gene PH01000845G0410
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000845:262729 - 271965(- stand)   Name
Alternate name Locus tag PH01000845G0410
Length of gene 9237  bp Length of CDS 4533  bp
Product information
Feature type
CDS
Product name
auxin response factor
Alternate name
Molecular weight
(predicted)
166343.46242  kDa
Isoeletric point
(predicted)
4.7633934020996
Length
1510  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP04549020 PH01000845:265020 C C_T
PH01SNP04549030 PH01000845:265036 A A_G
Ortholog Groups (determined by OrthoMCL algorithm)
(0 result)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os04g59430.1 auxin response factor, putative, expressed 2E-129
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
1 200 400 600 800 1000 1200 1400 1510
Detailed signature matches
    1. PF01412 (ArfGap)
    2. SM00105 (ArfGap)
    3. PS50115 (ARFGAP)
    4. PR00405 (REVINTRACTNG)
    1. SSF49562 (C2 domain...)
    1. SSF101936 (DNA-bind...)
    1. PF06507 (Auxin_resp)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31384 (FAMILY N...)
  2. SSF57863 (ArfGap/Re...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent
GO:0009725 response to hormone stimulus
GO:0032312 regulation of ARF GTPase activity

Molecular Function

GO:0000166 nucleotide binding
GO:0003677 DNA binding
GO:0005515 protein binding
GO:0008060 ARF GTPase activator activity
GO:0008270 zinc ion binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 240868 45 116 2.03E-20 cd12422 RRM2_PTBP1_hnRNPL_like cl17169 -
superfamily 247723 45 116 2.03E-20 cl17169 RRM_SF superfamily - -
specific 197383 1120 1221 2.78E-19 cd10017 B3_DNA cl15242 -
superfamily 246903 1120 1221 2.78E-19 cl15242 BfiI_C_EcoRII_N_B3 superfamily - -
non-specific 176003 910 994 2.82E-35 cd04038 C2_ArfGAP cl14603 C
superfamily 246669 910 994 2.82E-35 cl14603 C2 superfamily - C
specific 216485 640 709 7.58E-33 pfam01412 ArfGap cl02464 C
superfamily 243047 640 709 7.58E-33 cl02464 ArfGap superfamily - C
non-specific 216995 1121 1222 2.77E-27 pfam02362 B3 cl15242 -
non-specific 214518 652 709 6.64E-27 smart00105 ArfGap cl02464 C
non-specific 214977 1121 1222 5.68E-20 smart01019 B3 cl15242 -
non-specific 175973 912 988 4.17E-17 cd00030 C2 cl14603 -
non-specific 214577 912 989 7.31E-15 smart00239 C2 cl14603 -
non-specific 241136 45 116 5.45E-14 cd12692 RRM2_PTBPH3 cl17169 -
non-specific 191545 1250 1328 5.59E-14 pfam06507 Auxin_resp cl05824 -
superfamily 191545 1250 1328 5.59E-14 cl05824 Auxin_resp superfamily - -
non-specific 215765 912 981 7.30E-14 pfam00168 C2 cl14603 -
non-specific 176007 912 984 4.15E-13 cd04042 C2A_MCTP_PRT cl14603 C
non-specific 241137 45 116 7.24E-13 cd12693 RRM2_PTBP1_like cl17169 C
