gene PH01001410G0190
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001410:149317 - 156375(+ stand)   Name
Alternate name Locus tag PH01001410G0190
Length of gene 7059  bp Length of CDS 1836  bp
Product information
Feature type
CDS
Product name
chloroplastic group IIA intron splicing facilitator CRS1, chloroplast precursor
Alternate name
Molecular weight
(predicted)
67904.3501200003  kDa
Isoeletric point
(predicted)
4.90118026733398
Length
611  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP06455710 PH01001410:150215 T T_A
PH01SNP06455720 PH01001410:153911 T T_A
PH01SNP06455730 PH01001410:155591 G G_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_177832 2
Please click OG5_177832 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 611
Detailed signature matches
    1. SSF75471 (YhbY-like)
    2. PS51295 (CRM)
    3. PF01985 (CRS1_YhbY)
    4. SM01103 (CRS1_YhbY)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31846 (FAMILY N...)
  2. PTHR31846:SF0 (SUBF...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003723 RNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 198171 327 392 5.00E-14 smart01103 CRS1_YhbY cl00663 N
superfamily 242013 327 392 5.00E-14 cl00663 CRS1_YhbY superfamily - N
specific 198171 1 71 7.17E-14 smart01103 CRS1_YhbY cl00663 -
superfamily 242013 1 71 7.17E-14 cl00663 CRS1_YhbY superfamily - -
non-specific 190184 1 71 1.32E-13 pfam01985 CRS1_YhbY cl00663 -
non-specific 190184 327 392 1.69E-13 pfam01985 CRS1_YhbY cl00663 N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001410G0190 gene.
AGACCCACAAGGAGCGGAGAACTATCCACCTATCTGGACAGCAATACGGTGGATTTCAACTCAGAAGGCTTTGACATCTTGCAATGGTGGCAAGCCCATAAGTTAACATATCTTGTGTTATCCATACTTGCACGTGATGTGTTAACTGTTCTTGTCTCTACGATTTCCTCCGAGTCTGCTTTCAGTTTTTCTGGAAGAATATTAGAGGAGAGAAGAACAAGTCTCACAAGTGAGATGGTGGAGATCCTTCTAACTGTGAAGGACTGGGAACAAACTGATTCACGAACATAACATTCTGTGGAAAATCCAGAGTTGTCGGAGGTGTTCAAAAATCTGTACTTAAATAATAACACTGACACATAGAACAAAGATGTATTATGTATGTATAATTGTAGAGTTATAGGCTGTACTCTTTTTCTTTGCTGAGGTTTTCTCATTTTGAGTTTTTACTTGGTGAAGGTTTTAACGAGGCAGCGAGTTGAACATTAATAAAGCCCTTTATTACATTTTCAATATAATTGTTTATTTTTTTTATTTTCATGTCTACTTTAGAATTCTACCCATTTTTCTAATTTTTTTGGATTTTTTTTGTTATAACGAACCAAACGGGCTATATTTGGTCCGACGGGCTAAACGGCTCAGGCCAGCCCGGCAAAACACGAATGTCCGATGAATTGTGTCTAAGCTACCATCTCGACCCTTAAGCCGACCAGAACAAACCATATCTAACCGAGCTCGTGTCGTGCTGTGCCGTGCCGTACTGGACAGCCTGTTTGGCCAGGTCTGGTCGCGTCCTTGTTTCAGATTCCTGGAATCGTGTGCGTGCTCAAGGATAGGGGTGGAAAAAAAAGCTCGTTAGTGGGGTTCGTTGACTCGGTTCAAAATTGTTCCAAATAGACTCGTTATTTGGTCAAATATTGAAATGAGTCAATTTCGAATGAAATTGGATTTTACTTTGGCTCGGCTCGGCTCGTTAGCTCGGTCATAAAAATACTTTCAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGGATCAAGTCGAGGACCAAGGTGGGCGGCGCGGGGGTCACGCGGGAGGTCGTGGAGAAGATCAGGGAGAAGTGGAGGACGGATGAGGTGGTCAGGATCAAGGTCAGCGGCACGCCCGCTCTCAATATGCGCCTCTTCCACGAGATACTCGAGAGAAAAACAGGGGGGTTGGTAATATGGAGGTCAGGAACTTCTGTTTCTCTGTACAGGGGAGTAGCCTATGACGTACCTGAGCCCACTAAGGGAACAAATAAGACTTCTCAGGCTCTTGGTATGAAGTCCTCAATCAAAGCACCTCCTAGCCCTTCCTTGCTATCTACTGATAAAGTAAACAGCATGGAAGATAGCAATGGAGCTTTGGTATCTAATACTGAGAAAGAGGAAATAGTTGAACCAGTTCCAGAAATCAAATATGAAGATGAAATTGACAGGCTGTTGGATGAACTTGGTCCAAGATACAGCGACTGGCCTGGATCTGGTCCATTGCCAGTAGATGCAGATTTGCTTCCTGCAACTGTACCAGGTTACAAGCCCCCTTTCAGAGTTCTGCCATATGGAAAATTAACAGGTGGTGTAATGCTTTCAAGGAACAATGACTTTATAGTCTTCTACAGAGGGAAGGATTTCTTGTGCTCAGAACTCGCTGAGGCGCTGCTAGAGAGGGAAAGATTAGCAAAGTCCCTACAAGATGAGGAGCAAGCACGGCTAAATGCAGCGTCGTCTTTTGGTTCCAGCACTGAGGCATTTGTAGAGCCAACTGTAGCTGGTACTCTTGGAGAGACTCTTGAGGCTAACTCTAAGTATGGAAATAAACTGGATGAGAATTACGCGGATGAGATGACAAGAACCGTAGAAGCTGCAAGGCATGCTGACCTCGTAAGGAAGTTAGAGTGGAAGCTCTCGCTTGGAGAGAAAAAGATAGCGAAAGCTGAAAGGGTACTTGGAAAAGTTGAGACAGCCCTGAAGCCAACTGAAGGTAGAAGAGGAGTTTTTGATGGCACAATTGAAAATATGCACTTGCACTGGAAATACAGGGAACTAGTGAAAATACTAGTGAAAGCAAAGTCCTTTTCAGATGTCAAGAGGACAGCATTGTCACTTGAAGCTGAGAGTGGGGGTATTTTAGTTTCTGTGGACAAGGTCTCCAAAGGTTATGCTATTGTTGTGTTTCGTGGGAAGGACTATAGACGTCCTTCTACGCTGAGACCCAGGAATCTTTTGTCAAAGCGAAAGGCTTTAGCACGCTCCATTGAGCTTCAGAGACATGAGGCCCTCAGTCGTCATATTGCAAAGTTAAACAGAAGGGTGAATCAGCTCAAAGCGGAACTGCTCCAAATCGAAGGCGTGAAAGAGCAAGGAGATGAGGAGTTGTACGCCAAACTAGATTCTGCGTATTCGAGCGACGAGGAAGATGTGGAGGATGAGGATGATGAGGCTTATCTCAGGAGCTTTGACAATGCGGCTGCTGCCGGCGACACTGCCGAGGATGGAACCTCCCTTGACGGCAGCAACTCCAGTTGTGAAGATGACGGTGAATATGCTGAAGAAGAGGATGACGATGATGATTATGATTATGACGAGGAGGGTTTTGATTATGAAAATGATGACGACGAGGACGAAGATGGTGCACCTTCGGTAACTCCTGGTGGTAATCTACGACACGACACAGATCTAGATTGTTCTAAGAAAGAAGACCGTAGTTTAGAAGGGGGTGGCGCAGGTGAAAAGAGTAATTATGCACGCGATAATAGTAGCAGAAGAAACTCATACGGTGAGCAACCAACTGATCCGACGAACAACTGTAGTTGGACAGACGTTCTGCACAGCAAGTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001410G0190 gene.
ATAAAATAGCAGCGGAACAAGGAAACTTCAGCGGAATCCCATCAATTCACCACAGGCAACTGACTGGGACCAAGACCCTACGATCAAACACCTTCGATGAACTCCTCCTCGAAAACAGACGATGACTCCTCCTCTTCTGTTGCATGTTTTACAACAAGCATGAGTACACACCGTACTCGCAAGTCATACCACAGAAAATGCAATTATAGATGCAGGCTTATTCCAAAGGAATGGCTTCTGTGGTTCTTTTGCAGAAATGCAGCATTTGCAATTTAAATACAAGTAATAGATTGAAAGCATAATTCAAAACAAATAGACAATAATAATTTGACAGTTTTAGTTCACAAAGACACATAGCCTAAACAAGTTATTCACATAACCATATGACTTAGGTCACACAGCTCCCTTCCCAAGGTTTTCATGAAAATCTACCCCTCGTGTGAAATCCCTGAGCATGTCCATGACCGCGGACGCGGCTATTCGAATAGATTGTTTAATACTCTGCAGAGGTTGTACACTTTACCCACAAGATACAACTAGTGTAGCTAGCAGTAGCCGTAACAAAACAGTTCAGAAACTTCATCTTAACATTGACACTCCCAGTGTGCTTACAAACCGTCAGACAACCCCACACAGGAAGTCAGTCTGACACACACCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTTTTACGAGAGGCTCAGTTCAATGGCGCACAAAGTTAAGTCCTTAATTGATCAAGGCAAGACTTCCAAATAAACTACAAATCTCTATGCACACAGGTTATTAAGCTCACGCACATAGCTCCACTAAAATATCACACAGTCCACTTGCCTCCATCTAAATCATTTCCCACCCTGTTGGTTAAGTGCAACATATGCCATCAACGAGTAATAGCACACAGTGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001410 Download
Protein sequence
Protein sequence
MRIKSRTKVGGAGVTREVVEKIREKWRTDEVVRIKVSGTPALNMRLFHEILERKTGGLVIWRSGTSVSLYRGVAYDVPEPTKGTNKTSQALGMKSSIKAPPSPSLLSTDKVNSMEDSNGALVSNTEKEEIVEPVPEIKYEDEIDRLLDELGPRYSDWPGSGPLPVDADLLPATVPGYKPPFRVLPYGKLTGGVMLSRNNDFIVFYRGKDFLCSELAEALLERERLAKSLQDEEQARLNAASSFGSSTEAFVEPTVAGTLGETLEANSKYGNKLDENYADEMTRTVEAARHADLVRKLEWKLSLGEKKIAKAERVLGKVETALKPTEGRRGVFDGTIENMHLHWKYRELVKILVKAKSFSDVKRTALSLEAESGGILVSVDKVSKGYAIVVFRGKDYRRPSTLRPRNLLSKRKALARSIELQRHEALSRHIAKLNRRVNQLKAELLQIEGVKEQGDEELYAKLDSAYSSDEEDVEDEDDEAYLRSFDNAAAAGDTAEDGTSLDGSNSSCEDDGEYAEEEDDDDDYDYDEEGFDYENDDDEDEDGAPSVTPGGNLRHDTDLDCSKKEDRSLEGGGAGEKSNYARDNSSRRNSYGEQPTDPTNNCSWTDVLHSK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above