gene PH01000985G0240
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000985:132048 - 138273(- stand)   Name
Alternate name Locus tag PH01000985G0240
Length of gene 6226  bp Length of CDS 1881  bp
Product information
Feature type
CDS
Product name
expressed_protein
Alternate name
Molecular weight
(predicted)
69882.2104200003  kDa
Isoeletric point
(predicted)
9.57706832885742
Length
626  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP05049650 PH01000985:132062 T T_G
PH01SNP05049660 PH01000985:132341 T T_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128182 2
Please click OG5_128182 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G16810.1
pumilio 24
Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRN
pumilio 24 (PUM24); FUNCTIONS IN: RNA binding, binding; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding repeat (InterPro:IPR001313), Armadillo-like helical (Inte
4E-162
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g61560.1 expressed protein 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 626
Detailed signature matches
    1. SSF48371 (ARM repeat)
    1. SM00025 (Pumilio)
    2. PS50302 (PUM)
    3. PS50303 (PUM_HD)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR13389 (UNCHARAC...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003723 RNA binding
GO:0005488 binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 153420 120 389 9.06E-05 cd07920 Pumilio cl02427 C
superfamily 243032 120 389 9.06E-05 cl02427 Pumilio superfamily - C
non-specific 153420 134 222 0.00021198 cd07920 Pumilio cl02427 NC
non-specific 153420 104 222 0.00811894 cd07920 Pumilio cl02427 NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic RNA binding site V169,F170,K173,A205,A206,D209,R244,T266,Q269,S313,S314,Q348,D386,Y387,C389 28 15 153420
 
DNA sequence
Upstream 1000 bp region from PH01000985G0240 gene.
TCAAATTCGAATGAATTCACGCATAATTACTCTTACGTTGCTACTCGATCCGATCGACTGGTTTAATGAATGCGCAGTGCCTAGAGTGACATTCAGTAATCACTAACCCACGTCCACGTGTCGATCGCATGCATTTGCAGGCGCACGCGTGCCTGACGGACAAGGCTCGCCGGAGAGCCTTCGACGCCGAGCGCTCCACCAGCTTCTGCACCGCCTGCCACCAAAGGACGAGATCGTCGTCCCTCGCGCCCACCGCCAGGCACCGGACCACCGACAGGAGGGCGGCGGCGGCGGCGGCCAACAACAGCAACGCGCAGCAGGCGCGCGGCGGCGGCAGGAGGATTCCTGCCCCGACAACGCCGCAGGCGCTGCGGGAGGTGCAGGACCGGCTCCGGGACGAGTGCCGGGTCATCGAGTCCTGCCTGCGGGCCAACGGCGCCGGCGCCCGGCGCCGCCAGTCCTTCCCTCTCTTCGACCCCTCCGACCGGCAGCGCTTCCCCGACTACCCGTATACCCGCCCGCCGCCGTTCGCAGGCTGCCGGCCGGCGGAGTTCTTGCCGTTTGAGGAGCATCTCGGTGCGGATCAATGTCAGAATCAGAGGTGGTGCAGAGGTGGCGGTAGCAGCCGTGAGTCGCCCGTGTACCAGATCAGAACGGCACCGGAGCGCACCGCAAGAACCAAACGTTCTTGGTGATGATGAACTCGACATCAGTGCCAGTGCAGATTTTTTTTTTTTGACTTATTTGCTCTCTAAGAAGTGATCAGATTTACATTTCGATTCCTTTGTCTTTCTCCGGTTGATCATCGAATTTGTTTTACGTCAGGCACTGACAGGAAAACAAATCAAAGCATATCTGTTTTAGATAAATGACATTTCTGGTTAAATGGGTTTTCAGCAGATGATAGTTCGAAAATTACAATCTAGCTCCTCGATTAAAACGAACAAAATTGGAGCGTATTTATCTTAAGAGTCAATAAATATACACCAACATAGGTACGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCGGCGGCGGCGGCGGCAACGGCATCCAGAGCCCGAAGAAGCGGAAGCGCGAGGCCGCGGGGAATCCCAAGCCGCTGGGGAAGGGGCGCGATGACAGCAAGAAGCGGAAGAGGCCCTCCGATGCCCATGCGGCGCACGGCGGCGACGGCGGCGAGGCCAAGGCGAAGAAGCAGCCGGTTACCGCCAAGGAGAAGCGCCTGTCCGCTAAGGAAATGGCGGAGTCAAGGAAGAAGAAGAGGAAGCCGAATTACAGCCTTGAGAAGGAACTCACCGTGCTTTGGGAAAAGATGAGATGTCACAATGTGAGCAAGGAGGAGAGATCCAAGCTAGTAAGCGAGTCTCTCCGTAAAATGGACGGGAAATATTTGGAAATTGCTGGATCCCATGTAACTGCACGTGTTCTTCAAACATGTGTGAAGTGGTGCTCACAGTCAGAGAGGGATGCTGTTTTTGAGTCCCTGCAGCCGCATTTGCTTACTCTTTCGCGCCAGAAATATGCTGTTTTTCTAGTAAAGAAGCTCATAAAACTTGCCACTAAAAAACAGTTTGACTGGTTCATCTCTTCTCTTCATGGTCGTGTTGCAAAACTTCTTCGTCATACTGTAGGAGCAGCAGTTGTTGACTTTGCATTTCAGCGGGCGACACAATCTCAGAAAAGAAGGCTGTTATTGGAATTGTACTCAACTGAGCTTCAGCTGTTCAAGGACCTGACTGAACAAAATTCCCGCAGTTTGTTAGAGACAATTTCCAAGCTTGGATTGCAGAAATCGTCTGTCCTGCAGTATATGACTACAGTTCTACAGCCGCTTTTGGAGAAAGGTATTGTTGAGTATTCCATAGTACACACGACCATATTGGAATACTTTACAATTGCTGATAAGACCTCAGCCTCCGACGTGATTCGTCAACTAATCCCACTTCTCACTCAAGGATCATCTGTCATAGACGGAGATGAACCATCAGTTGCCCCTGAATTGCCAAAGAAAACAAAAGCTAAGAAGAAACGGTTGTCAGAACCACTTCTCGTTCGGATCATGCAGACAAGAGAAGGATTAAAAATAGGGATTAGTTGCCTCAGGCATGGGAGTGCAAAGGATAGGAAGAAGATTATAAAAAGCTTGAAGGGGCACATTATGAAGCTTGCTCTCAATGATTATGGATGCCTTTTCCTTGTTTGCACTCTTTCCATCGTTGATGACACAAAGCTCGTTACTAAGATTGTAATTCAGGAGCTGGCAAAGCAGTTAAAGCAACTCATTTTTGACAAGGGTGAGGCACCAGAGAGCGCAACTGATGTTATATCCGAGAATAAGGTGGATGCTGCAGCTGATAAAGAGAACGGCGGGTCAGAAGGCATGCAGATTGCGGCTGACAGCAAGAAGGACCCGTCACAACGACGACATGAATTGTTGATGAAAAGTGATCTTGCTGAGGCTCTCATCCAGACTTGCATTGAAAATGTCGGGGAGTTACTTCGAACAAATTTCAGCAAAGATGTATTATATGAGGTCGCTATTGGTGGAAAAGATAATATTTTGGAGGGCATCACTGACAGGATCCACATCTTTCACAATGCAATAGCTTCAGATGCAGCTCGTCCAAAGACAGAAGATATTGAGCATGCCTTTGAGAACTTCCATTCCAGCCGTGTAATCAGAAGAATGATACTTGATTGTCCTGCATTTGCTGCTACCCTCTGGAAAAAGGCTCTTGAAGGGAAGTGCGAGATATGGGCTGATGGATACAGTTCCAAGGTGGTTGCAGCATTCCTGGAATCTCCAAACTCTAAGGTGAGGGATCTTGCAAAGCACGAGCTGCAGCCGCTGATTGATCGTGGCATTCTGAAAATCCCAGACCGTAAAGCAGTGGAGAAATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000985G0240 gene.
