gene PH01001473G0230
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001473:145276 - 153443(+ stand)   Name
Alternate name Locus tag PH01001473G0230
Length of gene 8168  bp Length of CDS 1941  bp
Product information
Feature type
CDS
Product name
ATP-dependent protease La
Alternate name
Molecular weight
(predicted)
71947.9046200003  kDa
Isoeletric point
(predicted)
9.00754928588867
Length
646  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP06645310 PH01001473:147079 C C_T
PH02SNP00015170 PH01001473:150900 G G->A
PH02SNP00035030 PH01001473:149809 C C->T
PH02SNP00035040 PH01001473:150900 G G->A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_130671 3
Please click OG5_130671 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g44590.3 ATP-dependent protease La, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 646
Detailed signature matches
    1. SSF88697 (PUA domai...)
    1. PF02190 (LON)
    2. SM00464 (LON)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR14255 (ATP-DEPE...)
GO term prediction

Biological Process

GO:0006508 proteolysis

Molecular Function

GO:0004176 ATP-dependent peptidase activity

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 197740 190 243 0.00174031 smart00464 LON cl15344 C
superfamily 197740 190 243 0.00174031 cl15344 LON superfamily - C
multi-dom 216923 191 279 2.15E-16 pfam02190 LON - C
multi-dom 225362 188 279 9.14E-11 COG2802 COG2802 - C
multi-dom 223542 187 282 4.73E-06 COG0466 Lon - C
multi-dom 233119 192 278 8.19E-06 TIGR00763 lon - C
multi-dom 216923 460 530 4.13E-05 pfam02190 LON - N
multi-dom 182730 189 279 0.00163128 PRK10787 PRK10787 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001473G0230 gene.
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCTCGTCCCGCGCGTCCGTTCAGTGCATCCTGTTCGCCTCCATTCCCGTGCGTGCCTGCTGCCTTCGCGCTGCAGCGCATCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCCCATGCTCTTGACCAGCGGAGCCCCCGAGGGTCCGAGTCCCTCCCGTCTCCAGCTCGAGCAGGATGCCTACCGCAAGCTCGCCGAGCGCAAGGCCTCCTCCTCCACTGCCTCCACCGCCCCCGCCACCTCGCCGCTCCCACCCCGCGCCCCCGCCACCTCGTCGCTCCCATCCCGCGCCCCCGCGCCGGCAGCCACGGCCTCTTCGCCGCTCAGGAATAACCACCCCGCCTCCAGGGCCTCCCTGGACTCTCACTTCGGCAAGGTTAGGGTTTTCTCCGTTTATTTGCTGTTTCGGGGAATTCGTGGTGCTGGTCTGAAACTCTGTATAGTCAATGTCTTGGAGCGTTGGGAGCTGAACACCCATGAACCAAAGAGGATCCGCCCCTGGGCTGGAGTGCGTTACAGTTGGATAAGCTTTAGGTATGAATGGATGTTTATTTGCCGTAGTTTCGCTTATAGAGAAATACTATTAGAGCATGTGCATCCTTCGTGCGAAGGCAATGCTAGAGAGGTTGATGATACACGCGGAAGAGTTGCCCTCTTAGATGCTGGTAGAATCCTTAGCTTGCCAATGCTCTATCTCCAAGGTGTTGTCCTATTTCCTGGAGCTACCCTGCCTCTCAGACTAATTCAGGGTAGACATGTGGCAGCTGTTGAGAAAGCTTTGAGGCAGGTTGATGCTCCATGCACAATTGGCGTGGTTCTCATGTACAGACAACCAAATCATCGTGCTAATGCATCGGTTGGAACAACAGCAGAGATACGGCAACTTGGAAGATTGGATGATGGTTCATTAAATGTTGTAGCCCGTGGGCAACAACGATTTCGTCTGATGCGGCATTGGATCGATGTTGATGGGGTGGTGTGGGGTGATGTCAAAATCATTGAAGAAGATACTCCTCTAAGAACTCCAAGAGATGCATTTGGACAGCTAGCTGCATGTAACAGTTTCCGGCTGCGTACTTCTTCACCAGCTATCAGTTTGGGTGTGTCTCCAATCAAACAACAGGATCATATTGATTCAGAACTAGATTGCGATACTCCATCACCCAAAAGTACTGCAAGTGATCATTCAGCAATGGAAACAAGGATGTGCCATTCAGGTTCACAATCGAGTAACTCAATAAAATCCTCAAATGAAGATGGAGAGCACTTTTGGAGCCAGGAGTTACATTCTGTGAAAGGAATTGGTGTATCAGGTCATTCAGGCAAGAATACCAACATGGATGAGAAGGATATTTGCTTGACACCCCTTGGATCCTTGTCAAGTGCAAGAACAAGAGATACTAAGCAGCAGCAGCGGCACCATGCCACCAGTTACTCAAAGCAACCTTTTCAGGCACCGCTATCATTTTGGCCTCGGTGGGCTTATGAAATGTACGACTCATATGTACTTGCTCGTAGAGCTGCAGATTTGTGGAGACAGATAATCACAAACCCAAGCATGGATGATCATGTGAGAAAACCAGACCTCCTGTCATTTTACATTGGAAGCAAACTTCCTGTATCAGAATCTGTGAGACAAAAATTGCTGGAGATTGATGGAATTTCATATCGCCTACAAAGGGAGATTCAGCTTCTAAAGGCCTTTAATCTCATAAAATGTAGAATTTGCAAGTCTCTTATAGCAAAACGTAGTGACATGGTGGTGATGTCTACTGATGGGCCTCTCGGTGACTGTGCCAACCCACATGGTTTTGTCCACGAGACGATTACAGTCGGCAAGGCAACTGGGCTTGCTCTTGATGGCGATCCTTCAACGGTTCACAGCTGGTTCCCAGGATACTCGTGGACGATTGCATCATGTGCTGAATGTGAATCCAACATAGGCTGGCTATTCAGAGCCACAAGGAACAATCTGCGACCGAGATCCGTTTGGGGGATCCGTAGCTTCCAAATTGCAGATGATACACAGGAAGTAGATCAGGATGAATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001473G0230 gene.
ATAAAGTTTTTATTTTATGTTACCAAATATAAAATTAATAAAGTTATTATTTTATTAAATTTTCTGACTTTTAAAAGAGTTTTCTTGGCTAAAAAAATAATAAAATGAAGTTAATTATTTAATTTCCTAGTTTTAATGTCAAAAATAAAATTTATTAAGTTTTTTGGGATTTTATTGAATTTAGAGTGAAAAAGGATATTTTAATAAATTTCTTAAATTTTCTGGATTGTAAAAAGGTTTTTCCTATTTTTTAGAAATTAAAAATAATTTATGTGTAAGAAATAAAAACCAACTTTAATTTGAAATTAATTTTGTTAAGTTCTAAATAATTCAAGGAATTTATGTGATTTTTTCTAGAATTTTTTTAACTATATTTGCTATTTTCTAAAAGGCTATTTGATTTGTTGCATTTTCTGAAATTCAAAAAATAATTAAAATCTCCTTTTCTCTTTTGGGCCAAAATTTGGATATCCGAACTTCATCTTATCCGGATAATTATCCGTCGGATAGCATGACTACCGTATTCGTTTCCGAACTTAAAATTATTCGAGAAAAATCCGATCTGAGATAATCCGAATCTGTTTCCGTCCGAATCGGTCGGAAACTATCCGATTCGTTTTCACCCTTATGCTCCATGTATAGTAATGTAGCGGAGTAGTTAGCTCTGTATGACTTGTTTGATCTGATAACAATCCATATCATTCTCCCTTTTCGTNNATCTGATAACAATCCATATCATTCTCCCTTTTCGTAATTTTCTAGTCCACAGATCCAGGCTTTCCTGCCTTTTTATTTACCTTCGCAATGGTCAGAATGGAGATTTGTAAAATAATCACTTTCTCTGGTGTGTCTTGTACCCAAGTTCCGTTGCAGAAAAATTTCTGAAATGTATGTATTGGATCGTGACTTTTCAGAGTACTCACCTCTTTCAGTTCAGCCGTTCCGTCTCTTCTTGGATTGCAATATCTTTTGCCGTCTCACGCTCGCCCACCCTGCCGTCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001473 Download
Protein sequence
Protein sequence
MPMLLTSGAPEGPSPSRLQLEQDAYRKLAERKASSSTASTAPATSPLPPRAPATSSLPSRAPAPAATASSPLRNNHPASRASLDSHFGKVRVFSVYLLFRGIRGAGLKLCIVNVLERWELNTHEPKRIRPWAGVRYSWISFRYEWMFICRSFAYREILLEHVHPSCEGNAREVDDTRGRVALLDAGRILSLPMLYLQGVVLFPGATLPLRLIQGRHVAAVEKALRQVDAPCTIGVVLMYRQPNHRANASVGTTAEIRQLGRLDDGSLNVVARGQQRFRLMRHWIDVDGVVWGDVKIIEEDTPLRTPRDAFGQLAACNSFRLRTSSPAISLGVSPIKQQDHIDSELDCDTPSPKSTASDHSAMETRMCHSGSQSSNSIKSSNEDGEHFWSQELHSVKGIGVSGHSGKNTNMDEKDICLTPLGSLSSARTRDTKQQQRHHATSYSKQPFQAPLSFWPRWAYEMYDSYVLARRAADLWRQIITNPSMDDHVRKPDLLSFYIGSKLPVSESVRQKLLEIDGISYRLQREIQLLKAFNLIKCRICKSLIAKRSDMVVMSTDGPLGDCANPHGFVHETITVGKATGLALDGDPSTVHSWFPGYSWTIASCAECESNIGWLFRATRNNLRPRSVWGIRSFQIADDTQEVDQDE
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above