gene PH01001160G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001160:60 - 6463(- stand)   Name
Alternate name Locus tag PH01001160G0010
Length of gene 6404  bp Length of CDS 2775  bp
Product information
Feature type
CDS
Product name
pollen signalling protein with adenylyl cyclase activity
Alternate name
Molecular weight
(predicted)
104771.239219999  kDa
Isoeletric point
(predicted)
6.99222946166992
Length
925  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP05680780 PH01001160:117 G G_A
PH01SNP05680790 PH01001160:135 A A_C
PH01SNP05680800 PH01001160:160 G G_A
PH01SNP05680810 PH01001160:433 A A_G
PH01SNP05680820 PH01001160:2597 G G_A
PH01SNP05680830 PH01001160:2820 G G_A
PH01SNP05680840 PH01001160:2846 A A_G
PH01SNP05680850 PH01001160:2932 C C_T
PH01SNP05680860 PH01001160:2954 T T_C
PH01SNP05680870 PH01001160:3060 C C_T
PH01SNP05680880 PH01001160:3225 G G_A
PH01SNP05680890 PH01001160:3288 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_135523 27
Please click OG5_135523 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os11g28950.1 pollen signalling protein with adenylyl cyclase activity, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Domain
  3. Repeat
1 100 200 300 400 500 600 700 800 925
Detailed signature matches
    1. PR00364 (DISEASERSIST)
    1. SSF52540 (P-loop co...)
    1. PF00931 (NB-ARC)
    1. SM00369 (LRR_TYP)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR23155 (LEUCINE-...)
  2. SSF52058 (L domain-...)
GO term prediction

Biological Process

GO:0006952 defense response

Molecular Function

GO:0043531 ADP binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 221970 197 308 0.00408718 pfam13191 AAA_16 cl17189 -
superfamily 247743 197 308 0.00408718 cl17189 AAA superfamily - -
multi-dom 216202 193 458 1.89E-60 pfam00931 NB-ARC - -
multi-dom 227223 542 667 4.39E-05 COG4886 COG4886 - NC
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01001160G0010 gene.
GGCTATGGAACTGAGAAGTCCTAAGCTGCAGTCCACTTGCAAATTCCTTATGTTTACAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCAATTGTGCTGGATGCTTTTGCGTCCTACGTTGGCGACCTGCTCACCCAGGTGGCAAAAGATGAGGCGGGCATGCTGCTCGGTGTCTCCGGCGAGATCAACAAGCTGGATGGCAAGCTGCAAGTTCTTAAGGACTACCTTGCCGACGCTGAGAAGAAGCGCATCACCGACAGGCATGTTGAGGGGTGGGTGAGGAAGCTGAAGGAAGTCATGTACGATGCCACTGACATCCTAAAGCTCTGTCAGCTCAAGGCCATGGAGAGGGGTGCATCGGTGGACTTGGGGTGTTGCAACCCATTGTTGTTCTGCCTACGGAATCCCCTCTTTGCACGCGACATCGCCAGCCGCATCAAGAAGCTCAACCAGAGGCTTGACGACATCTGCGATACCGGTGCTAAGTTCAACTTCATCAAGCTGGAAGCCTACCGAGATCAAAGGGCAGCCCCTCCTCCCGCCAGTCGCACAACATCGCCGGTGTCTGAGCGGTTTGGTGTGGTTGGTGAGAAGATCGAAGAGGATACATTAGCGCTGGTGGAGGTGCTAACAAAGAAGAGGGAGACTGTCCATGCGGTCGACAATTTCCTGGTGGTAGCCATCACGGGTGTTGGTGGAATTGGCAAGACTACCCTTGCTAGGAACATCTTCAATGATGAGACCATCCAAGGGAAGTTTGACAAGACGATATGGTTGAGCGTCACACAAAACTTCAACGAGGCTGAGCTATTGAGGACTGCCATCATTGCCGCAGGGGGAGACCACCTTATGACTCAGGAGAGGTCTATGCTTGAGCCAACCCTTGTTCATGCCATCAGGGAGAAGAAGTTCTTTGTGGTGCTGGATGACATGTGGAGTGAGAGAGCATGGAATGACTTCCTCAGGACAGCATTCAGCCATGGTGCTCGAGGTAGCCGAGTCCTTGTCACCACAAGAGATGAAAGAGTTGCTCGGGGGATGAAAGCTATACATCTTCACCACGTAAACAAACTAGGGCCTAATGATGCTTGGTCTTTGCTCAAGAAACAGGTAATCTCAAGTGAGATAGATGACCCTGGGGTTGAGGCACTAAAGGATATTGGGATGGAGATTATAGGGAGATGCGACGGTTTACCACTTGCTATTAAAGTGTTAGGGGGACTCTTGTGCAGGAGAGAGAGAAACCATCGTGATTGGTCTGAGATTTTAAATAATTCTGCATGGTCAAGTGTTGAAATGCCCGAAGAGCTAAACAGTGCCTTGTACCTAAGCTACGAAGATCTATCCCCTCATTTGAAGCAGTGCTTCCTGCACTGCTCACTTTTCCCCAAAAACGCATTCCTTGGTGCTGATACAATTATTGGTATGTGGATCAGTGAAGGATTTGTTCATCCAAGCACAAATGAGCTAGAAGAGTTAGGAAGAGATTACTATGATGAGTTAATTGTGCGAAATCTTATTGAGCCAGATACATTTTATGTTGATCAGTCGCGATGCGTCATGCACGATGTTGTCCGCTCATTTGCTCAATATGTGGCTAGAGATGAAGCGCTAGTGGCTCACAATGGACAAATTAATAAAAATAAACTCAAGTCACAACAGTTTTACCGATTATCCATAGAAACCGATGATTTAGAGTGGGGTCTTCTAAAAAAGCAGAAGTCGCTGAGAACATTAATATCATTGGGCCGTACCAACCTTAAGTCCGGTGATTCATTGGATACTTTTGCAAGCCTGCGGACACTACATGTACAATCTGCAAATTTTGTCCTATTGGTTGACTCTCTGTGTCATCTCAAGCACCTAAGATACCTGGCCCTACAAAAGACCGATATATCTAGATTGCCAGATGACATCGGCAAGATGAAATTCTTGCAGCACATTAGCCTTCTAGCATGTGAAAATTTGGTGCAACTTCCTAAAAGCATTGTAAAGCTAAGACAGCTGAGATTTCTAAGACTTACTGACACAAATATAAATAAAATGCCCAAGAGGTTCCGTGATCTAACAAATATTCGGAAACTATTCGGTTTTCCAGCTCACATGGACACTAATGGTGTTTCATCGAAGGGGGGGGATTGGTGTAGTTTGGAAGAGCTAGGGCCTCTTTCTGAGCTCAGGGAACTTACACTAAAGAGTCTAGAGAATGTATCTACCAGCTCTTTAGCCACAAAGGCCATGCTTGGCGCCAAGGAGCATCTTATCTATTTGGGGCTATGCTGCACTAGTAGACTGGGAGATGATGGGTTGGTCAAAGAGGAAGGAGGTGTATCTGAGGCAGAGGAGCAACGAATTGAGGAGTTCCTACAAATCCGCCGCGCTCCAGCCATCAAACGTGTTGGGCTTGAATTCCTGCTCTGCCATCGTCATCGCCATCGCCATCCTTCCCAGATGGGGGTTGCGTTTCCCAGATTGCACGAGCTGATTTTCGGTGGAATGGTGGAATGGGAGGACTGGCAATGGGAGGAGCACGTGCAAGGCATGCCTGCCTTGGAGGAGCTTCGACTACATCGTTGCAAACTGAGGAGTTTTCCTCCTGGCCTTGCCTCGCATGCAAGGGCATTAAGGAAACTAGTGGTTTTTGATATCCAGCAACTCAACTCTCTGGAGAACTTCACTTCTGTCGTTGAGCTCAGTGTGGACGAGAACCCTGACCTGGCGAGGATCACAAATTTCCCCAAATTGAAAAAGCTTGCCATCGTGTCCTGCCGAAAGTTGGAAGTATTGGAGGGTGTGCCAGCTCTCTGGAGCCTCGAGCTGAAGGACTACAGCATTGAAACACTCCCTGGATACTTGCGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001160G0010 gene.
