 A A_T
PH01SNP07097190 PH01001634:78802 C C_T
PH01SNP07097200 PH01001634:78837 C C_T
PH01SNP07097210 PH01001634:78857 T T_C
PH01SNP07097220 PH01001634:78873 A A_C
PH01SNP07097230 PH01001634:79088 C C_A
PH01SNP07097240 PH01001634:79100 G G_A
PH01SNP07097250 PH01001634:79152 A A_G
PH01SNP07097260 PH01001634:79229 T T_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_137537 11
Please click OG5_137537 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 350 350
Detailed signature matches
    1. SSF54171 (DNA-bindi...)
    1. PR00367 (ETHRSPELEMNT)
    2. PF00847 (AP2)
    3. SM00380 (AP2)
    4. PS51032 (AP2_ERF)
    1. SSF56112 (Protein k...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24420 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 237985 28 88 7.26E-23 cd00018 AP2 cl00033 -
superfamily 241562 28 88 7.26E-23 cl00033 AP2 superfamily - -
non-specific 197689 29 86 1.88E-23 smart00380 AP2 cl00033 -
non-specific 216148 28 61 2.12E-09 pfam00847 AP2 cl00033 C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific DNA binding site R31,G32,R34,R36,W38,K40,E44,R46,R53,W55,T58 11 11 237985
 
DNA sequence
Upstream 1000 bp region from PH01001634G0140 gene.
TCACTGCACTTCACCTTAAGCTCTAGGCACACGGCTAAGAGACGGATACGAGAGCATATGGGCTTCGTCTTCGACTGGGTTCAGTTGGCGCTGCACAAGGGAAACAAGGGTGGATCGTCTAGGAGATACTGCTGCTGCTCAGGGCGCCCCAGGGCATCGTCCTCGCAAGAGGGCTTCATCTCCTCGTCAGGGCCTTCACGGCGAGGCGGCGGCTGAAGCGCGAGGAGGCGGCGGCGGCGTGTTCCACCCCGCGGTGCACCCGGAGGACGAGCTCGCCGTCATCGTGGCGGCGCTCACGCACGTCATCAGCTCGACGGCTGCGCAGCCGCCGGTGGTGGAAGGCGCGGCGCAGCCATGGGCCGTGGCAACCTTGTTCGGGCAACAGGGTACGTACTGGTGTACTACTGCTACTGGTGCACTTTTTCTTTTTCTTGAAATCTTGATGTTCTCTAGAAGTCTAGACAGTTAGACCCAGGGTTCAAATTTTCGGACGAAATTCGCCGAAAATCGGTGTTTACGGCCACCCCGGTTAAATTTCAAGCCGGCAAGAAAAAAAAAACGGATTCACGTGATTTTTGTCCAATATAAAAGAAATTCAGAATCCCATCTAAATTCATAACGCATATTCTCTGGTGGTAAGGCTCACAGGCTAAATAACGGCAGGTTTTGTGTTCGAGCCTCGTAGACGGTACATTTTTTGTATAGCTAGCTAGCTCTTCTTAGTTCTATATGTGACGGGGGCAGCACAAAAATGAAAAGAAAATAAAAAGGAAAGGAAATAGCATTTACCATCCATCCAATCGCTCCTCTTTCTTACTTATAATATACCATTTAAACAAATATATTATATTTTAAAGTATACTTAAATACCAATTATAAGATACTTTAATATAATGCAACTTAATTGAACAATTTCTGTTGGAGCCTATTATTTTTTTATATACCTTTTTCCATATATAAAGATTATATATATACAAATTTTGCTATAAAAGTAGACTTTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGATTCAGTGTTGCACCAGCAAAGCGTTCCTCCGCCGGCGACGTTGGAGCAGCACCAGCAGCAGCGAGGCGCTGAGCGGCCGCGGTACCGCGGCGTGCGGCAGCGACCGTGGGGCAAGTGGGCGGCGGAGATCCGCGACCCCGTGAAGGCGGCGCGCGTGTGGCTCGGCACCTTCGGCACGGCCGAGGGCGCGGCCCGCGCCTACGACGCCGCCGCGCTACGCTTCAAGGGCTCCAAGGCCAAGCTCAACTTCCCCGACGACGCCCGCAACATCCTACAACTACCCAGTCATCAGCCAGCCGCAACCTCTTCGTCGACGCCGCAACGGCGACCACGCGCCGCAGCCCATACGCAGACCACCACGCCGGCGGCCACCGCGGGCACAGCCGCTGAGTTTCCCGACCTCCGCCGTGACTGTATCCAAATTATTTCTGTTGTCGCATTCGCCAAGGATTTATACTCCGACTCAGTGCTAGAACGTGAGACAGTCGCCTGTTTGCGAGAACTCCATGAGATCAAATTGGTGCCAAAGTATATGGCATATCCTCCTGTGGATCTTCTATCATCCAAACACCTAACCCAATCTGCATCTGAGAATGCACTGACCAAGGTTGACACGGACTTGTGTATTTGTAGTCCCGCTGCAAGGTATGCTCAATATGGTGATGTTTCTCCTAAGGTCGATGCTTATGCCTTTGGCGTTGTCCTTTATGAACTTATTTCAGCCAAAGAAGCTATTGTCAGATCAACTGAATCTGCTAGTGATTCAAAGGGATTGGTTTATCTGTTTGACGAGGCTCTCACCACACCGGATCCAAAGGAAGGCCTTGGGAAACTGATCGATTCAGGGCTAGGAGAGGATTATTCCATGGATTCCATCCTCAAGTTCCGCCGTGACACGAAAGCAAGCACACAGGACGACCCCAAGTTGAGGCCTACAATGATATCCGCCGTTGGTGCGCTCATGATGCTGTCTTCAACGAGTGAATTCTGGGACATGAACAATCTCTGTGAGAACCAAGGTTTGGTCAACCTCATGTCCGGGGGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001634G0140 gene.
ATAAATTCTATTGGAGAGGGCCTCCGTAAGACCCTTTCCCTACAGTCGTTAGATCTGTGAGATGTGCATTGTAGCATGTATGTGGGGAGAGGGGATCCAACGGCTGTGGGGGAGGGCCTCCGTAAGACCCTTTCCCTACAGTCATTAGATCTGTGAGATGTGCATTGTAGTATGTATGTGAGATGTACATCAAGTTCGTACGTACGGCAGCCAGTGCGTTGTGTCTTGTCTATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001634 Download
Protein sequence
Protein sequence
MDSVLHQQSVPPPATLEQHQQQRGAERPRYRGVRQRPWGKWAAEIRDPVKAARVWLGTFGTAEGAARAYDAAALRFKGSKAKLNFPDDARNILQLPSHQPAATSSSTPQRRPRAAAHTQTTTPAATAGTAAEFPDLRRDCIQIISVVAFAKDLYSDSVLERETVACLRELHEIKLVPKYMAYPPVDLLSSKHLTQSASENALTKVDTDLCICSPAARYAQYGDVSPKVDAYAFGVVLYELISAKEAIVRSTESASDSKGLVYLFDEALTTPDPKEGLGKLIDSGLGEDYSMDSILKFRRDTKASTQDDPKLRPTMISAVGALMMLSSTSEFWDMNNLCENQGLVNLMSGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above