gene PH01000750G0690
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000750:435897 - 442169(+ stand)   Name
Alternate name Locus tag PH01000750G0690
Length of gene 6273  bp Length of CDS 777  bp
Product information
Feature type
CDS
Product name
GATA transcription factor 25
Alternate name
Molecular weight
(predicted)
28055.9258199999  kDa
Isoeletric point
(predicted)
8.17724990844726
Length
258  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP04154000 PH01000750:436598 A A_G
PH01SNP04154010 PH01000750:437185 T T_A
PH01SNP04154020 PH01000750:440804 A A_T
Ortholog Groups (determined by OrthoMCL algorithm)
(0 result)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G51600.2
ZIM-LIKE 2
member of a novel family of plant-specific GATA-type transcription factors.
ZIM-LIKE 2 (ZML2); FUNCTIONS IN: sequence-specific DNA binding, sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14
4E-48
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g52450.1 GATA transcription factor 25, putative, expressed 2E-133
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 50 100 150 200 258
Detailed signature matches
    1. PF06200 (tify)
    2. SM00979 (TIFY)
    3. PS51320 (TIFY)
    1. PS51017 (CCT)
    2. PF06203 (CCT)
    1. SM00401 (ZnF_GATA)
    2. PF00320 (GATA)
Unintegrated signatures no IPR
Unintegrated signatures
  1. SSF57716 (Glucocort...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0005515 protein binding
GO:0008270 zinc ion binding
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 238123 160 199 8.77E-09 cd00202 ZnF_GATA cl00158 C
superfamily 241648 160 199 8.77E-09 cl00158 ZnF_GATA superfamily - C
specific 203407 90 134 2.22E-18 pfam06203 CCT cl05620 -
superfamily 203407 90 134 2.22E-18 cl05620 CCT superfamily - -
non-specific 214648 160 199 2.25E-10 smart00401 ZnF_GATA cl00158 -
non-specific 109380 164 191 7.66E-09 pfam00320 GATA cl00158 N
specific 203405 34 63 9.05E-09 pfam06200 tify cl05618 -
superfamily 208355 34 63 9.05E-09 cl05618 tify superfamily - -
non-specific 198047 34 63 3.31E-08 smart00979 TIFY cl05618 -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific zinc binding site C178,C181 4 2 238123
specific DNA-binding region P165,A166,R168,C178,N179,A180,C181,G182,L183,K184,W185,A186,N187,K188 17 14 238123
 
DNA sequence
Upstream 1000 bp region from PH01000750G0690 gene.
AACGACAGTAACATGGCGAGGATGGACGAGCGACCTACGGGCGAAGCGCCAGCGCGAGGGCATCGATGGACAATAGCAGGTGCGCTCGGTTGACCGAGGAAGGAGAGAGAGAGGGACAGAGGGCGATGGGCTGGGTTGGGCACGGTCGGGTTGCAACAACCGTGGCCTGGCTCTGTCAATGGAATAGTATGAAGAGAAAGAAATGAGTAGGGAAAATGAGAAGGAAATAGGGCTAAGATGCTTTCCAAAATTCTGGTATTTTGCTTAGGAGTTTTCATGTGATGATGGGTAAAATCTGATTATTAGCTAAGGATCACTAATTGGCCTTTTGAACACTTAGAGTATTAAGTTTCGAATTTTATGATTTCGATCTTAGGCTTGCTCTTCCGGTACTATTTAGAAGGACGATACCTTAGGTTTATTTTGCTCTTATAATTTCTGATACTAGGGTTTCCATCTTCCTAGGGTTTACCTAGTAAGGGTTTCTATCTCTAAGGTTTACTGTAATTATCACATATTCTGACAAAAGAAAATGTCATTCAAATTATTCTCAAAAATGCAATCAAGGCAAAACTGAAATAACACGTAAAAAGTTTTAAAAATCCCAACTTTTTATATTATGGCATTTTTGGGATGTTACTGTGTACATAACTTCTTTTTTTTAAGAAGATGTGCATAACCAATTCATAAGTTGCTTGTGCAAAATTTCAATACAGATTGCATGTTCATAACCAGTAGTAAGATTATCTAGGTTTGTCAGCATAAGCTACAAGCTAATGCAATTCTCATATGTTCATCCCAGCAAACAGACTACAATCTAAAGACGCTAACATTATGCGTTCGTAAACTCTGAAGGCTCTATCCAGCTATAGAGGCGTATTGCTCAAATACGTGTCCCTCACACATCGTCCGGACTGACACGTACACGGTGTGTGTATATATATCCATCACACGTGCGCGCTCCCACCCATCCTCCACACAGACACGTACACGGTGTGTGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGGCGGATGGCCACGATCCCCTGCTCCCGTCGGACGGCGCCGCCGGCGAGGACGACGCCGCCGCGGCGGAGGCGCTTCTGAGCGCGGCGTCAGAACAGCTGACGCTGGTGTACCAGGGCGAGGTCTACGTCTTCGACCCCGTCCCGCCCCAAAAGGTTCAGGCTGTTCTGTTGGTACTTGGAGGGTGTGAGGTGCCTCCTGGTTTAGTAAGCATGACTGTACCTTCTGCATCTGATGAAAAGAGTACAACTGCGGCTGCCAGAAGGGTTGCTTCCTTGATGAGGTTTCGTGAGAAGAGGAAGGAAAGATGTTTTGATAAGAAAATAAGATACAGTGTGCGCAAGGAGGTTGCCCAAAAGATGAAACGGCGTAAAGGCCAGTTTGCTGGAAGGGCAGATTTTGGTGATGTTGCATGCTCTTCTGCAGCTTTTGGCTCCCCAGCTAACCGCGAGGATGATCATTTTCGAGAAACCCACTCAAGGCTTACTCCAGCAATGCGTAGGGGGCCAACTGGTCCAAGGTCCCTCTGTAATGCTTGTGGCCTAAAGTGGGCAAATAAGGGTACTCTAAGAAGTCCTTTGAATGCCCCCAAAGTGACTGTGCAGCATCCCACCAATCTGAGTAAAATGTGTGACACAGATGATAACAAAGTGATTCTTCGTGCTGAGCATAATCAAGCCACAATTAAAATTGACTCTGAGATGATCCCAGAACAGGAGCAGAAGTTAGAAGTGCTCCCACCAACCGAAGACGATAGCAAGGCACCTTCATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000750G0690 gene.
TTAAAAAGAGAGTAAACTTACTTAGTGTTGCTTAAATCATCTTGTAATTCTCAAACTTGAGTGGGGCAACGAATAGGTGAGCAATGAACAAGGTCTCTAACAGATATTTGGCAAGGTGTTTTCAATGTTTATGATAATTTTTTTCTTTTTGAGATATGAAGTAGGAAGTATAATTTAAATGTTTTGTGTGTTAACTATGTAAAGCAAAATTGAAAGATTAGTGATGTATGAAGTTGAAAAATATGAAGAGGAGGAAGGTTTGTTCATGATCAAAAAGAAGAAATTAATAGATGATTCCATGGTAAGATCCGGATGACTATAACTATGCTCGTGTGAGTAAGGATTAGTAGTTTTGTAAGGGGAAATTGGGTCAGTGACATTGCGTTCGGGCGTATTTAGAGGTCTAACATCACCTTCGTCACACATTGGAAAGCAACACCGCGAAGAGCCAAAATTCTGCCGAATAGCACTGCCATCACTGACCCAGCGTTACTGTCACGTTGCCTGCCGTTTGGCTAGTGAAAAGACTAAATTGCCCTTCCATTCGGCTGCAGAGGTGAATTGGACGCCATCATCCCATAAAAACGGAAGCCCAGCCCTAGTTTATCCCCATTTTGGCTGCTGCTCTCTCCTTGCCTTCGGGTGATTTTGCCTGTTGCTCCCTGCTTGCCTTCAGGTGATTTTTCTCCTAATCGGTCTCCTGGACTCCGGTTCGTTCTCTCTTTTCTATTTCCTTTGCCCTCAGTTTCTTTCATTTGCCTTCGGTGGAGCTCGTAATCCGTGGAAATGAGCCAAGGAGGGGACACATCTTGCTCCACTCCATCTGTGAAGTGCCCGAATTGAAATTTGGTGGTTAGGCGTAGGACGTCCAACTCTCGGAAAAATCCTGGGCGTGGGTACTACAAATGCCCTATGTATTCAGTAATTATTTGGATTCAGGATTCCATTTGGTTTTGGGTTTTGTTGTATGTGAAGAAATTTGAATTTTGTAGTTGATCTGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000750 Download
Protein sequence
Protein sequence
MAADGHDPLLPSDGAAGEDDAAAAEALLSAASEQLTLVYQGEVYVFDPVPPQKVQAVLLVLGGCEVPPGLVSMTVPSASDEKSTTAAARRVASLMRFREKRKERCFDKKIRYSVRKEVAQKMKRRKGQFAGRADFGDVACSSAAFGSPANREDDHFRETHSRLTPAMRRGPTGPRSLCNACGLKWANKGTLRSPLNAPKVTVQHPTNLSKMCDTDDNKVILRAEHNQATIKIDSEMIPEQEQKLEVLPPTEDDSKAPS
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above