GCAGTGGACGCAAGCTGCAGTGATCTATTTATAGTACACAGGCAGCTAGCTAGTTGCATGTCAGAACAAATGATGCCATCACGATAGTCTCGTCATGCCGATTGAAATATATGTATTATTTGCTATATTTCAGCTTGCACGCAGATAATACTAAGCCCGGAAGATTCACACCTCGTGTGGGCCCGCATGTCAGTTTGTGGGCCCACCTACGGACGTACTCACCAAGTCAGGTCGTTGTGGCCATCTCAGAAAACAAATTCAAATTTGATTGCATAATCGTAGCGTTCTTACAATTTGTAAGAAAATATCGGACGACGTCGCAGGCTCTCAGCCACTCATTCACAACTAGGCTCAGAGCCATTCCCAGGATATTTGGGAGAGGGAGAGAAAAAGCTTGCGATGGCGTGGATAAAAACGAGAAGATAAAGAAGAGAAAATGAGTGAAAACGGTTGCATGGCGGCGAGATGAGCCTGCGATGCCACCAGATGTATGGTTACCACCAATATCCCAAAAAAATCAACTCTTGTGCCGCCTGTTCTCATCATTGCCATTAGTAGGCCTCATTAACTTGCCTGTTACGTGTTTTGTCTGGACCCAAAGGCCATTTCTTTCTAGTGGAAACTGTATCACGCACGGGCACCTTACTAGTCCCCAAAAAATCAACTCTTGTGCCGCCTGTTCCCATCATTGCCATCAGTAGGCCTCACTGACTTGCCTGTTACGTGTTTTGTCTGGACCCAGAGGCCATTTCTTTCTAGTGGAAACTGTGTTACGCACGGGCACCTTACTAGTCCCCAAAAAATCAACTCTTGTGCCGCCTGTTCCCATCATTGCCATCAGTAGGCCTCACTGACTTGCCTGTTACGTGTTTTGTCTGGACCCAGAGGCCATTTCTTTCTAGTGGAAACTGTGTCACGCACGAACACCTTACTAGTCCCCAAAAAATCAACTCTTGTACCGCCTGTTCCCATCATTGCCATCAGTAAGCCTCACTGACTTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001160 Download
Protein sequence
Protein sequence
MAIVLDAFASYVGDLLTQVAKDEAGMLLGVSGEINKLDGKLQVLKDYLADAEKKRITDRHVEGWVRKLKEVMYDATDILKLCQLKAMERGASVDLGCCNPLLFCLRNPLFARDIASRIKKLNQRLDDICDTGAKFNFIKLEAYRDQRAAPPPASRTTSPVSERFGVVGEKIEEDTLALVEVLTKKRETVHAVDNFLVVAITGVGGIGKTTLARNIFNDETIQGKFDKTIWLSVTQNFNEAELLRTAIIAAGGDHLMTQERSMLEPTLVHAIREKKFFVVLDDMWSERAWNDFLRTAFSHGARGSRVLVTTRDERVARGMKAIHLHHVNKLGPNDAWSLLKKQVISSEIDDPGVEALKDIGMEIIGRCDGLPLAIKVLGGLLCRRERNHRDWSEILNNSAWSSVEMPEELNSALYLSYEDLSPHLKQCFLHCSLFPKNAFLGADTIIGMWISEGFVHPSTNELEELGRDYYDELIVRNLIEPDTFYVDQSRCVMHDVVRSFAQYVARDEALVAHNGQINKNKLKSQQFYRLSIETDDLEWGLLKKQKSLRTLISLGRTNLKSGDSLDTFASLRTLHVQSANFVLLVDSLCHLKHLRYLALQKTDISRLPDDIGKMKFLQHISLLACENLVQLPKSIVKLRQLRFLRLTDTNINKMPKRFRDLTNIRKLFGFPAHMDTNGVSSKGGDWCSLEELGPLSELRELTLKSLENVSTSSLATKAMLGAKEHLIYLGLCCTSRLGDDGLVKEEGGVSEAEEQRIEEFLQIRRAPAIKRVGLEFLLCHRHRHRHPSQMGVAFPRLHELIFGGMVEWEDWQWEEHVQGMPALEELRLHRCKLRSFPPGLASHARALRKLVVFDIQQLNSLENFTSVVELSVDENPDLARITNFPKLKKLAIVSCRKLEVLEGVPALWSLELKDYSIETLPGYLR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above