gene PH01001074G0010
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001074:946 - 2093(+ stand)   Name
Alternate name Locus tag PH01001074G0010
Length of gene 1148  bp Length of CDS 612  bp
Product information
Feature type
CDS
Product name
aquaporin protein
Alternate name
Molecular weight
(predicted)
20388.0530199999  kDa
Isoeletric point
(predicted)
7.15372848510742
Length
203  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP05382730 PH01001074:947 A A_G
PH01SNP05382740 PH01001074:1099 G G_A
PH01SNP05382750 PH01001074:1173 C C_A
PH01SNP05382760 PH01001074:1274 A A_G
PH01SNP05382770 PH01001074:1299 C C_G
PH01SNP05382780 PH01001074:1312 C C_T
PH01SNP05382790 PH01001074:1457 A A_G
PH01SNP05382800 PH01001074:1504 G G_A
PH01SNP05382810 PH01001074:1561 T T_C
PH01SNP05382820 PH01001074:1618 T T_G
PH01SNP05382830 PH01001074:1649 A A_G
PH01SNP05382840 PH01001074:1659 T T_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_126615 8
Please click OG5_126615 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G25810.1
tonoplast intrinsic protein 4;1
tonoplast intrinsic protein 4;1 (TIP4;1); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plant-type vacuole membrane, membrane, central vacuole; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 ant
3E-67
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g13130.1 aquaporin protein, putative, expressed 1E-98
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
1 20 40 60 80 100 120 140 160 180 203
Detailed signature matches
    1. PTHR19139 (AQUAPORI...)
    2. PF00230 (MIP)
    3. PR00783 (MINTRINSICP)
    1. SSF81338 (Aquaporin...)
    1. PS00221 (MIP)
Unintegrated signatures no IPR
Unintegrated signatures
GO term prediction

Biological Process

GO:0006810 transport

Molecular Function

GO:0005215 transporter activity

Cellular Component

GO:0016020 membrane

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 177664 30 201 1.32E-58 PLN00027 PLN00027 cl00200 N
superfamily 241680 30 201 1.32E-58 cl00200 MIP superfamily - N
non-specific 215807 32 187 2.24E-45 pfam00230 MIP cl00200 N
non-specific 165733 32 201 3.10E-45 PLN00166 PLN00166 cl00200 N
non-specific 238204 32 188 1.73E-40 cd00333 MIP cl00200 N
non-specific 233156 32 187 7.28E-38 TIGR00861 MIP cl00200 N
non-specific 215085 33 188 6.66E-37 PLN00167 PLN00167 cl00200 N
non-specific 223653 32 191 1.29E-28 COG0580 GlpF cl00200 N
non-specific 165748 32 179 1.84E-25 PLN00182 PLN00182 cl00200 N
non-specific 177778 32 200 1.59E-24 PLN00184 PLN00184 cl00200 N
non-specific 240230 31 187 1.50E-19 PTZ00016 PTZ00016 cl00200 N
non-specific 235453 32 191 5.06E-19 PRK05420 PRK05420 cl00200 N
non-specific 177663 32 187 9.48E-18 PLN00026 PLN00026 cl00200 N
multi-dom 215092 32 190 8.71E-18 PLN00183 PLN00183 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic Asn-Pro-Ala signature motifs N39,P40,A41,N152,P153,A154 6 6 238204
generic amphipathic channel H37,L38,N39,G148,A149,N152,R155 8 7 238204
 
