gene PH01001067G0070
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01001067:50203 - 59969(+ stand)   Name
Alternate name Locus tag PH01001067G0070
Length of gene 9767  bp Length of CDS 1794  bp
Product information
Feature type
CDS
Product name
serine/threonine-protein kinase receptor precursor
Alternate name
Molecular weight
(predicted)
65438.3765200003  kDa
Isoeletric point
(predicted)
5.99012374877929
Length
597  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP05358970 PH01001067:52161 G G_A
PH01SNP05358980 PH01001067:57304 T T_A
PH01SNP05358990 PH01001067:57320 A A_C
PH01SNP05359000 PH01001067:57345 T T_A
PH01SNP05359010 PH01001067:57359 C C_T
PH01SNP05359020 PH01001067:57997 A A_C
PH01SNP05359030 PH01001067:58373 C C_G
PH01SNP05359040 PH01001067:58668 A A_G
PH01SNP05359050 PH01001067:59937 G G_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127930 60
Please click OG5_127930 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 597
Detailed signature matches
    1. SM00108 (B_lectin)
    2. PF01453 (B_lectin)
    3. SSF51110 (alpha-D-m...)
    1. PF00954 (S_locus_gl...)
    1. SM00473 (PAN_AP)
    2. PS50948 (PAN)
    1. PF08276 (PAN_2)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24420 (FAMILY N...)
GO term prediction

Biological Process

GO:0048544 recognition of pollen

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238531 401 484 3.14E-25 cd01098 PAN_AP_plant cl00112 -
superfamily 241619 401 484 3.14E-25 cl00112 PAN_APPLE superfamily - -
non-specific 219774 405 469 1.80E-20 pfam08276 PAN_2 cl00112 -
non-specific 201524 277 388 2.54E-15 pfam00954 S_locus_glycop cl03036 -
superfamily 201524 277 388 2.54E-15 cl03036 S_locus_glycop superfamily - -
non-specific 237995 156 218 4.42E-12 cd00028 B_lectin cl16927 N
superfamily 237995 156 218 4.42E-12 cl16927 B_lectin superfamily - N
non-specific 214680 406 483 7.23E-09 smart00473 PAN_AP cl00112 -
multi-dom 216511 154 251 1.60E-23 pfam01453 B_lectin - -
multi-dom 214519 160 217 8.56E-11 smart00108 B_lectin - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative binding site P419,K421,L436 3 3 238531
generic mannose binding site T163,L165,K167,V169,S171,L196,T198,N200,V202,Q204 15 10 237995
generic dimerization interface W179,T181,V189,A192,V194,L196,D197,T198,G199,N200,L201,V202,I203,Q204,L205,R206,D207,G208,T209,I210,V211,W212,Q213,S214,F215,D216,H217,P218 35 28 237995
 
DNA sequence
Upstream 1000 bp region from PH01001067G0070 gene.
