gene PH01000831G0230
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000831:165979 - 168050(- stand)   Name
Alternate name Locus tag PH01000831G0230
Length of gene 2072  bp Length of CDS 648  bp
Product information
Feature type
CDS
Product name
CCT/B-box zinc finger protein
Alternate name
Molecular weight
(predicted)
23412.0689199999  kDa
Isoeletric point
(predicted)
10.1839714050292
Length
215  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP04497620 PH01000831:166008 G G_A
PH01SNP04497630 PH01000831:166855 T T_C
PH01SNP04497640 PH01000831:166872 T T_A
PH01SNP04497650 PH01000831:166927 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_144994 6
Please click OG5_144994 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os08g15050.1 CCT/B-box zinc finger protein, putative, expressed 9E-26
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 20 40 60 80 100 120 140 160 180 200 215
Detailed signature matches
    1. PS51017 (CCT)
    2. PF06203 (CCT)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31319 (FAMILY N...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 203407 139 166 2.77E-12 pfam06203 CCT cl05620 N
superfamily 203407 139 166 2.77E-12 cl05620 CCT superfamily - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000831G0230 gene.
TTGCGAATTATGAGGAAAGATTGTTACTTTTGAAATTAAAAGTTGCTACAGGATTAGAACAGTAAAAAATTCATTTTTATTCTCTAGTCCGGATCATTCGGCCTAAGCCTATCCAGTGTCCAACTCAATCTCGAAAATTGATGATGTAATTTATTTATCTTTGCAATTTTGTAAAAACCTGAATCTACGAATGCCTACAATCGTATCGTTGTGACTGATAGGTGGACGTAAAACCTGGGGTAAATTTAAAGAAGGCAATATATAAACATCCCACAAAAATAAAAGAGTTGTCAGACTTCATTTCATTCCACTAAAGAACCAGAGGGAGGGAGAATATTCCCAAGAACAAATCCTGATAAGCTCAAACCCAAAACAGACATCCTCTTTACTATAGTTTGCATGGTGACCAAACCAAATAAACAAAGCACCAATGATCGGGTCATACCTCAAAACTCAATTAAAAAAAATCTGGTGTCATCATGCTAGCTATGTGTTCAAAAAAAAAAATCACATAGATTTTATTATCTTAGCACAGGGAATTAAACTACGAAAACTACATGTGAACAATTAATCTCCTGTTCCGCCTATGGAAATAAATTTCTACACATCGAAAACCCACGTCATCAGTTAAAAAATTAGTGAGTGGGTCTTCAGCACAAACATTGATGGAGGTGTCTGGGGGCATGTGAAAGATTAATTCCCTCTTCCGCTCATGCTTGTCAGCCTGCCGACCTCCACCGTCCTCCTCCACTCCGTCGTCACTACCGTCTATCGCTGACCCGTTGTCTTCCCGAACCTCTCTCTATACTCAGGGCTCCAGTGAATCTGACCCTAAGCCAGGTGAACCTTATTCCTAACCTTGTCGCAAAATCGAATGGATCAAATTTCAAGTACTCCCATAGTGAAAAAATAATCGAGTACTCCTTACCAATCTCCTTGATGGTAAACAATGATACAACATTAACCCCATTGTAGTACTATTCATAAGAAATCATGTAGAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCGGCGGTGCTCTGCGTCCCCTGCGACGCGGCCGTCCACGCGGCGAACCCCCTGGCCTCCCACCACGAGCGCGTGCCGCTGGCGGCCGAACTCCGGCGTGTATGACCTCTTCGCGGCCGACGACGACGGCGGCTCCGCGGCGACGTCCTGGCCGACGCCAGCGCAGGGGCAGGGCAGCCCCAACAACAGCTCGTCCTGCTTCACCAGCGACAGTGGCGCGGAGCGGAGCCTGTTTGACCTTCTCTCCGACGTCGACCTCATGGTCTGCGGCGGCAGCGCCGCCCGGCCTGCCCGCGGTCGCCGCTGCGTGGAGCTCGTGGTCACCACCGGAGGCCGTCGTCGTCCCGTCGCTGCGGCGGCGGAGAGGGAGGCGAGGGTGAGGAGGTACCGCGAGAAGCGCAAGAACCGCAGGTTCCAGAAGACCATCCGCTACGCGTCCCGCAAGGCCTACGCCGAGGCGCGGCCGAGGATCAAGGGCCGCTTCGTCAAGCGCGCCGCCACCGCCGTCGCCTCAAACGACGACAGCACCGGCGCCACGGACGCCGCCGAGGCGGTCAAATTCTGGCTCTCCTCCGACGACAGCCGTGACGACAACGTAGGGTTCTACGTGGACGCTGCGGCCTACGGAGTCGTTCCAAGCTTCTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000831G0230 gene.
GTACTCCCACAATACCATACCATTTTCCTATATAGAGTAAATGAGCTTCAGCAATCCATGTTGTAGAAAATTATGACCAGTAAATAAAATTTTATTTAAAAGAACAATTACACGATGATAATCTATGTAAGAAAATGCTTCAAAACAAATTATCTCCATCATAAAATTAAATTACTATCCATGTCACCACTTCATACAATCCATTTCTCATTTTGTGAAGAATATTTGGTAAAGTGAAAAATATATAATTACTAATGCCTTTGAAATTTACATATTTATAAGAATGAGATTTGTCAATTATCTTATTTTAGATAGAGAAGAATATATTACTAAACTTAGAATAGTTGAATCAATAACGTAATTAATTAATATTAGTTGTATAGATTCATCCACCAAAGCAAGATGGTGGTAGAAAATTTCTACTATTTTTTAACCTAATATGTCAATAGCAATGGATAGACTATACATCGATTAATGGTTACATAGAGCAAAGAGAATTTAGGGTGAGGACCTCTAGATACATCAGGAACTGTGCATACTAAGCACGAATCACACATATTTTGGGCTTTGGATCTTCTCCGTTCGGAGTAGATTAATGGCTAATATGAGCGTCATTATAAAATACTTGGCGGAAATAGTATGTCATTACAAAATTTGAAACTGTTGTATTAGATAGTAGTATAGATACATAATATGTGTAAGATCAAATATTGATGCTCTTACATAAAATAGTCTATTTATTATATTACAAATGTTGTGATTACAAAAAAAAAAGAAATTATGCTTTTCTACATTATGTATATAGTTTCTCAGTTTCATTTTATAGGGACTATATAAGTAAATCAAATTTATTGCAAAATAAAAGGTGTTAATATAATTTTAATGTTATTTTTATTCTGTGCCCTTATTTATCGCTCCTTCTTGCAATTATTTGTGAACACCAACACAATCTATCATCTTTTATAATAGCTAATGGAGATATATAGCTATTTATTTAGTTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000831 Download
Protein sequence
Protein sequence
MRRCSASPATRPSTRRTPWPPTTSACRWRPNSGVYDLFAADDDGGSAATSWPTPAQGQGSPNNSSSCFTSDSGAERSLFDLLSDVDLMVCGGSAARPARGRRCVELVVTTGGRRRPVAAAAEREARVRRYREKRKNRRFQKTIRYASRKAYAEARPRIKGRFVKRAATAVASNDDSTGATDAAEAVKFWLSSDDSRDDNVGFYVDAAAYGVVPSF
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above