DNA sequence
Upstream 1000 bp region from PH01001074G0010 gene.
CCTCACTTAGATCGGGTTTAGGGTTTGTCGGTGGGGAGTTGCGGCTCAGGCCAACCTCGTGATAGGAGCCGCTGGCCCCCACCTCTTTTTATAGCGCAGGGTGACAGGGGCCCTCCAGCCATGGTGGGCTAGGCGTCCCCGATCAGGGCGCGAATCAAATGCCCAACTGGGCCGTTGGATCCAGTTAGGTTAGAGATCAACCTAACACATACCTCCACAAGTGCGCCCCATCCTCGATCTCCCTCATTAGATGAGCTTCAGATTTACGATGTCAAGCGAAGACTCTAGCACGACGTTCTTTCCATATCATCCAAGTTGCAGGCTTTACAATGGAATCGATTCCTCGTCTTCTTTGTGCGGCAACACGTTCTCTTGCATCAAGCCACCGATCCCTGCAAGTTGCAACCCTTGTGCGCCTGTAGGATCGAGTTAGCCCCACATAGCCAATGCAAAACGAGAATGCGATCGATACCATATCAATTTGTCTCGATAAAACGCATGATTGTACGTGAAGTTTGAAGAGGTTATCCACCGTTTCTGATCCTTCGAAACAGAGCAGACAAGATCCAGAAGCTAAGCAAACAGTGACGCTGAAGTCTGTAATCAGCCAAGCAGCATTATTAGTGAACGTGTCAACATCACTCGTGGTCAGGAGTAATTTTTCGGTATATATATAGAGCTCACAGTTATATTATATGCTGACATGATACCCAGGGTGCAATTGTCAATGGGTGTTATCATACACCAAAATTTCATTTTTACGGTGAGTACTTTTACGTAATAGGGCTCGATATGCCCACTGTTACCATACGGAGATTTTCATTGGCTAGCACGTGATTTCAGTACGTACCAACTGATCGATGTGCGTGAATGGCCGTTAATGTTTCCGATGCAACTCAAAATTAAGTCAGATCAGCAAATTTCTTGATCGTTAATGTTTACCAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
AAGACGGCCGGAGGAGCCGATCAGTCGTCGGCGTTGACGGCGGCGGCGGTGGCGCAGGCGCTGGTGGTGGCGGTGCTGGCGACGGCCGGGTTCCACATCTCCGGCGGCCACCTCAACCCGGCCGTCACGCTCGGCCTCGCCGTCGGCGGCCGCATCACCCTCTTCCGCTCCGCCCTCTACATCCTCGCCCAGCTGCTCGGCTCCTCCCTCGCCTGCGTCCTGCTCCGGTGCCTCACCGGTGGACTGGCCACTCCGGTGCACACGCTGGCAGAGGGCGTGGGCCCGGTCCAGGGCGTGCTCGCGGAGGCCGTGTTCACCTTCACGCTGCTGTTCGTCATCTGCGCGTGCATCCTCGACCCGCGGATGTCGGCGCCGGGGATCGGTCCTCTGCTCACCGGCCTCCTCGTCGGCGCCAACACCATCGCCGGCGGCGCGCTCACGGGCGCGTCCATGAACCCGGCGCGGTCGTTCGGGCCCGCGCTGGCCACCGGCGTCTGGACGCACCACTGGGTCTACTGGGTCGGTCCCCTCGCCGGCGGGCCCCTCGCCGTGGTGGTCTACGAGTGCCTGTTCATGGTCGTTGGGACCCACCAGCCGCTGCCCCAGGAGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001074G0010 gene.
ATAAAATCTTGCATTGTGGACGAGAGGAGTGTCTATGTACATTATTTGTTGGGGGCACTGCATTAAACAACGTCAAGCCCTCATCGTCGTTGCCCGTGTCGCCCGCCGTGGTCGTGTCGCACGCCATCCTCCATCGTGGCCACCACATCACTTGCCATCTCCCGTGCCATCGCCCGACGTGGTTGTGTCGCTCGCCGTCGCACATCGTGGCCACCGTGTCGCTCGCCGCCACGCAACCAAGCTACCTGACTCCAAGCCCGCTGCACGCCCGCCGCACCTGATCTCCTCACTGCTCTCACCACTGCGGGCCACCGCGCTCGCCGTCGGCGCGTGTGTTGTGGTGCGACCGAGCCACCACTACTACAAAAAGGCTAATATTGGACGCCTCATCACTAATGGTTGATTAGAACCGTTAGTATTAAATACAATCACAAACGGTTTTCGTTTAGAGACTGTTTGTGTTACTGACTGTGCTAAAAACCGTCTGTGAAGAGGTAATATCGCGGACGGTTCATATTGAAAACCATCTGTGAAGTATCACAGATGGTTTTTAACAAGAACCGTCTGTGATATTTCTAAATATCACAGACGGTTTTAAGAAAAAAATCGTATGTGATACTTCCCGTCACTCATCACAGAAGGTTTGTAGTAAAAATCATTTGTGATAATTTCACTTATTGCAGACCTGACCCTCACAGATCTGTTCTCACAGCAGGCTGCTGCTTTGAGGAGGTGGGGCTTCGAAGCCATTTGGTGAAAGGAGACCGCGGAGGAGGTGGAAATATTATTTACATCTAGTATGGTATTAGCTCATTGTCCTAATCCAAACACCTTCTCTATTCTTACGTTCTTTTAAAGGAATTTTTCTTATTAGCGCACTATCCTAATCCAAACACCTTCTCTCTATTATTTCACTCTTTTAAAGGAAAAGTGATTGTAGATCTATTTGTTCTTGACTATCTATGGTTAGTAATTTGTTCCTAAATACATTATATTCTAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001074 Download
Protein sequence
Protein sequence
KTAGGADQSSALTAAAVAQALVVAVLATAGFHISGGHLNPAVTLGLAVGGRITLFRSALYILAQLLGSSLACVLLRCLTGGLATPVHTLAEGVGPVQGVLAEAVFTFTLLFVICACILDPRMSAPGIGPLLTGLLVGANTIAGGALTGASMNPARSFGPALATGVWTHHWVYWVGPLAGGPLAVVVYECLFMVVGTHQPLPQE
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above