CGTTTCTTGGCTACTCCGACCCTGTTCTTGGCATGTTCTTGGCCCTACAATTTAACACTCTGTAGTTCTGATAGCTGCCTGATTCAGAATTCTCAATTTAGCTAGGTCGTCTAAACTTGTTCAGGTTTTGTGTTAGCATATATCGTTGGTTGTCAGTCAAATCGAAACAAGTGGTTCTAATTAGGTTTTAGGATTTCCATTTCCTCATGGTAGATTCATTTCTGCTGTGGCATCGGTAGAAAAGGATTTTTATGATTTGAGACTAGTTGGTTAAAGTTACTATACCTTTCCTTTCAATCCAAAAGTTGACCTCTAGTTGGACTTTGATATGAAATGTTGAGTGATATCATGCCTCTATTTCTATGATCTGGTTGTTTTGTGTAAAATTTCCCCTTGCACTTGATTTTCTAGCAACTGAACGCATAAGTGTTGTAGAAAAGTACATTTGGTTAGTTGAAGCATGGTGAAACTGAAACAGGTTGATTAGACATCGATGCTTTGGTAAAACCAATTGATTTCTTTTTCTGCATGGCATGACAACTTCTGGTTAGCTGAATTCTGAGACCAAGTAAACGATTAGTTGTGACTTGTGATCGTTTATTCCAAACCAATTTGGACATCGTCACGGAGTTTAACCAGAAAAAACTTGTGTCTGTTACAGCTGATCTACTAATCTCTAATGGCACTGTCGTACTGTTGTCAAGATCATGGCCTGTGTACGAGGAATGAACATTAACATTTTAATGATTAATTGAAAGGTAAAATGGTGTTTCTTGCTAAGTTTTTCTGACTTACATTCAGACTGGTACCAGCCCAGCTAGATTTTAGCACTCACGTCCAATAATTCCAACAGGTTCTAATGATTGCTGTACAGTTAAGCAAAAGCCAGCAAGCGCTCCCTGTAAATTAGCAAATCAGATGATATCACTGACCGGGAAACCAACTACAGTTTTAACTTAATTATTATGCCTATTGGTTTTGTGATCGTTTATTCCAAACGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGTGAGGTCTCCAGGGATAAGGCTCATGATGTCTCCAAGGCTGTTGTCTCCATCTGCTTCACGGGCGAGGTCCCCATTTGCTTCACAGGCGAGGTCCCCATCTGTGCCACAGGCAAGGTCCCCATCTACATTGTCTCCTGCTCTTGAGGAAACAAGAAGTGATATTGGGCATGGTAATCCCCTTCAGTTTATGATTGATCCACAAGATTTTCAAGATGCAGAACTAGATCTTGTTGCAAATTCTGCTTCAGAAATTATAGAACGCATCAAAGAGAACAGTGATCAGTGTACTATGGCTCTCAGGTCCCTCTGTCGTAGGAAAAGAGGCCTTACTGTCGAGGAGGCAAGCTTGATTGGTGTTGACAGTCTTGGTATTGATACAACATTGGTTTCACCATTCCTCTTGCACCTCTTCCTTTGCTTAAGCAAGGCAGAGGATACGGATCCCCGCATCACCAATCAGTCATCTGCGTTGCTGTCCCTGACCAACCTGTCTAAGCTAGTTGTGTCCGATTCCCTAGGCACCACTCTTTGGAAGACGGACAACAACATCACCGGAGGCGTCGGAGCTGCGGCCGTGCTGCTCGACACAGGGAACCTTGTCATTCAGTTACGCGACGGGACCATTGTGTGGCAGAGCTTTGATCATCCAACTGACACCATCCTCCCCACAATGAAAATCTGGTTGCTCCGTGGTGACAATATCGCCATTGAGCCCTTCATTTCTTGGAAGGGCCCTGACGACCCATCCACCGGCGACTTCTCCCTCGGTGGCAACTCCAAGGCGCACCCGCAGCTCTTCATGTGGCATGGTTCCCACCCGTATTGGCGCAGCTCAATTTCAAATGGCCCACCGGTCACCGGTCAGTACCCAAGGAGCTTAAGCTTCATCCTGTACTCAGCTCTTTTAAGGACCAAGAATGGCACATACTTGACGTTCACCACCTCGGACAGTTCACGGGGCTTGCATTTGCATGGTGTGCTGGACAACTCCGGTAATTTGCAGATCCTGAGCTGGGACACCAGTCGCTCGTCGTGGGCAGTACAGTACAGGTTATCTAATCATGGCTGTGACCGCTATGGCTCATGCGGACCATTTGGTTATTGCGACCTGACAGGCGTCCGTACCTGCAAGTGCCTCGATGGATTTGAACCTGTCAGTGGTGACTTCTCACATGGTTGCCGGATGAAGGAGGCGCTACAATGTGATGGTAGTGGAGAAAATTTCTTGGCGTTGCCTGGCATGAAATTGCCAGATAAGTTCTTGTATACCAGTAACATAAGCTTTGACAGGTGCACAGCATTATGCAGTAGCAACTGCTCATGCACGGCTTATGCTTACAACAATTCAACCACTTTACCTGCATCCCGGTGCTTGCTGTGGATGGGAGAGCTTATTGACACGGGAAAGCTTGGTGACAATGGTGAGAATTTATATCTTCGGCTTGCCAGCTCACGAGTAGCCATTGCTAGCATGGCCTCCACTGCCGTGCCTGCCCTGCATTGGGCATGGGAGGATGAGAAGAGGGTAAAGGTGGTAAGGCTAGAGTTTTCTCAGGACGTTGGCAGGATTGAGAGAGTAGGTCAAGAACTCCAGGAAGCCATTGCTAGCATGGCCTCCACTGCCGTGCCTGCCCTGCATTGGGCATGGGAGGATGAGAAGAGGGTAAAGGTGGTAAGGCTAGAGTTTTCTCAGGACGTTGGCAGGATTGAGAGAGTAGGTCAAGAACTCCAGGAAGGTAATGGGGGAAAGATTGTAAAAGTGATTTTCAACGTGGATGGACTAATATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01001067G0070 gene.
