gene PH01001308G0140
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001308:113246 - 126347(- stand)   Name
Alternate name Locus tag PH01001308G0140
Length of gene 13102  bp Length of CDS 4437  bp
Product information
Feature type
CDS
Product name
PHD-finger domain containing protein
Alternate name
Molecular weight
(predicted)
162401.99712  kDa
Isoeletric point
(predicted)
8.50222396850586
Length
1478  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP06146630 PH01001308:117295 G G_A
PH01SNP06146640 PH01001308:117305 G G_A
PH01SNP06146650 PH01001308:117331 G G_T
PH01SNP06146660 PH01001308:120079 C C_A
PH01SNP06146670 PH01001308:120134 G G_A
PH01SNP06146680 PH01001308:120365 A A_C
PH01SNP06146690 PH01001308:120392 A A_T
PH01SNP06146700 PH01001308:120480 T T_C
PH01SNP06146710 PH01001308:120506 T T_C
PH01SNP06146720 PH01001308:120518 G G_A
PH01SNP06146730 PH01001308:120546 G G_A
PH01SNP06146740 PH01001308:120578 G G_A
PH01SNP06146750 PH01001308:120679 G G_T
PH01SNP06146760 PH01001308:120699 C C_G
PH01SNP06146770 PH01001308:120714 T T_A
PH01SNP06146780 PH01001308:120726 G G_A
PH01SNP06146790 PH01001308:122294 G G_A
PH01SNP06146800 PH01001308:122401 T T_G
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_189965 5
Please click OG5_189965 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g52960.1 PHD-finger domain containing protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 200 400 600 800 1000 1200 1478
Detailed signature matches
    1. SSF57903 (FYVE/PHD ...)
    1. SM00249 (PHD)
    1. PS50016 (ZF_PHD_2)
    1. PS01359 (ZF_PHD_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PF13831 (PHD_2)
  2. PF13832 (zf-HC5HC2H_2)
  3. PTHR13793 (PHD FING...)
  4. PTHR13793:SF6 (PHD ...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding
GO:0008270 zinc ion binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 206003 1167 1256 5.95E-32 pfam13832 zf-HC5HC2H_2 cl17725 -
superfamily 248279 1167 1256 5.95E-32 cl17725 zf-HC5HC2H superfamily - -
specific 206003 355 476 1.47E-29 pfam13832 zf-HC5HC2H_2 cl17725 -
superfamily 248279 355 476 1.47E-29 cl17725 zf-HC5HC2H superfamily - -
non-specific 222368 386 477 4.20E-27 pfam13771 zf-HC5HC2H cl17725 -
non-specific 222368 1201 1257 4.61E-10 pfam13771 zf-HC5HC2H cl17725 N
specific 222406 1111 1143 2.18E-08 pfam13831 PHD_2 cl17445 -
superfamily 247999 1111 1143 2.18E-08 cl17445 PHD superfamily - -
specific 222406 302 334 3.29E-07 pfam13831 PHD_2 cl17445 -
superfamily 247999 302 334 3.29E-07 cl17445 PHD superfamily - -
non-specific 201356 288 335 2.60E-05 pfam00628 PHD cl17445 -
non-specific 214584 288 334 0.000178038 smart00249 PHD cl17445 -
non-specific 201356 1099 1143 0.00539353 pfam00628 PHD cl17445 -
non-specific 214584 1099 1143 0.00876625 smart00249 PHD cl17445 -
multi-dom 227470 249 525 3.39E-35 COG5141 COG5141 - NC
multi-dom 227470 1100 1288 1.08E-15 COG5141 COG5141 - NC
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001308G0140 gene.
