gene PH01001473G0180
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001473:112919 - 119962(+ stand)   Name
Alternate name Locus tag PH01001473G0180
Length of gene 7044  bp Length of CDS 1560  bp
Product information
Feature type
CDS
Product name
ATP-dependent protease La
Alternate name
Molecular weight
(predicted)
58224.5348200001  kDa
Isoeletric point
(predicted)
5.56720352172851
Length
519  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP06645060 PH01001473:116846 A A_T
PH01SNP06645070 PH01001473:119111 G G_A
PH01SNP06645080 PH01001473:119124 T T_G
PH01SNP06645090 PH01001473:119494 C C_T
PH01SNP06645100 PH01001473:119566 A A_C
PH01SNP06645110 PH01001473:119634 T T_A
PH01SNP06645120 PH01001473:119657 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_130671 3
Please click OG5_130671 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G25740.1
ATP-dependent protease La (LON) domain protein
ATP-dependent protease La (LON) domain protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: proteolysis, N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 gr
1E-107
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g44590.2 ATP-dependent protease La, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 50 100 150 200 250 300 350 400 450 519
Detailed signature matches
    1. PF02190 (LON)
    2. SM00464 (LON)
    1. SSF88697 (PUA domai...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR14255 (ATP-DEPE...)
GO term prediction