AGCTTGTTTGATTTAATACTTTTTTATTAATAGTTTGAAAGTATTTTAAAAACCGAGCTAACGGGTCGAGTCGAGTCAGAGAGAAATTTAATTTTATTCGAATCAATTTATTTCAATATTTAACTAATTAACAAGTGTAATTAGAGTAATTTTGAATCGAGCCAAGAAACTCTACTAACAAGCTTTTTTCCACCCCTAGTGATGATTTCACTTTGCTTGGAGCACAGGTGGTAGCAACTAGCAGTAACCTTACTAGCTTAATTTAAGAGCCCATACGCGAATTTCTCGTACCAAGTTTAGCAGTCGGTCAGGTCAGCAACTAGGGCTGAAAATGAGCTGAGCCAACTCGAGCCTGCCTCGCTCAAGCTTGGACGAAAATAGCGGCTCGACTCGTTTCAGGAACGAGCCAAAAGCTCGGCTCGGCTCAGCTCGAAAACAGGCTTGAGCTGCCTTGCGAACCCTGCCACGAGCTAGGGTGGAGGGGGTCACAGAGGGCAGCGACGCAAGAAGGACTCGCTGTCCTCGCTGGTGAAGCGATGGAAGAATTCGTCGAGGGAGAGCACGGCCGCGACGTCATTGTCCTCCTTGGGTGCACCTGTGCTGGTGGTGGAGGGGGCAACAAAGGGGGTGGTTATGAAGGACGGAGAATGGAGCGCGGTGGAGGTGGCAGGCGTCGGGGTAGGGACAGGCCTGTGGCGTTGGAGGCGGCGGCAGTCGAGGATCTTGAGCTATGCATATCGGAGGAGGAGGGGGTCACGAGAGCGCAAGGCCTAGAGCCATTCGAGGTGGTTGCAGAGGCAGGGAAGATCGGGGAAGAAGTCGCGCTCGAAGTCTTGTCAAGCACCTCCGGGCGGCGGCGCTTGGAGGAGGAAGAGGAGGTGGTGGCGATGGCGAAGGCAAAAGAGGGGGTAGGGGGTGTGGGGTAACAGGTAAAGGGGCAGGGGACGGCGAGTGGTGGCGAGGGGAGTGGTGGGGAGAGCATCGGGGATTGGGGATTGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000985 Download
Protein sequence
Protein sequence
MAGGGGGNGIQSPKKRKREAAGNPKPLGKGRDDSKKRKRPSDAHAAHGGDGGEAKAKKQPVTAKEKRLSAKEMAESRKKKRKPNYSLEKELTVLWEKMRCHNVSKEERSKLVSESLRKMDGKYLEIAGSHVTARVLQTCVKWCSQSERDAVFESLQPHLLTLSRQKYAVFLVKKLIKLATKKQFDWFISSLHGRVAKLLRHTVGAAVVDFAFQRATQSQKRRLLLELYSTELQLFKDLTEQNSRSLLETISKLGLQKSSVLQYMTTVLQPLLEKGIVEYSIVHTTILEYFTIADKTSASDVIRQLIPLLTQGSSVIDGDEPSVAPELPKKTKAKKKRLSEPLLVRIMQTREGLKIGISCLRHGSAKDRKKIIKSLKGHIMKLALNDYGCLFLVCTLSIVDDTKLVTKIVIQELAKQLKQLIFDKGEAPESATDVISENKVDAAADKENGGSEGMQIAADSKKDPSQRRHELLMKSDLAEALIQTCIENVGELLRTNFSKDVLYEVAIGGKDNILEGITDRIHIFHNAIASDAARPKTEDIEHAFENFHSSRVIRRMILDCPAFAATLWKKALEGKCEIWADGYSSKVVAAFLESPNSKVRDLAKHELQPLIDRGILKIPDRKAVEK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above