gene PH01000811G0380
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000811:248210 - 252643(+ stand)   Name
Alternate name Locus tag PH01000811G0380
Length of gene 4434  bp Length of CDS 945  bp
Product information
Feature type
CDS
Product name
transcription factor
Alternate name
TGA
Molecular weight
(predicted)
34872.50642  kDa
Isoeletric point
(predicted)
9.56067276000976
Length
314  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP04405710 PH01000811:248247 A A_G
PH01SNP04405720 PH01000811:248303 G G_C
PH01SNP04405730 PH01000811:248738 C C_T
PH01SNP04405740 PH01000811:248782 C C_A
PH01SNP04405750 PH01000811:250483 C C_A
PH01SNP04405760 PH01000811:251307 A A_T
PH01SNP04405770 PH01000811:251318 T T_A
PH01SNP04405780 PH01000811:251347 C C_T
PH01SNP04405790 PH01000811:251368 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_138072 5
Please click OG5_138072 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G12250.2
TGACG motif-binding factor 6
basic leucine zipper transcription factor involved in the activation of SA-responsive genes.
TGACG motif-binding factor 6 (TGA6); CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616), DNA/RNA non-specific endonuclease, active site (InterPro:IPR018
5E-137
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os07g48820.1 transcription factor, putative, expressed 8E-175
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 314
Detailed signature matches
    1. SM00338 (BRLZ)
    2. PF00170 (bZIP_1)
    3. PS00036 (BZIP_BASIC)
    4. PS50217 (BZIP)
    1. PF14144 (DOG1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22952 (CAMP-RES...)
  2. SSF57959 (Leucine z...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 206313 151 229 1.47E-43 pfam14144 DOG1 cl16653 -
superfamily 206313 151 229 1.47E-43 cl16653 DOG1 superfamily - -
specific 197664 68 116 7.08E-07 smart00338 BRLZ cl02576 C
superfamily 243100 68 116 7.08E-07 cl02576 B_zip1 superfamily - C
non-specific 201054 70 97 5.07E-05 pfam00170 bZIP_1 cl02576 C
non-specific 213400 73 116 0.00813547 cd12193 B_zip1 cl02576 -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000811G0380 gene.
CCCTCCCCCTCCACCACCTCCACCTCCCCCCCGAAGAGCTTCTCGAAGTTTCCCCCCAAATCCCTATCGCTCCTCTTCACGTCCTTCCCCCAAATCCGCCCCGCAGCGCGCGGGGTCCGAAGCTTCTGGAAGCCTCGCCGCCTGCCTCGAGAGTCTTCTAGAAGAAGCTGTGCTCGATTACGTCGCCGATTCGGTGCTGATCCCCCCCCCCCCCCCCCCCCCCATGGTCCTGGCCCGCCGCCGGCATGGCGAGCTCTAATCCGACCGCCACCGCCGATCATACACTGTATGCTCCCGCTTTGGACTCGCTCCCCCCTTCTTATTTTAAGTTTCGGTTTATAATAGTTGGTTTGGATTAACATATATTAGCATGTAGTTAGCGAGATATTATCGACAACTCTTAAGCTAGGTTGTGCTATTGGTATAGTTGTTGCAAGTTAGCATTTTTACTCGTCTTAGCTCTCCTTTTTTGTTCATTTCATTTTGTGTGTTTGTGTCATTGTTTGTGTGTGTCAGCACAGTTTCTGTACCTGTTGTATTGGGCTCATGATTGAGTAGTGAAGAACAAGCCTGGTAATGGTATTCTAATGGCTCGATTCGTATCTTTGCTCCAGTGGCACTGAGGGGAGTAGCACCGTGCAAACTGCTGTGGTCCGCCAGGGAGATTGGCAAACCTGTAGGGTTTCAGATCGACACAAGTACATCAATGTGCATATCCGTGTTCCCACGTGTTAACCTTTTGGATTGTATTATGTTTCGTACTAAGTACTTAGCAATGTGCCTTTTTCGGCAGATCATACGGTTGCATCAAAACCTGAGCAGTTACTGACTTGGATTGGAAAGAAGTAAGCATGTGCATGTACTGTGCATCGTTAATTGTATCAAATCACAGGTTTTAAGCTAATAATTTGTCAAAATTCCTTCCCTTTTTTTCACTGTGATGTATAGATTCCGACAACGATTGATCTGGCAGAACATAGGGTGGGCTCACTACCTTGCTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCAGATGCTAGTTCAAGGACTGACACGTCAACTGTTTTAGACAACGGCGATAAGAACCAGAGGACAATGCGGCGTCTGGCTCAAAATCGTGAGGCAGCAAGAAAAAGTCGGCTCAGGAAAAAGTTAGAACAAGGACAAAGTGGGGCAATCATGGCTTCTAATTCTTCAGATAGGTCTGACAGGTCTGACAAACCTTTGGACCAAAAGACAATGCGGCGTCTGGCTCAAAATCGTGAGGCAGCAAGAAAAAGTCGGCTCAGGAAAAAGGCATATGTACAGCAGCTAGAGAGCAGTAAGCTGAAACATGCACAACTAGAGCAGGAGCTCCAGAGAGCTCGCAAGCAGGGAATCTTCATTTCTAGCTCTGGAGACCAAACCCATGCCATGAGTGGAAATGGGGCATTGACTTTTGACATAGAATACACTAGATGGCTAGAGGAGCAAAATAAGCAGATAAATGAGTTGAGGACTGCAGTGAATGCTCATGCAAGTGACAGTGACCTACGCCTTATCGTAGATGGCATAATGGCACATTATGACGAAATATTCAAGGTCAAAGGTGTAGCTGCGAAGGCTGATGTGTTTCATATACTTTCAGGCATGTGGAAGACACCTGCTGAAAGGTGCTTCCTATGGCTTGGGGGTTTCCGTCCATCCGAACTTTTAAAGCTCCTAGCGAATCACCTCGAGCCTCTAACCGAGCAGCAGTTGCTGGGATTAACCAACCTCCAGCAATCTTCCCAGCAAGCAGAGGATGCACTGTCACAAGGGATGGAGGCATTGCAGCAATCCTTGGCAGAGACTTTGGCTGGATCTCTTGGTCCCTCAAGTTCTTCAGGGAATGTGGCAAACTACATGGGTCAGATGGCCATGGCCATGGGCAAGCTTGGAACACTTGAGAATTTTCTCCGCCAGGCAAGCCTCTTTGGTACATCCTTGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000811G0380 gene.
ATAAAAGTTAGATGAATTATTACTCAGGATCAGTTCCAAGTCGTTTGTAGAATTGTAGTGGCTGGAAATGCAGTTCTCCAAGTAAAATCATGTCTACTATCCTGGAGAGCTGCTGAATCACGCTTTGCGTAATAACGATGTTGTACAACAGATTATCGAGAAATGAGCAAGAGTCCATGAAGTTTAGACGGTGAATGCATGTCAAGAAAGCAAGCGAGGAGGTGCCATAATCATATTGTCGTCGTCAGCTACGCGCTGCAGAGCGTTTGTAAATGAAGCTGCGGTTCGCTGTACTCTGAAGACAGTATCTTGTCGGCAACGATCTTGTTGGCTGCCTCCGTGTAATGCGTCCCATCCCAGCTGATGTACTTGGAGACGTCCGATTCTGAGCAAGCCTTCGCCTTGGCTTCCCCAGAAGCTTTCTTCTTATTGGCCTCGAGATTGTACGGCGGCCCGCCACCGCCGCAGCATGGCATCAACGGGTTACTGAAACCTGAAACAATCGAGCAGACCAACAACAGCTGGGATTGGGAGCCCTGAAATGAATCCATCCAGAAGAATTGCGTACGTGCTGCTCCGATCCGAATTAATCGTATTGGTTACCATGTGCCGTGTGATTGACGATGAGGCCGTACTTGATGGCGTACAGGTCCACGCAGACGACGGTAGCGTTGGGAAGCTCTGCCGTCAGTCGGTGGCAGAGGCGGCTCAGCTGCGCGTTGAAGGCTTTGTCGGCGTTGTTGTGCCGGACGAGGCAGCCCGCGCGGTCGAGCTCGATGTCTCGCCGCTTCCTCCGCGCCAGCGTGCGAGGCATGCATCCAGACGGGCCCGTGTTGTACATCAAGAACTTGCGCCCGCCGGCCTCGTAAACCATCTGCATCCACATATGATTAGTTGCTGCAGCGAACGACGAACAAGGAGACCATTAATTTATCCGATACTGACAGAAGCTAACGTAACAGTACTGTGCAGAGTTAGACTGGCTGAGGAAAATTAAAATG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000811 Download
Protein sequence
Protein sequence
MADASSRTDTSTVLDNGDKNQRTMRRLAQNREAARKSRLRKKLEQGQSGAIMASNSSDRSDRSDKPLDQKTMRRLAQNREAARKSRLRKKAYVQQLESSKLKHAQLEQELQRARKQGIFISSSGDQTHAMSGNGALTFDIEYTRWLEEQNKQINELRTAVNAHASDSDLRLIVDGIMAHYDEIFKVKGVAAKADVFHILSGMWKTPAERCFLWLGGFRPSELLKLLANHLEPLTEQQLLGLTNLQQSSQQAEDALSQGMEALQQSLAETLAGSLGPSSSSGNVANYMGQMAMAMGKLGTLENFLRQASLFGTSL
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above