gene PH01000704G0630
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000704:408933 - 417328(+ stand)   Name
Alternate name Locus tag PH01000704G0630
Length of gene 8396  bp Length of CDS 1470  bp
Product information
Feature type
CDS
Product name
phosphatidylserine synthase
Alternate name
PTDSS2
Molecular weight
(predicted)
55637.3008200001  kDa
Isoeletric point
(predicted)
8.37639999389648
Length
489  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128533 7
Please click OG5_128533 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G15110.1
phosphatidyl serine synthase family protein
phosphatidyl serine synthase family protein; FUNCTIONS IN: CDP-diacylglycerol-serine O-phosphatidyltransferase activity; INVOLVED IN: phosphatidylserine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRE
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g48060.1 phosphatidylserine synthase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. PF03034 (PSS)
    2. PTHR12615 (PHOSPHAT...)
GO term prediction

Biological Process

GO:0006659 phosphatidylserine biosynthetic process

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Metabolism Lipid metabolism Glycerophospholipid metabolism  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K08730 phosphatidylserine synthase 2 EC:2.7.8.29
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 178518 133 456 0 PLN02930 PLN02930 cl03849 -
superfamily 186602 133 456 0 cl03849 PSS superfamily - -
non-specific 145924 176 457 1.34E-135 pfam03034 PSS cl03849 -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000704G0630 gene.
TTCCTTCAAAATTCATGCGTTCTATATGAACTAAGCGTTCAAGTGAAATCTTTATGAGATTTGTGTATTTCGTTACACCTGTTAATGGATCATACCTGTCGTACATTAGGTTGTAAAGGCTAAGAGCTCATTTAGATCGAGCCTACACCAGCACACTTTAAGGGAAAGTATGCGTATAAAATATGGGTCAAAATGACGAGAAAATGTATCATAGCATAAAAGTAGGCTCGTGCTACAGATCTGTAACACCCCAACCCATCCTTTGGCCCAGAATGCTACCACCACACAAATATCATCACGAACTTTGCGCAGCTAATTTACCAACTAGGTATATTACAGCAAAAGTGGTTATATAGGGAGTATGGTTTGCATCAGTGTCTGCATGTGACGTGGATATGCTATTCTCCCTTCCCGATGCATGTCGTCTTCAACGTTCACCTAAGCCAATAAATAAACAAGGGTGAGTCCAAAGACTCAGCAAATATATAATAAAGCCATAAACAATAGTTTATCAACCATCATCAACGTTATCATCATCATCTATCTATTTAATACCATTCTTATACTCAAATAAACAAGTTATACATGGGTAAATTTGCACAATTTAACAATTTACTCATATATACTAATGCACCATCAAGCTTATCCTCATATGCATATCATCAGCTGATACCGATATAGCGGGGTGTTCACCCGTCTATGACACACTCTTCCCTTATCTTCGTTAGGATGGGGTCATTACATTGTAGGACTTTAACTAGTCTCTACAAATGTAAGACTTTATCTAGAGCACTCCGGATTAGTCATGTATCTTTCTTACTAACCTCACCAGAATAGTTACATGACTTTCTCACCGACCTGGCTCGTGCATTCTTACCATAATGAATGTAAATGATGAAACATCATAATTAATCATTTACACAACTCATCTCATTAACTTAATATATCATTCCCATTATCTCCGTATCATAATCTCATTAACTCGATGTCATCAATATCAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGTCACCCCGGCCTACTCCCCGTTGCTATGCGCCGCCGCCGGCCTCTACGGCCCGGCCCGCGCTGCCTACGCTTGGCTCTCCGTGTGCCGCCCCCCTAGCTGCTCGGCTCGGCCGTACCTCCCGGCTTGGCCTACGTCTTGCTTGCCTCCTACGAGCTCTACCCCGAGAAAGTCTACTCTTACCCCGCTATACCGGTTTGCATTGCATCCCCTGTCCCTCTGATCGGGACCTGCTCGACGTATTTGTTGCCTCCGACGAGCCGGCCATGGAGGTGAACGGTGGAAAGGGCGCTTGCAAGAAGGACCAAAGGATGAAGAACAGCGACGGGAGTGGGTTGCCGTCGGACGGCGTCGGCGGCAGTGTGGAGGAATACGACCCGTGGACGGCTTGGCTTTACAAGCCGCGCACGATTTCAGTTCTCCTTGTCGGCGCATGCCTCCTCATCTGGGCAAGTGGAGCCCTTGATCCAGAGGGTGCAACTTCTCATAATACGACATCTATTAAGACGATACTTATCAGGCCACACCCTGCTGTGTGGCGCTTGGTGCATGGAATGGCTGTTGTGTACCTTATCGCTCTTACTTTTCTTCTTTTCCAGAACCGCGATGATGCACGGCAGTTCATGAAACACCTTCACCCTGATCTTGGAGTTGAATTACCAGAGCGATCATATGGATATGACTGCCGTCTGTATGTTCCAGAAAACCCTAAAAACAAGTTCATAAATGTTCATGAGACATTATTTGATGAATTTGTTATTGCCCATGTCTTGGGTTGGTGGGGTAAGGCAGTGATGATACGGAATCAACTTATCCTATGGGTCTTGTCAATCGGTTTTGAGCTCATGGAGCTTACGTTTAGGCACATGTTGCCGAATTTTAACGAGTGTTGGTGGGATAGTATTATATTGGATATTTTTGTCTGCAATTGGTTTGGAATTTGGGCTGGAATGCATACTGTCCGTTACTTTGATGGGAAAACATATGAATGGGTTGGACTGAGCCGCCAGCCAAGCATCATGGGTAAGAGTATAATCAAAGATGAGTTACTCTATGACTGTGCTGTGCATTTACTGTGCAAGAGTAAAGCCGTAAAGGTAAAAAGGTCATTGTGTCAGTTCACTCCCGCAAAATGGGATAAGGATCAATGGCGCCCTTTCATGGGGCCATGGAGGTTCATCCAAGTGTTGTGCCTCTGCATTGCTTTCATGACAGTGGAGCTTAACACATTCTTCCTTAAATTTTGTCTCTGGATTCCTCCTAGGAATCCCTTGGTTGTGTACAGGCTGATTCTTTGGTGGCTAATTGCTATACCGACCATTCGTGAGTACAACTCCTACTTGCAGGACAGCAACATTACCAGGTTTGTTTCACGATCCAATGCCGACTTGGTTGATTATTTGTTGGAGCTCAGTGGGGATTTCACTTGTGCTTTTCTTGCTGGCATGGTCTTGGAGGAATCATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000704G0630 gene.
ATAAAACAGTATTTCTAATTTACTACTGCGCAATATGTTTTTTTCCCCTTACAACTTGTGATACTTTGAGTCGGATTCTCAGTTATTATATCAACATATCCGCGGGATTGGTTGCATGTGCATCATCTACTGAACTGATCATGACAACAGAGCATTTGTATGAATTTTCGTCTTTTTTTAAGGAAGTGCAGAAACTTTGCACATCATTTCATTAAGATGAAAATAATACAGAAATGACCAAGAGAGTAACATAGATGAGAAAAAAAAACAAAGAGGCCTGAGGCCATACGTAAAACAGAAGATGATGAAACATATGTACGACCGAAAAACTACTACTCCTCAGCGGGCGACACCGACACCATGCGCCAAATGCGGTGCTCGCTAAGAGTGCGTAGAAGTAGCTGATCGATAGTAGTGGCATTATTATTGAAAATCCTTTGGTTGCGCTCCTTCCAGATCATCCATCAGACGAGTATTATGCACGAATCCAAGTCCTTCCTGCATTGCTTAGGTACGTAGCTCCTGACGGCAATCCAATGATCTTGTAGAGAGGCCTGACCTACGGGAACGGCACAAAGCAATCTGACCTAATTTAGGAAACACGCTCAAACTTGTGCTGTCACCGCACAACCAACTAGAAGGTGATCGATAGTCTCCTGCACGTGCCTACAGAAGACGCAAACTCCTTGGATTGGCAATCCTCGGCGTTGGAGGCGATCTGCCGTCCAGCAGCATCGGCGGATCGCTAGCCAAATGAAGATTTTGCATCTGAGGGGAGCCCTGGCTCTCCAAATGGCCTCTGCGCATGGGAACTGAATCGAACCCATGAAGAAAACCCAGTAAGCCGACTTAGAGGAGTAGCAACCCGAGCTTTCCCATCGCCAAAGAATCGGGTCGACCCCTCCCTGAGTTAACTGCAAAGGTTGCAAGGTATCCCATAGCCGCAGGAATTCCGAAATGATACCAGGTTCTGGTTGCCCCGAAATGTCCAAAATCCAAAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000704 Download
Protein sequence
Protein sequence
MASPRPTPRCYAPPPASTARPALPTLGSPCAAPLAARLGRTSRLGLRLACLLRALPRESLLLPRYTGLHCIPCPSDRDLLDVFVASDEPAMEVNGGKGACKKDQRMKNSDGSGLPSDGVGGSVEEYDPWTAWLYKPRTISVLLVGACLLIWASGALDPEGATSHNTTSIKTILIRPHPAVWRLVHGMAVVYLIALTFLLFQNRDDARQFMKHLHPDLGVELPERSYGYDCRLYVPENPKNKFINVHETLFDEFVIAHVLGWWGKAVMIRNQLILWVLSIGFELMELTFRHMLPNFNECWWDSIILDIFVCNWFGIWAGMHTVRYFDGKTYEWVGLSRQPSIMGKSIIKDELLYDCAVHLLCKSKAVKVKRSLCQFTPAKWDKDQWRPFMGPWRFIQVLCLCIAFMTVELNTFFLKFCLWIPPRNPLVVYRLILWWLIAIPTIREYNSYLQDSNITRFVSRSNADLVDYLLELSGDFTCAFLAGMVLEES
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above