non-specific 176005 920 987 7.31E-13 cd04040 C2D_Tricalbin-like cl14603 C
non-specific 175990 912 992 1.08E-10 cd04024 C2A_Synaptotagmin-like cl14603 C
non-specific 176037 920 984 1.16E-10 cd08391 C2A_C2C_Synaptotagmin_like cl14603 NC
non-specific 241228 45 116 5.03E-10 cd12784 RRM2_ROD1 cl17169 C
non-specific 175999 910 984 6.78E-10 cd04033 C2_NEDD4_NEDD4L cl14603 C
non-specific 241227 45 116 2.19E-09 cd12783 RRM2_PTBP2 cl17169 C
non-specific 176022 911 984 2.60E-09 cd08376 C2B_MCTP_PRT cl14603 C
non-specific 241226 45 116 5.81E-09 cd12782 RRM2_PTBP1 cl17169 C
non-specific 176014 921 1007 6.03E-09 cd04049 C2_putative_Elicitor-responsive_gene cl14603 -
non-specific 241138 43 122 7.76E-09 cd12694 RRM2_hnRNPL_like cl17169 -
non-specific 241230 45 122 8.62E-09 cd12786 RRM2_hnRPLL cl17169 -
non-specific 176031 912 984 1.03E-08 cd08385 C2A_Synaptotagmin-1-5-6-9-10 cl14603 N
non-specific 176070 912 988 1.07E-08 cd08688 C2_KIAA0528-like cl14603 -
non-specific 176063 915 986 1.29E-08 cd08681 C2_fungal_Inn1p-like cl14603 C
non-specific 176039 920 984 1.47E-08 cd08393 C2A_SLP-1_2 cl14603 N
non-specific 176010 920 989 1.78E-08 cd04045 C2C_Tricalbin-like cl14603 C
non-specific 176002 912 984 1.80E-08 cd04037 C2E_Ferlin cl14603 C
non-specific 176050 908 980 2.05E-08 cd08405 C2B_Synaptotagmin-7 cl14603 C
non-specific 176032 912 984 2.47E-08 cd08386 C2A_Synaptotagmin-7 cl14603 N
non-specific 175978 920 984 7.34E-08 cd04011 C2B_Ferlin cl14603 -
non-specific 175976 919 985 1.31E-07 cd04009 C2B_Munc13-like cl14603 N
non-specific 176001 917 984 2.12E-07 cd04036 C2_cPLA2 cl14603 C
non-specific 175985 921 985 2.28E-07 cd04018 C2C_Ferlin cl14603 NC
non-specific 176049 919 982 2.70E-07 cd08404 C2B_Synaptotagmin-4 cl14603 NC
non-specific 241134 43 110 3.55E-07 cd12690 RRM3_PTBPH1_PTBPH2 cl17169 C
non-specific 176006 919 989 3.98E-07 cd04041 C2A_fungal cl14603 -
non-specific 176004 916 991 4.88E-07 cd04039 C2_PSD cl14603 N
non-specific 176064 919 987 5.55E-07 cd08682 C2_Rab11-FIP_classI cl14603 C
non-specific 176009 921 984 1.00E-06 cd04044 C2A_Tricalbin-like cl14603 C
non-specific 241229 41 122 1.01E-06 cd12785 RRM2_hnRNPL cl17169 -
non-specific 175992 920 1000 1.05E-06 cd04026 C2_PKC_alpha_gamma cl14603 N
non-specific 176056 912 985 1.37E-06 cd08521 C2A_SLP cl14603 N
non-specific 176018 912 982 1.52E-06 cd04054 C2A_Rasal1_RasA4 cl14603 C
non-specific 175988 921 988 1.61E-06 cd04021 C2_E3_ubiquitin_ligase cl14603 C
non-specific 176047 919 979 2.03E-06 cd08402 C2B_Synaptotagmin-1 cl14603 NC
non-specific 176023 893 984 2.60E-06 cd08377 C2C_MCTP_PRT cl14603 C
non-specific 175991 912 987 2.91E-06 cd04025 C2B_RasA1_RasA4 cl14603 C