ATAAATTGCTCGAGATAATTGTGCATGTAAATTCATACCTGTAAGAAATGTTTGATTTTTAAAGTCTAATTATATCATAAATTCTTAAATCACGATTCTATTAATGGATTAAATTTGGGCAGATAAAAAGAGAAAGAACAACATACTGGACATTGCACTGCCAGTCGTGTCAAGTTTGCTCATACTCATATGCTTGTGGCTTGTTTGGGTCTATNNNNNNNNNNGGAGAAGGGATTGAGCAGGAGATGCTCAGGTTGCAGGATACTACGGCTCTGATACCACTTGTTAGTCGCTGGATTCTTGCACTTGGTGATAGCAAGATCCTTACTCTCATCGAGAGGATGACACTTGGAGATGGGGCAATTTTCTTTGTTTATTTCTCACACAACGCCATTCCAACCTGAGGGGTTGGGGATACAAATTTATAGGCTGCTAACCAGCCAAGCATATGCTAAGATGCTAGTCTAAGATGCTAGTCAAAAGCTGCTAAGATGCTGTCCTAGATGCTAGTCAAAAGCTGCTAAGATGCTAGTCTAAGATGCTGTCCTAGATACTAGTCAAAAGCTGCTAAGATGCTAGTCTAAAGCTGCTAAGATGCTAGTCAAAAGCCAACACAAAAGAGACTTATCCATCAACAACAATACAGACTGGACCGCTGGCAGGTTTTCACAGGGATGCCACCGGAAGGAGACACTAAGATGTGGCCAAGGAGATAGTTTCTTAACTTTGCCGACCATGAAGATTCCTGACAAGTTCTTGTATGTCAAGAATAGAAGTTTCGACGAGTGCACAACAGAATGCACTAGCAACTGCTCCTGCACAGCATATGCTTATGCCAACATTAGCATCAGGGCTATCAATGAGGATGATACAAGGTGCCTATTATGGATGGGAGATTTGATTGACATAGAGAAGCGCATTGGAGAAGGGGAAAACCTCTATATTCGGGTTAACGGATTAAGTGGTATAGTTTCTTGCTTCTCTTTCTCTACCTGCCTAAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01001067 Download
Protein sequence
Protein sequence
MVRSPGIRLMMSPRLLSPSASRARSPFASQARSPSVPQARSPSTLSPALEETRSDIGHGNPLQFMIDPQDFQDAELDLVANSASEIIERIKENSDQCTMALRSLCRRKRGLTVEEASLIGVDSLGIDTTLVSPFLLHLFLCLSKAEDTDPRITNQSSALLSLTNLSKLVVSDSLGTTLWKTDNNITGGVGAAAVLLDTGNLVIQLRDGTIVWQSFDHPTDTILPTMKIWLLRGDNIAIEPFISWKGPDDPSTGDFSLGGNSKAHPQLFMWHGSHPYWRSSISNGPPVTGQYPRSLSFILYSALLRTKNGTYLTFTTSDSSRGLHLHGVLDNSGNLQILSWDTSRSSWAVQYRLSNHGCDRYGSCGPFGYCDLTGVRTCKCLDGFEPVSGDFSHGCRMKEALQCDGSGENFLALPGMKLPDKFLYTSNISFDRCTALCSSNCSCTAYAYNNSTTLPASRCLLWMGELIDTGKLGDNGENLYLRLASSRVAIASMASTAVPALHWAWEDEKRVKVVRLEFSQDVGRIERVGQELQEAIASMASTAVPALHWAWEDEKRVKVVRLEFSQDVGRIERVGQELQEGNGGKIVKVIFNVDGLI
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above