Biological Process

GO:0006508 proteolysis

Molecular Function

GO:0004176 ATP-dependent peptidase activity

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
multi-dom 216923 333 403 3.03E-05 pfam02190 LON - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001473G0180 gene.
AAAAAGGTTGATGTCTGCATGCATAGAACTTGTAGTTGGTATAGACACACAAGGAAATAATACAATTGGTCAAAATAGATAATGAGGATCATCTCCATATCATTTCCAAGCAAACAAGAGAAGTAAACTAACTGCAAGTCATTGTTTCAAGAAGTTGAGGACACAAAAAAACAACAGTGTTCAGGCACACCAGACATCTAGAAGCAGTCTGAATCCTGCAGGAGAATTCTGGTGGCTCATGAAACAAATGGTGAAGTGTTGTTTGATATTTTGCCTATCCTGGCAATAGGAAGGTAGAACAACTAGGCCCAACTAGAATGATTGTTTCATTTTCTCACTTTTAAGGGCAGGGTTCCTTAGCTGTGTGTAGATTCTTGGCAACTAAATTAGGTTTGATGGTAAATTTGTTGTATATCTGTACCGTTGTACACTTTTACGTAGTTAAAAGTTCAAATTAAGTTCACTGAGAACGTATGGAAAAAAAAACCTAAACATTCTCATGTTCGCCCATGAAACCAACCTTGGCCATGTGTGCCTCTCCTTCACCAACCGATATTTTTCTAAAACCAAGTTGGATAGTTTGTTGGGAAAAGCAGGTTTTTCCTTCCCCCACCAAATAGGTAACCAACAGCACGCAAGAACTTGCCTAAAGTGGCAACAAAATTCAAATAGCCTCTAAGAGTCTGTCACCACCATCTGTCACATAGGCATGCTTAATATGTAGCCGAATGAAGATATTCAAAATCAACTACCTGGAGCTACCTAGAACAGCTGCCTTTTAATTGCTGCATGTGTGCATCCCATCTATCGAAATCTCTGGGATACTTCTCCCTGCACAGTGTTGTTAGACATACATGGCATATATATCCTCTTGCGTGTATCAAGTTTATCTATACCAATGGCTTGTGTCAGCTAAGAAAACAAGGTAATTAGCACGCTCTCTATAGTAACAACAGATGCACCTTCCCAATCAAAAAACTAGTATTCACACAAAGCATAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGGACTGGGACGGGATCCCGGCGAATGAGCGGCGGCAGATGGAGGAGATCATGCAGCTCGACATGGAGGAGCTCAACGTCGAGGTGGTCGACCACGACGAGGAGGACGACGATGGCCCCTTCACCTCCGTCGACGCCTTCCTCAGGTCACTCAACGCCGCTTATCGCCGTTTTTTTACCTTGCCGTTGCGACGTAGGGTTCCCAGAGATAACGATGGGGATGGAGTGGCTAGTACTTCTGCAACATTCACATTCGACGCGTCTCTAGCCTCACTGCACACCTATCTTGGTGAGGTTGATGATACACGTGGAAGAGTTGCCCTCTTAGATGCTGGCACAATCCTTAGCTTGCCAATGCTCTATCTCCAAGGTATTGAAGGTGTTGTCCTATTTCCTGGAGCTACCCTGCCTCTCAGACTAATTCAGGCCCGTGGGCAACAACGATTTCGTCTGATACGGCATTGGATCGATGTTGATGGGGTGGTGTGGGGTGATGTCAAAATTATTGAAGAAGATACTCCTCTAAGAACTCCAAGAGATGCATTTGGACAGCTAGCTGCATGTAACAGTTTCCGGCTGCACACTTCTTCACCAGCTATCAGTTTGGGCGTGTCTCCAATCAAACAACAGGATCATATTGATTCAGAACCAGATTGCGATACTCCATCACCCAAAAGTACTGCAAGTGATCATTCAGCAATGGAAACAAGGATGTGCCATTCAGGTTCACAATCGAGTAACTCAATAAAATCCTCAAATGAAGATGGAGAGCAGTTTTGGAGCCAGGAGTTACATTCTGTGAAAGGAATTGGTGTATCAGGTCATTCAGGCAAGAATACCAACATGGATGAGAATGATATTTGCTTGACACCCCTTAGATCCTTGTCAAGTGCAAGAACAAGAGATACTAAGCAGCAGCGGCGGCACCATGCCACCAGTTACTCAAAGCAACCTTTTCAGGCACCGCTATCATTTTTGCCTCGGTGGGCTTATGAAATGTACGACTCATATGTACTTGCTCGTAGGGCTGCAGATTTGTGGAGACAGATAATCACAAACCCAAGCATGGATGATCATGTGAGAAAACCAGACCTCCTGTCATTTTACATTGGAAGCAAACTTCCTGTATCAGAATCTGTGAGACAAAAATTGCTGGAGATTGATGGAATTTCATATCGCCTACAAAGGGAGATTCAGCTTCTAAAGGCCTTTAATCTCATAAAATGTAGAATTTGCAAGTCTCTTATAGCAAAACGTAGTGACATGGTGGTGATGTCTACTGATGGGCCTCTCGGTGCCTATGTCAACCCACATGGTTTTGTCCACGAGACTATTACAGTCGGCAAGGCAACTGGGCTTGCTCTTGATGGCGATCCTTCAACGGTTCACAGCTGGTTCCCAGGATACTCGTGGACGATTGCAAATTGTGCTGAATGTGAATCCAGCATAGGCTGGCTATTCAGAGCCACAAGGAAGAATCTGCGACCGAGATCCTTTTGGGGGGTCCGTAGTTCCCAAATTGCAGATGATACACAGGAAGTAGATCAGGACGAATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001473G0180 gene.
AAAAAAGAATGAAAAAATTGAAAATTGAAAATTTTAAAAAATATTTAATTATATTTGATTCAAAAAGAATATCGGCACTGAGATTTGTAAAAAAAACTTTCATTAAGATAAAGTATGGTTTCCTTTTTAGGGCATAGAGATAAAGTAGGGTTTCCTTTTCTCTGAAATCAGGGTTTCGTCGCAGTTTGTAGTAATTTCAAAATATAGTAAATGAGTATAGGAAAATTACGAAACTTTTTGTGGAGCCTCCCGTCATAGTGTTGTTGCTTTGTATAATTTTATTCGTTTAGAGAAAGAATGATTGATAAGCATCAGACGAGGTATAACCTTAAGGATGTCGTCGAAGCAAACTATCTGCTGAAACACTTGTTGTCTTTTAGAAGTTGGATAAAAAGGTATAAGGACTATTGGAGTCTCTCCTCGATGAAGTCGTCTGAACGTATACGCGTATATAGGTAGGCAGTCGATGAAGTACTTTATGAAGCTTATACATAATATGATTGAAGGGGCTGAGAACACTCGTTTTGATGATAAAGATGCCCCAAAACATGGAGTCTGTCCTCGATCACAGGAGGCAAGCAGCAAGAAACCGATAGAAAAAGTGAGGCCACAATAACAGACTGACAGGAGAGGAATCGATCAGATGGGAGGAAAACTACACTGAAAAGGGATGCACTTCTCTACGTCTGTATATGCATCAGATAGGAGGAAAACTACACTGAAAAGTGATGCACTTCTCTGCGTCTGTATATGCATGTACCTACCCTTTTTATGAGAATTTTTTTTATCTATTAATCCTTTTCAAAATTTTATTTTAAAGTTAACCTCCGCAAACTTTATTTCCAATTCTGACCTCTTTAGTCACGCCACCACCCGTGACGTGACAAAACAACACTGTCAAGCCAACCGGTATCTGGACAAGTTCTTGTCACGCCACGGGTGGTGGCGTGACCGTATTGTTTGGTCACGCCACCACCAGTAGCGTGACAAAAAGTGCTATT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001473 Download
Protein sequence
Protein sequence
MADWDGIPANERRQMEEIMQLDMEELNVEVVDHDEEDDDGPFTSVDAFLRSLNAAYRRFFTLPLRRRVPRDNDGDGVASTSATFTFDASLASLHTYLGEVDDTRGRVALLDAGTILSLPMLYLQGIEGVVLFPGATLPLRLIQARGQQRFRLIRHWIDVDGVVWGDVKIIEEDTPLRTPRDAFGQLAACNSFRLHTSSPAISLGVSPIKQQDHIDSEPDCDTPSPKSTASDHSAMETRMCHSGSQSSNSIKSSNEDGEQFWSQELHSVKGIGVSGHSGKNTNMDENDICLTPLRSLSSARTRDTKQQRRHHATSYSKQPFQAPLSFLPRWAYEMYDSYVLARRAADLWRQIITNPSMDDHVRKPDLLSFYIGSKLPVSESVRQKLLEIDGISYRLQREIQLLKAFNLIKCRICKSLIAKRSDMVVMSTDGPLGAYVNPHGFVHETITVGKATGLALDGDPSTVHSWFPGYSWTIANCAECESSIGWLFRATRKNLRPRSFWGVRSSQIADDTQEVDQDE
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above