non-specific 175993 919 987 3.10E-06 cd04027 C2B_Munc13 cl14603 C
non-specific 175975 905 982 4.18E-06 cd00276 C2B_Synaptotagmin cl14603 C
non-specific 176012 908 989 1.03E-05 cd04047 C2B_Copine cl14603 -
non-specific 176011 921 982 1.74E-05 cd04046 C2_Calpain cl14603 C
non-specific 176013 917 985 1.76E-05 cd04048 C2A_Copine cl14603 -
non-specific 175998 918 982 1.92E-05 cd04032 C2_Perforin cl14603 N
non-specific 176030 919 978 3.86E-05 cd08384 C2B_Rabphilin_Doc2 cl14603 NC
non-specific 176000 920 984 7.41E-05 cd04035 C2A_Rabphilin_Doc2 cl14603 N
non-specific 176008 912 986 7.96E-05 cd04043 C2_Munc13_fungal cl14603 C
non-specific 175984 918 978 0.000111344 cd04017 C2D_Ferlin cl14603 C
non-specific 176028 912 968 0.000128489 cd08382 C2_Smurf-like cl14603 C
non-specific 176033 912 984 0.000136391 cd08387 C2A_Synaptotagmin-8 cl14603 N
non-specific 175995 912 984 0.000218254 cd04029 C2A_SLP-4_5 cl14603 N
non-specific 176021 920 982 0.000441526 cd08375 C2_Intersectin cl14603 NC
non-specific 176019 919 988 0.000627946 cd08373 C2A_Ferlin cl14603 C
non-specific 175997 912 985 0.000781409 cd04031 C2A_RIM1alpha cl14603 N
non-specific 176060 918 982 0.000810035 cd08678 C2_C21orf25-like cl14603 C
non-specific 197381 1121 1217 0.000974737 cd10015 BfiI_C_EcoRII_N_B3 cl15242 -
non-specific 176057 912 992 0.00134671 cd08675 C2B_RasGAP cl14603 -
non-specific 175996 918 984 0.00135626 cd04030 C2C_KIAA1228 cl14603 N
non-specific 176046 921 982 0.0021082 cd08401 C2A_RasA2_RasA3 cl14603 C
non-specific 176029 911 983 0.00242253 cd08383 C2A_RasGAP cl14603 C
non-specific 176048 920 978 0.00319317 cd08403 C2B_Synaptotagmin-3-5-6-9-10 cl14603 NC
non-specific 175987 913 978 0.00357033 cd04020 C2B_SLP_1-2-3-4 cl14603 NC
non-specific 175989 919 968 0.00362458 cd04022 C2A_MCTP_PRT_plant cl14603 C
non-specific 176034 919 984 0.00447006 cd08388 C2A_Synaptotagmin-4-11 cl14603 N
non-specific 175974 911 980 0.0075546 cd00275 C2_PLC_like cl14603 C
multi-dom 227651 631 709 5.88E-26 COG5347 COG5347 - C
multi-dom 178661 640 709 9.03E-15 PLN03114 PLN03114 - C
multi-dom 233508 33 122 9.66E-13 TIGR01649 hnRNP-L_PTB - C
multi-dom 227371 920 984 3.30E-08 COG5038 COG5038 - N
multi-dom 178585 915 985 6.68E-05 PLN03008 PLN03008 - C
multi-dom 227371 919 984 0.000180377 COG5038 COG5038 - NC
multi-dom 178677 652 705 0.00122802 PLN03131 PLN03131 - C
multi-dom 178666 652 734 0.0083746 PLN03119 PLN03119 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific RNA binding site R47,T49,S75,F77,R79,E84,M86,D115 15 8 240868
specific putative DNA binding site K1123,T1126,G1134,S1137,P1139,R1174,L1185,T1187,T1188,W1190,S1191 11 11 197383
 
DNA sequence
Upstream 1000 bp region from PH01000845G0410 gene.
TGCATCCATGTATGCATGCATCCACTCTCTAAATGCAACCAATCAAACAAGATTTCAGCACAGCTTGGCTAGTTCAGTCTGGATGACTCGTACGGACCAGACTAGGGACATATAGACAACCAAATACACCCAAGACACCTGAAGTGGTGCGATTCCACCGTAGACAGTAGGCTGGTCACACCACCAGCTGGAAAAAGAGAAGTGACAAGTGCATGCAAAGGTTGCCACGGACTTGAGATGTCGCAAGATCGAAGGAAAACTCGAAGGAAAAACAATATCAAAACAGTAATAGTTCCCCAAGGAAGAAATTTATCAGAGCGACACCAGTACCAGCATCAACACTGGTCTAACAGAGGGAAATTCTAAAAGGAAACAGACAGGTGCTGCTCCTCTGTAACAAAGCACCGAGGGTTGAATCACATCTCCGCTGCTTCTCTGGGTAACAGCTGCTAGAAACAAGTTAACTAGGGCGCTGGGGCTGGGCGGATCACCCAGCCTACTAAAACTCTTGGGTAACTTGCATGCATCAAACCGCAGAGGGGTGAAGCAAATCACATCAAAATGGTGAGACAGATCTGATCCAACCATCTGGAAAAGCACGGCAAACAAGCAATCAGTAAACAGGTGACCAATAACATATACTACATTCTATGTATCTAGGCTTTGCTTTTGCTTTTAAATTGATTGATTGATCCATAAAAAAACATTAGGTTGCTTCTTTTAAATTTACTAGTCGAGTGCCCGTGCGTTGCAACAGATCTCAAATAAACATATATATATTCTAAACTTGAAAAACCAATATGCATAAGGTAGATAACAGACCCAACATCGCCACCAAGTCCTTCTATAGTAGTAAAGATTGATGCAACCAAGTGCAAGCCAGTAAAGGAACATGAAGGAGAGCAATGGGCTTGTAGAATGTGGACTGTATCATCGATGAATTAGCACTAATTGCAGCGAAGGCAGGATAGTTTACATACTAAGTTATTACTAAGTCAATG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGTGTGGGAAGGGATTGATGGCGGTAGCTTAGACCAGCGACTTGATTCGAGCAGTGGCGGTGTTGGTGGGGGAGACACCCGCCACCTGTTCGGTGAAATGCCGAGCCACCAGGATGCAACCATGGGCGGCGTGCTACGCATCACCGTGAGCCATGTGCTCTATCCGGTGATGAAGGAGGTTCTACACCAGATCCTCGAGATGTATAGTGTGGAGAAGATGTCTATGTTTGAGAGAGTCAACCACGTGGAGGCCATGGTACAACTCCGACCATGGCAAGAAGCGAAGCAAGCTCGAGATGCCTTCCATGGTCAGTGCATCTACGAGGGCTGTTGCTTCCTTGATATCTTGTTGGTGCAGCCGACGCCAGACTCTGCGTCCTCTACGACTACTCGACGCGACGCGGAGGCCCCCACGATTGCCCCCGAGGTCATCGTCGCGGATGCCCGTTCATCACCATCGGACAATGGGCATGATCATGTTGACACTAGTATTGCGGATTCAGAGGTCCCTGTGGGGGAAAATTCCATTAAACAAGCCACACTTGTTATTGCTCAGTTGGAGGATAGAGCTGACAATGATAGGGAGGAAACAGTGCAATACACAGGTGCATTCGGTGCTGATGAGACTACCGAGGAAGTGGAGTCTCAAGTTGAGCAAAGAAAAGATAAAGCTGTCTGTGATGTTACTGAGTTAACAGACAGATTTGCGAAGAGAAATGAAGAGGCTCTACTGGTTGGTGAGTTGGCCAAGCATGAGACTGATGTCAGTAGCCTTCAACCTAAGGAACCATTGTCATATTCGACTGTTGAAGTAGAGAAAGAGGAGACCATGGAACCTGTTCGTTTGGAGGAAGCAACTTTAGCTTCTATTCAACAGCAGACAGCTCATTCTTTCCAAGACACTGAGGGGCAAAAGCATTCAGAGACACCTGGCAATCATATAGCTGGTAGAAATGACAACGATAAATTAGACGCAGAACTGAAGCAAGAACCTGATATGGAGGTTGTTGATGGTGTTCAGTTGCAAGCAGATCCAGCGGTTGTTGCCACTGCTTTCCATATTGAGCCAAGGTCCTCAGACTTGGTAGATAGTGAGGGAGTGAGAGTTGAACATTCAACTCCTGCTTGTGAACTTGAAACTCCAGACGATGCACCAAGAGAAGATAATGGTTCTCAAGAAAACTTCAGTTATGCTATTGCTCGTGTTGAGCTTGGTGCTTTTAAGGAACATGAAACCGTTGGTGTTGATGAAGCTGAACCCAGTTATCGGACCAGAAATGAATGTGGTGTTGTTGCTAAAGCTGAAGCCAGTTCCAATAAGGAGGACAAACCCAATGGTATTGGCAAGGATGGTGAATCAGATGGACCTACAAGGGATCCACATTTAAGAAATATGGTTGATGCTTGCTCTTTTGATGACCAATTGAATTTATGCAACATATCAACTCCATGTGACGTAGTTTCATCAGGAACTGAAAATATGGATTCCTTTTCAATTAATGAGCTAGCTTCTTCAGCTGAAAACCCATTGGAAGATACTCCTTCTCCATTCGATGATACTTGCGCTTTAGATGGGGCATGCAATGAGGTTTCCTCAGAGAATGCAGGCACATTTACTAAATCTTCTTTCCAGGTTGAGACCAAATATGTGAAAGATCTAGAATCTCCACCTGTTGATGTGATAATTCATGATGAGCACAAGGATGATGACAAAAAAGGATCTTTAATTGAGGAAGTACATATGGGCGATCGGATTGCTCAAGAATGGATGACCAAAATGGAAGCGCAGCTGAAGCGTGATGACTGTCGCCGTATCGACCTATATGGCTCTGTTATCATTCTTTATGGTCTCCCAGGACTAACGATAAATTCAAATATGAAGCTATGGTTCCTAGCAAAATATAATATGGTAAAGCTGAGTGAGTTATTGCACAGAAGTGAAAGTCACATTTGTGCTGACTGCAGTGCACCTGATCCCAAATGGGCATCAGCTAATATTGGAGTATTCATATGCCTTAAATGTTCTGGAGTTCATAGAAGTCTCGGTACACATATTTCAAAGGTTCTGTCGGTCACACTAGATCCGTGGACTGACAATGAAATTGATTCCATGATAGAAGTGGGTGTGCACCTGATCCCAAATGGGCATCAGCTAATATTGGAGTATTCATATGCCTTAAATGTTCTGGAGTTCATAGAAGTCTCGAAGTGGGTGGTAACCCTCACACCTAGTCAGAGGCTTCTTTTCATGATTATGCAGCCTCCTGTTAAACTGTCATGGGTATACCGGTCAGAGTTGATCACAACAGCACATCTATCTGATGATGACACTTCAATATATGGTTTCGTAGCATCTAAGCCCACATGGCCATCATGGCTGCTCATTGCAAGAGTGGTACTTACATTAGCAGCAATTACATCCATTATCCCAGTGAAGTATGTTGTCGAGTTGAGGGCTTTATATGCAGTGGGAGTTGGAATTACACTAGGCATCTACATATCTGTTCGGTACTTCTTCCAGGCAGTTGTTCTGTATCCTCTTCTTGTTGCAACAATTGTCTCTGCTGTTGTCTTCATAGTATTCACACATCTCCCATCTGAATCCAGCACAAGGGTTTTGCCATGGGTTTTCTCTTTCTTGGTTGCTTTGTTCCCAGTCACTTATCTGTTGGAAGGACATTTAAGAGCTAAAAGTTTTGCGGATGAGGATGTAGCAGAGAAGTTCACCAAATTAGCTATCAGGGATATGTCAAGCAGCGACCCTTATGTCGTCTTGATCCTTGGACAACAGAAAGCACAAACTTTAGTAATGAAATGCAACCTGAATCCTGTCTGGAATGAAGAACTCAAGCTCTCTATTCCTCGGCAATACGGGCCTATGAAGCTACAAGTGTTCGACCATGACGTGCTGTCCAAGGACGACATCATGGGGGAGGCCGAGATTGACCTGCAGCCGATGATCAACGCGGCAGTGGCGTTCGGCGACCCTGAGCTGCTGGGCGACATGAGTAGGGTTGTTATTCTCCCAGGAGAAGGCCCGAACCTGTATAAAATTCCCGTGTCTCCATCTTTGTGTGATTTTGAGCCTAGAGGAACCCCCGAATCAAACAATCTTTACGTCTACTACTTCCCCCACGGCCACTCCGAGCAGTGCCCCACCCCTCTCCCGGCCCCGCTCCCGCCCCCCTACATCTTCCCCTGCACCGTCGCTGCCGTCGACCTCTTCGCCGACGCCAAGACCGACGAGCCCTACGCCACCATCTCCCTCCTCCCGGGCCCCCACCGCGACCCGCCCCCCGCGCAGCCAGACCCCAACCCCAATCCCAACCACGCGGGCGGGGACGGCTCCTTCAGCTACTTCGCCAAGCAGCTCACGCAGAGCGACGCCAACAATGGCGGCGGCTTCTCCGTCCCCAGGTTCTGCGCCGACTTCATCTTCCCCAAGCTCGACTTCGAGGCCGACCCGCCCGTCCAGAAGCTCCTCATGCGGGACCTGCGGGGCAAGCCCTGGGAGTTCCGCCACATCTACCGCGGCACGCCGCGCCGCCACCTCCTCACCACCGGATGGAGCAAGTTCGTCAACGCCAAGCTGCTCGTCGCGGGCGACACCGTCGTCTTCATGCGCCGCCCCGAAGGCGAGCTGCTCGTCGGGGTGCGACGCGCGCCCAGGTTCCCCGTCTCGCTGCAAGCGACCGGGCCGCTCCGCAACGCGCGGGCGCGTGTCCCGCCCCAGGAGGTGCTGGACGCGGCGCGGCTCGCGGCGGAGGGGAGGCCGTTCACGGTCACCTACTACCCGAGGCAGGGAGCGGGGGAGTTCGTCGTGCCGCGGAAGGAAGCGGAGGACGCGATCAACAGCACCACCTGGGAGCCCGGGGTGCAGGTGCGCATGCAGGTCATGGAGGCCGAGGACTCGCGCCGCTCCGACTGGGCCAGCGGCACCGTCAAGGCCGTCGATCCCTCCATCATCTGGCGCATGCTCGAGATAGACTGGGATGACTCCACGTCATCGTCTTCAACAAAAAGCAGGCATGTTAATGCTTGGCAAGTCCAATTTGTTGGATACCCTCCTCTTCTGAAGAGGCTTAGGATTTCTGAAGGCATTCCACCTCCGTGCTCTGGAAGTGGCGCCACTGCTGACCCATTGATGGCACCGGAAAGTCAGACTATGGCGATACTACTGGGCTTACCAATTCCTGCGGGCATGCAGGGAGCCAGGCATAATGGCCCTACCGATGTACCCACTTCATCCGCTACAATATTCCACCGAGAAAATGAATCTCCGCCCAACAACTCAGTGGACATGCACTCATCTGACCTTCCTGACGAAATGAGGAGCATACAGCTGTTTGGCACCACAATCACATCACCTGTACAAAGTGCCAACAATGGTGCTTTTGAAGAAGTGAACCAAGTTCCTAATGGTTTGGTTGATGGAACTGCTAATGAAGATGCTTCTGCCACAAATCCACTTGACTGGAGTCTCAGTAAAGATGATGGCCACAACCAAAATGATTCTAGGCAAGGAGCCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000845G0410 gene.
GTTCGATCCTTCTTCAGTCGCTATCGCCTGCCTTTGTAGTCTTGACCGGTTCCCCTCTCACTTGCCTCCTGGGCCTATGGCCCACGATTGAAGCCTTCCTCACGCTAGGAGGAATCTATCTGCCTAGGGAGTGTGATCTGACCATTTGCATTCACAACTGCAAAGCCACTTGAATCGTAAATGAACACTGTGACATGACAAAGAAACTAGAAGATATTTTGTGCGCGCACATACAACATCCAAATTCCAGAGTCCTAGATCAAAAGAAAATTAATCAGCCATTTAGCATTTCTGACTAGACATACGGCGATGGGCAGTCTAACTGCCTAGCCAGAAGCTCCAATCCCATGGGATCAAATCAAATCCACACAACAGCCAAAAGTTGAAGCGAATGTTTGCGCCCATTTCAGAGCAAACCATATCATGATATCATCACATTATGAGCATAGGTCTTAGTCACTCATCAAAGCCTCCAATGCACCGAGAAATGAAACTTCAGTGGCCAGTGAGGAGGCATCGCGAGCGTTTAGAGAAGCGTGCCAGGAGAGGCGCAGGTGCAGCAAGTCGGGCCCGTGGAGGAGACGCGAAGCACAAAGCGTGCGAGGGGTAGCTGCTCCTTGGACAAGCGGCCCGGCTCCGGGAACAGCCATATGTACATGGACCGGCTCTTCTCCAGGAATACACCATCAAATTCGCAAGTCACCAGCATCAACTCACGATGAAATCTCGCAAACTGAAATCAAATTGGCGTCTAGTTAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGAATGATCGGTACCTACCGGTCCCAGATGCCGAGCTTGAAGGGCTCGGAGCGACGGTAGGAGCAGGGGGGCGAAGGTCTCGATGTGCCATTGGGCGACGCGAGAGCCCGGCAAGCTCATGGCGCCGCTCATCGCCGGAGGTGCGTCGCCGCTCAAGGCTTTGGGTGTCCACTCCTATACGGTCGCACTGCAGCG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000845 Download
Protein sequence
Protein sequence
MVWEGIDGGSLDQRLDSSSGGVGGGDTRHLFGEMPSHQDATMGGVLRITVSHVLYPVMKEVLHQILEMYSVEKMSMFERVNHVEAMVQLRPWQEAKQARDAFHGQCIYEGCCFLDILLVQPTPDSASSTTTRRDAEAPTIAPEVIVADARSSPSDNGHDHVDTSIADSEVPVGENSIKQATLVIAQLEDRADNDREETVQYTGAFGADETTEEVESQVEQRKDKAVCDVTELTDRFAKRNEEALLVGELAKHETDVSSLQPKEPLSYSTVEVEKEETMEPVRLEEATLASIQQQTAHSFQDTEGQKHSETPGNHIAGRNDNDKLDAELKQEPDMEVVDGVQLQADPAVVATAFHIEPRSSDLVDSEGVRVEHSTPACELETPDDAPREDNGSQENFSYAIARVELGAFKEHETVGVDEAEPSYRTRNECGVVAKAEASSNKEDKPNGIGKDGESDGPTRDPHLRNMVDACSFDDQLNLCNISTPCDVVSSGTENMDSFSINELASSAENPLEDTPSPFDDTCALDGACNEVSSENAGTFTKSSFQVETKYVKDLESPPVDVIIHDEHKDDDKKGSLIEEVHMGDRIAQEWMTKMEAQLKRDDCRRIDLYGSVIILYGLPGLTINSNMKLWFLAKYNMVKLSELLHRSESHICADCSAPDPKWASANIGVFICLKCSGVHRSLGTHISKVLSVTLDPWTDNEIDSMIEVGVHLIPNGHQLILEYSYALNVLEFIEVSKWVVTLTPSQRLLFMIMQPPVKLSWVYRSELITTAHLSDDDTSIYGFVASKPTWPSWLLIARVVLTLAAITSIIPVKYVVELRALYAVGVGITLGIYISVRYFFQAVVLYPLLVATIVSAVVFIVFTHLPSESSTRVLPWVFSFLVALFPVTYLLEGHLRAKSFADEDVAEKFTKLAIRDMSSSDPYVVLILGQQKAQTLVMKCNLNPVWNEELKLSIPRQYGPMKLQVFDHDVLSKDDIMGEAEIDLQPMINAAVAFGDPELLGDMSRVVILPGEGPNLYKIPVSPSLCDFEPRGTPESNNLYVYYFPHGHSEQCPTPLPAPLPPPYIFPCTVAAVDLFADAKTDEPYATISLLPGPHRDPPPAQPDPNPNPNHAGGDGSFSYFAKQLTQSDANNGGGFSVPRFCADFIFPKLDFEADPPVQKLLMRDLRGKPWEFRHIYRGTPRRHLLTTGWSKFVNAKLLVAGDTVVFMRRPEGELLVGVRRAPRFPVSLQATGPLRNARARVPPQEVLDAARLAAEGRPFTVTYYPRQGAGEFVVPRKEAEDAINSTTWEPGVQVRMQVMEAEDSRRSDWASGTVKAVDPSIIWRMLEIDWDDSTSSSSTKSRHVNAWQVQFVGYPPLLKRLRISEGIPPPCSGSGATADPLMAPESQTMAILLGLPIPAGMQGARHNGPTDVPTSSATIFHRENESPPNNSVDMHSSDLPDEMRSIQLFGTTITSPVQSANNGAFEEVNQVPNGLVDGTANEDASATNPLDWSLSKDDGHNQNDSRQGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above