GAATGAGAAGATGCATTTCCCAGTTAAAAGGCAATCAAACATGAATTGAAATTGGCTTGTGAATTCATTTCTATGCATCAATTTCGTTAGCAACCAAACAAAAAAAATGAATTGTAGACTCCATTTCCAAAAAGCCCAATTTAATTCAGGGATTCAAACGGAGCCAAGAAATCCCATCAACCAAACACCCCCCTAAATGTGAACCATAGTAAAATTAGAGCAGTACTGGACTGAGTAGCATAGGACGAAAGCTATTCCATGCTAGATCGGCAGCTCTCTGAGCTTCCACAAGCCACTTTGAAGTTTGAACAATAATCGCCACAGCAGAAATTTTTATGATAAAACAACACGATGCCTTCAAGTCCTTCAGACAATCAACGTTTGGAAGTATACACCAGGCACGAGCTTTTAGGTTCAAGCACAACAAATAGAAAGGAGTACGACTACAAACTGAACAAATGTTATACATTGTCGGTGTGGCTTCCAACGGCACCAAACATAATGAAACAAAGTTACAAATCTGAAATCTGGACGGCAAGCAGAAAACACCTCTCAGAACAAAATATATTGATCCAACATATAAGTTAAAAAGCCGACTACCACACCTGACTCAAGTTATGAACTCACTAGTCAACTTTCCCGTTTGCTGTTGTCTTAACATAAAACCACGTTAATCTCTGAAACTAGTAAAAAGTCTCTCTTTTTTGCCAAAAAACCTACTGGTATTCAACAAGTCACCCGCTACCAACCAACATAAATAAGAAGTCTCAGTCTGTACTATACCGGTTATCACCGGTAATTGTCCACTGAACAGTAGTGGCTGGTCCAGATTATTTTTTAACACGTCCTTTAACTGCATTAACTGTCTCCATCCTTACAAATAACATGAATCGGACCTTGCTAGGTATTAGCAAATGCTTCTCTCCAATCCTGTGAGAACGTCACCCCTGCAGTTGTCCAAAGTCTTTTTTTTTCTTGTACAACTAAAAAGGAATGGTGAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCCGCGCCGAGGGTTCGCCGGAGGGGGCACCCCACGGCGTCGGTGTCGACCTGTACGCGCAAGCCAAGAAGGCCCTGTCCTTGCGCACGCCGTTGGAGGGCGAGGAGGCGGCGTCTAGGGTTCCGACGTTGCCCGCGCGGCTCGTGAGCTGGGCAGGGCCAGGCGACGGGCGGAAGAAGCATAAGAAGGCTCAACCTCCGGATGTGGCTGCTGGTGAGGATCCACCAGCGCCCTCTACAAAGGCAGGCGTGTGGGAGCAGTTTGAGGCGTATTTTAGGCCAGTAACCTTGGATGATATTGATATATTAATGCCAAAGTTTCCATTCAGCTACAGTGAGCTCGATTCATGCATCCTCATACCATTTGTGGGCAGTGGCAAAGAATTAGTGAACGAAGCTGAGACATTTGACGTGGCCGTGGCTGAAACAAGCTCGTACTTGGGTGTTGGTGGTGAAGAAGTGGTCAGTAACAAAGAGCGTAGCGGGCAGAGTGTGGGTTTGATTAGTAACAAAGAGCGGAGCGAGCAAAGTGTTGAGCAGGGCATACATGATGTGGTTGTGCAACAGTTGGTTAGTAACAGAGAGCGCAGTGAGCAGAGCGGAGAGCAGGGCATACATGAAGTGGTTGTTCAACGGGAAGAGTGGCCATTGGAAGTGGAGCAAGCTGGTAGCAGCGGTGGCATTGTGTCGCCAAAATGTGGAGAGGAGGCAGGAACATCACTTAATTGGCTGCTAGGAGCAAAGGAGCGATTTGTGCTCACTTCGGAGCGGCCCAACAAGAAGAGGAAGCTCTTGGGTGTGGATGCTGGGTTAGAGCAGCTTGTGCTGCTTCCATACGTGGGAGCTGATGCTGGGTCAATATGTGATGTTTGCTGTTTGGGAGAGAGTGGCGTGGTGTCCAATAGGATACTTCATTGCAACAACTGCAAGGTTTCTGTGCACCAGAAGTGTTATGGTTTGCGTGTTGTGCCAGATGGCCAGTGGTTGTGTGCTTGGTGTAAGTATTTGGAGTCAACAGGGCAGTTATCAAAGAAATATACGGGCAGCACCCTGTCAATGCCTTGTTTGTTATGCCCAAAGGAGAAAGGGGCTATAAAACCTGTAAAAGGGGAGTCTAATCGAACTGCAGATGGAGGCAGCCTAAAATTTGTGCACTTGTTTTGCAGTCTTTGGACACCAGAGGTTCTTGTTGAGGACTTGGAGTCAATGGAGCCTGTTACTAATATTGGACGTGTCCAAGAGAATCGGATGAAACTGGTGTGCAACATTTGCAAGGTTAAGCATGGTGCATGCGTTCGGTGTAGCCATGGGACATGCCGGACAGCCTTTCATCCTATATGTGCGCGAGAGTCCAAGCATCAAATGGAGATATGGGGAAAATCTGGACATCCTAATGTCGAGCTGAGAGCATTTTGCTCAAAGCATTCTGGAGTTGGATACATCAACTCTGTAGAGAAAAGTAACAATGCATCTAAGCAGAGTCCTACAGAATTGAGGTCAAAACAAGCAAACCTTATCACTAGAAAGATACCAAAACTAAGATTCACACGCAAGAACAAGGACAAATTCATGAATTATGAAACCAGTAGCTTTAACTCTGATAGCCTTATCAAAGTAGAGACCATGGAGCAAGGTGCTTTGCCCCATACTGTTGGAAGTTCAGTTACCCAAGCAATCCGAAGCATGGAAATGGATACTAATCATCCCTCAATTGGTGGGAATCTTATGAGAAATTCTGGTGATATTGCTGTAGTGCTTAGAAAGCTAATCGACCAAGGCAAGGTTAGTGTTGGTGATATAGCATCTGAAGTGGGTATTTCTTCGGAATCCTTGGAAGCTGCTCTCGTGGGTGAAACTACCACTTTTTCCCATGGTTTGAAGTTGAAAATTATCAAGTGGCTTCAAAATTCTGCACATATACCAACTGTTCAAGCAAGGACACTCAAAGGGAGCTCAGTGGTGGTGCAAGATAACAAACTAGATGGGTTTGAGGGTACAGATAGTGTCAATGTGAAGAGTTCACTGGTTCCGGATGATGACAAAGGAGCAGCAGTTGATATGTCGGGTCCTGCTGTGATGAAACCCTCCCCAACAAGATCTAGAGATAATAACAAGATTCTGAAAAATAACAAAGCAACATGTGCAACTGGAGTAACTCCTTTGCAAAATGGAAACAAAAAGATGGTTAAAGAAGGTGCTGATCGTGAGTGTTCCCCTGCTGAAGATTTTGCAAAAGAATCTACTAGAAATTTGTCCCCGGTCGGAAGCAAGGAAACTTCAAAGGAAGAGCATGAAAAATTGATATCGAACAGCATCTCAAGCAATAAAGAATTTGGTACTTCCATGGAGATACCAAATGAAAATGAAGGTACATCACTTGGAAGGAAAAGTAATGGCTTGACTAAGGCTGAACTTGGCTCGGAATCGGAGGAGGGCTTCTCTTCATTGGATCAGTGTTTTTCTCAGGGTGATAATGCTAAACATGGGTCGTATTCAGTTGAAAACGGCGTCTGCAATCGTCGTGATTGTAATACGGATCATGTTCGCGGACAACCTTGTTTCAACTTTGATGATTCTCATTCTTATATTCATCCATTCATAAAGAAAAAGATGGCTCATCTTTGGGGTCATACTTTCAAGCAGAATAAGCAGGTGCCATGTCATGCTGAAGAACCATTATGTTCTTCCGATGAGAAAAGGCCTGTGGATTCCTCAATAAAACTTGCGGAAACAACAGAAATTGCTGTGGCAGATCAAGTATCAAAAGCAAAATCCTTAGGAATCCTTGAGCATTATGATGATGATGAAGTAGGAGGAGAAATGGTGTACTTACAAACTAGGCTGCTTGACAATGCTGTTGTTCTGAAACACAGATACGAAGATTTAATAGTAAAGGTTGTCCAGAATCTTTCTCGCGAGTTGGATGCTTTCAGTAAAAGAAAATGGGACTTCATCCTTGTCAATCAGTTTCTTCGTGATGTTAGAGAAGCTAAGAAACGTGGGAGAAAAGAGAAGAGGCACAAAGAAGCTCAGGCCGTACTAGCTGCAGCTGCAGCTGCTGTTGCAGCTTCCTCTCGTAACTCCACTGTGAGAAAAGATGCAAATGATGACAGAATACCTGCTAATCAAGAGAGTTCTCCAAAATTTGGTGTTGGATCTTCAAGAGTTGGCCAGCGGACTTCTTCATTGCCACGGACCAAGGATTCAACAAAGTCATCCAACTGCAAAGTTTCACCGGATACTAACTTCAGCATTTTTCATATGCCAATTATTTCAAAAGAAAACACACTCTACTGTGATGTATGCATGCGAAGTGAAACTGCGTTGAACCGAATATTTGTCTGCTCCAGATGCAAGGCTGCTGTCCACATAGATTGCTATAGAAATCTGGGGAATTGTACTGGCCCCTGGAAGTGTGAACTTTGTGAAGATATTTCATCGGAAGCTTCTAGCACTAGCGATCAGTCGGATTGCAATGGCACAAACTTATCCTTGGTACAGTGTGGTCTGTGCCATGGCACATCTGGTGCTTTTAGAAAGACTACAGACGGGCAATGGATTCATGCTTTCTGTGCTGAGGAAAGCCTTGTAAAGGACAAAGATACTTGCTGTGTCTGCCTCCGCAGTGTTGGCGTGTGTCTAAAGTGCAATAGCGGGGACTGCCGATCCACTTTTCATCCTTCTTGTGCTAGACATGCTGGTTTCTACATGAACACAAAAGGGTACGGTAGTATGTTGCAGCACAAAGCATATTGCTGCAAACACAGCATAGAACAGAAAGAGGCTGATGCCAAACAATATGGACCTGACGAACTCAAAAGCTTGAAAAGGATGAGGGTTGAGTTGGAAAAATTGCGCCTCTTGTGTGAGAGGATAATTAAGAGAGAAAAGGTGAAGAGAGAGAGAGTTCTGTGTGATCACGACATACTTGCCAAAACAAAGGATACTGTTGTTTTCTCCTACCTTGCACCTGGAGCAAGTTCAGAATCTGCCACTACTTCGGTTAATAACAAATCATACAGTGGAACTGTGCAAAGATCTGATGATGTCACGGTGGATAGTACTATTTCTGGGAAAAACACCATCAGGTTTTCTCTTAATAACAGAGATGCTGAGAGAAACACAGCTGATAGCTCAAAGACACTGATATCGTTCAAACGGAAGTTGAGTGAGAGGGGATCTCTTGGTGGCAAGCAACTTCCGCAAAGACCAGTTACCGCCTTACAGAAATTAGAAGCCGGAGAAAAGAAGACAAAAGATAAGAAGCAGAGGGAATCATTTCAAAAGGAGCTTGTTATGACATCTGATCAAGCTTCTACACAGAACCAACGCCTTCCGAAGGGATATGTGTATGTCCCCCGTGACTCTCTTTCTAAAGAGAAGCCATGGAATCGAAATACACAGACCCATGAACCACAAGAGCCTGGTGGATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001308G0140 gene.
CGACTACTGCATGAGAGACGGCTCAATTCTTTATACACCCTCTCTCTCCTCCACATCATTTTGTATCCTACGTGGCAAGACTTGACAGTTGATATCATACCATTATACATACTCTAATACTATCCCAGTTTAGAACTATTTATTTGTTGAATGTTAGTTTCAGCTGTTAGGTTAAGGAAGGTGGCTAATAAGGCCATTGGAAAGAGTTAGACTGATTTTATTAAAGATCGTAACATTTTGGATATGTTGTATCTCTTCGTGAGATAAGAGTTACTGAGGAGAGAGGTGTTATTCTTAAACTGGATTTTGAGAAAGTTTATGATAAAATTAATTAGAAGCTCCTTGAAAATGTGATGATAGGGAGGGATTTCTCTAGTAAATGGATTAAGTGGGTTATGAGTTCAATTAAAGGGGGTAAAGGTGGGTATCAATATAAATGGGTCTGTTGGTTCTTATTTTACCACTCACAGGGGTCTAAGGCAAGGGGATCCCTTGTCCCTCTTTTGTTTAACTTAGCAGCTCATGTTTTGGCTTCTGTGATAGCTAAGGCACAACAGAAAAATTTTATTAAAGGGGTGGTGTCTAATCTAATCTCTGGGAGAGTTCTTTTACTTCAGTATGCTGATGACATAGTTCTTATAATTGAATGTAATGATGAGTACATCCTGAACCTTAAATTTCTGTTGTATTGTTTTGAATGGATGTCGGGTCTGAAAATATACTATCACAAGAGTGAAGTTTTTGTTGTTGGGTGGATAATTCTGAAGCCCAGAGAGTGGCAAATATGTTTAATTGCAAGTTAGGGCGGTTTCTCCTTACTTATCTGGTTCTATTGGGGACAGAATAGTAAGGGATAAGGTTGCAGGTAAAATCATCAGCAAGTTAGAAAACAGATTGAACAATTGGAAAAGTAGTATGTTATCATCAGGGGGTGGGTTAATTCGAGGAATAGTTGTTTGAGTAGTATTTCTACTTATACAATAGGGTTTTATAGGTTTAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001308 Download
Protein sequence
Protein sequence
MARAEGSPEGAPHGVGVDLYAQAKKALSLRTPLEGEEAASRVPTLPARLVSWAGPGDGRKKHKKAQPPDVAAGEDPPAPSTKAGVWEQFEAYFRPVTLDDIDILMPKFPFSYSELDSCILIPFVGSGKELVNEAETFDVAVAETSSYLGVGGEEVVSNKERSGQSVGLISNKERSEQSVEQGIHDVVVQQLVSNRERSEQSGEQGIHEVVVQREEWPLEVEQAGSSGGIVSPKCGEEAGTSLNWLLGAKERFVLTSERPNKKRKLLGVDAGLEQLVLLPYVGADAGSICDVCCLGESGVVSNRILHCNNCKVSVHQKCYGLRVVPDGQWLCAWCKYLESTGQLSKKYTGSTLSMPCLLCPKEKGAIKPVKGESNRTADGGSLKFVHLFCSLWTPEVLVEDLESMEPVTNIGRVQENRMKLVCNICKVKHGACVRCSHGTCRTAFHPICARESKHQMEIWGKSGHPNVELRAFCSKHSGVGYINSVEKSNNASKQSPTELRSKQANLITRKIPKLRFTRKNKDKFMNYETSSFNSDSLIKVETMEQGALPHTVGSSVTQAIRSMEMDTNHPSIGGNLMRNSGDIAVVLRKLIDQGKVSVGDIASEVGISSESLEAALVGETTTFSHGLKLKIIKWLQNSAHIPTVQARTLKGSSVVVQDNKLDGFEGTDSVNVKSSLVPDDDKGAAVDMSGPAVMKPSPTRSRDNNKILKNNKATCATGVTPLQNGNKKMVKEGADRECSPAEDFAKESTRNLSPVGSKETSKEEHEKLISNSISSNKEFGTSMEIPNENEGTSLGRKSNGLTKAELGSESEEGFSSLDQCFSQGDNAKHGSYSVENGVCNRRDCNTDHVRGQPCFNFDDSHSYIHPFIKKKMAHLWGHTFKQNKQVPCHAEEPLCSSDEKRPVDSSIKLAETTEIAVADQVSKAKSLGILEHYDDDEVGGEMVYLQTRLLDNAVVLKHRYEDLIVKVVQNLSRELDAFSKRKWDFILVNQFLRDVREAKKRGRKEKRHKEAQAVLAAAAAAVAASSRNSTVRKDANDDRIPANQESSPKFGVGSSRVGQRTSSLPRTKDSTKSSNCKVSPDTNFSIFHMPIISKENTLYCDVCMRSETALNRIFVCSRCKAAVHIDCYRNLGNCTGPWKCELCEDISSEASSTSDQSDCNGTNLSLVQCGLCHGTSGAFRKTTDGQWIHAFCAEESLVKDKDTCCVCLRSVGVCLKCNSGDCRSTFHPSCARHAGFYMNTKGYGSMLQHKAYCCKHSIEQKEADAKQYGPDELKSLKRMRVELEKLRLLCERIIKREKVKRERVLCDHDILAKTKDTVVFSYLAPGASSESATTSVNNKSYSGTVQRSDDVTVDSTISGKNTIRFSLNNRDAERNTADSSKTLISFKRKLSERGSLGGKQLPQRPVTALQKLEAGEKKTKDKKQRESFQKELVMTSDQASTQNQRLPKGYVYVPRDSLSKEKPWNRNTQTHEPQEPGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above