gene PH01000639G0270
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000639:208379 - 211774(+ stand)   Name
Alternate name Locus tag PH01000639G0270
Length of gene 3396  bp Length of CDS 1662  bp
Product information
Feature type
CDS
Product name
DnaK family protein
Alternate name
Molecular weight
(predicted)
61220.4739200002  kDa
Isoeletric point
(predicted)
8.05340194702148
Length
553  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_126588 17
Please click OG5_126588 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G02500.2
heat shock cognate protein 70-1
encodes a member of heat shock protein 70 family.
heat shock cognate protein 70-1 (HSC70-1); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cold, response to virus, response to heat; LOCATED IN: cytosol, apoplast, chloroplast, plasma membrane, membrane; EXPRESSED IN: 27 plant struct
2E-158
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. PF00012 (HSP70)
    2. PR00301 (HEATSHOCK70)
    1. PS00329 (HSP70_2)
    2. PS00297 (HSP70_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR19375 (HEAT SHO...)
  2. SSF100920 (Heat sho...)
  3. SSF100934 (Heat sho...)
  4. SSF53067 (Actin-lik...)
  5. SSF57889 (Cysteine-...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 212675 8 250 0 cd10233 HSPA1-2_6-8-like_NBD cl17037 C
superfamily 247684 8 250 0 cl17037 NBD_sugar-kinase_HSP70_actin superfamily - C
non-specific 212681 6 251 2.05E-157 cd10241 HSPA5-like_NBD cl17037 C
non-specific 212676 1 251 3.85E-113 cd10234 HSPA9-Ssq1-like_NBD cl17037 C
non-specific 212683 6 250 1.47E-111 cd11733 HSPA9-like_NBD cl17037 C
non-specific 212667 9 254 9.07E-110 cd10170 HSP70_NBD cl17037 C
non-specific 212684 9 319 6.43E-101 cd11734 Ssq1_like_NBD cl17037 C
non-specific 212670 7 241 2.39E-85 cd10228 HSPA4_like_NDB cl17037 C
non-specific 212677 9 242 1.09E-82 cd10235 HscC_like_NBD cl17037 C
non-specific 212678 8 311 3.46E-80 cd10236 HscA_like_NBD cl17037 -
non-specific 212679 9 251 4.95E-75 cd10237 HSPA13-like_NBD cl17037 C
non-specific 212680 8 251 3.07E-62 cd10238 HSPA14-like_NBD cl17037 C
non-specific 212689 9 251 3.88E-53 cd11739 HSPH1_NBD cl17037 C
non-specific 212687 9 250 1.36E-50 cd11737 HSPA4_NBD cl17037 C
non-specific 212674 7 251 2.18E-50 cd10232 ScSsz1p_like_NBD cl17037 C
non-specific 212672 9 251 3.03E-50 cd10230 HYOU1-like_NBD cl17037 C
non-specific 212682 9 251 9.53E-47 cd11732 HSP105-110_like_NBD cl17037 C
non-specific 212688 9 242 5.47E-46 cd11738 HSPA4L_NBD cl17037 C
non-specific 212673 9 249 2.51E-19 cd10231 YegD_like cl17037 C
non-specific 212671 9 235 4.29E-12 cd10229 HSPA12_like_NBD cl17037 C
non-specific 212657 93 228 3.34E-08 cd00012 NBD_sugar-kinase_HSP70_actin cl17037 -
non-specific 212668 9 252 4.46E-05 cd10225 MreB_like cl17037 C
multi-dom 240227 4 242 1.04E-166 PTZ00009 PTZ00009 - C
multi-dom 215656 8 251 7.75E-149 pfam00012 HSP70 - C
multi-dom 234715 1 250 1.01E-120 PRK00290 dnaK - C
multi-dom 233830 8 251 3.78E-105 TIGR02350 prok_dnaK - C
multi-dom 223520 7 254 1.45E-95 COG0443 DnaK - C
multi-dom 240403 1 251 3.08E-92 PTZ00400 PTZ00400 - C
multi-dom 184038 6 250 3.37E-91 PRK13410 PRK13410 - C
multi-dom 184039 6 251 3.07E-88 PRK13411 PRK13411 - C
multi-dom 140213 2 255 3.56E-85 PTZ00186 PTZ00186 - C
multi-dom 214360 6 251 5.27E-85 CHL00094 dnaK - C
multi-dom 215618 9 251 3.58E-79 PLN03184 PLN03184 - C
multi-dom 235360 8 311 2.53E-76 PRK05183 hscA - C
multi-dom 233673 8 249 1.17E-73 TIGR01991 HscA - C
multi-dom 240227 243 429 1.61E-68 PTZ00009 PTZ00009 - N
multi-dom 215656 243 408 4.85E-47 pfam00012 HSP70 - N
multi-dom 234955 8 252 1.40E-45 PRK01433 hscA - C
multi-dom 234715 243 419 2.63E-44 PRK00290 dnaK - N
multi-dom 233830 243 408 9.17E-38 TIGR02350 prok_dnaK - N
multi-dom 223520 243 408 8.14E-34 COG0443 DnaK - N
multi-dom 184039 243 426 1.25E-30 PRK13411 PRK13411 - N
multi-dom 240403 242 413 1.94E-30 PTZ00400 PTZ00400 - N
multi-dom 184038 243 324 5.53E-29 PRK13410 PRK13410 - NC
multi-dom 215618 223 419 2.36E-27 PLN03184 PLN03184 - N
multi-dom 214360 243 409 3.51E-26 CHL00094 dnaK - N
multi-dom 140213 243 324 9.66E-22 PTZ00186 PTZ00186 - N
multi-dom 233673 243 418 1.03E-17 TIGR01991 HscA - N
multi-dom 235360 247 324 2.96E-14 PRK05183 hscA - N
multi-dom 234955 247 315 1.71E-10 PRK01433 hscA - N
multi-dom 213718 106 233 3.69E-08 TIGR02529 EutJ - C
multi-dom 227157 126 233 5.28E-08 COG4820 EutJ - NC
multi-dom 237904 106 233 1.76E-07 PRK15080 PRK15080 - NC
multi-dom 236954 120 215 1.77E-05 PRK11678 PRK11678 - NC
multi-dom 237563 146 239 6.04E-05 PRK13928 PRK13928 - NC
multi-dom 129982 146 239 8.43E-05 TIGR00904 mreB - NC
multi-dom 115385 132 230 0.000121352 pfam06723 MreB_Mbl - NC
multi-dom 237564 158 215 0.000833558 PRK13930 PRK13930 - NC
multi-dom 184403 9 240 0.00226324 PRK13929 PRK13929 - C
multi-dom 224003 146 215 0.00278128 COG1077 MreB - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic nucleotide binding site D12,L13,G14,T15,Y17,C19,E178,D204,L205,G206,G207 12 11 212675
 
DNA sequence
Upstream 1000 bp region from PH01000639G0270 gene.
CACAGCCTCATTTCGACCGGGCCCAAATGGCCCAAAAATCGCGCGGCCTTAAAGGCTGGCGCTGTGGGCGGGCGGAGAAAGTGAGCGGGGGCGGCGGCGCTTCACGCAGAGGAAGAGAAGGAGGCGAGTGGCCAGCGGCGGCGCTTCCGCGGCGATGGCGGCTGGCGGCGCGGGGAGCTTGAGGTAAGTCCCTTACCTCTAGGGTTTTGCGGGCTGGGGTTTCTTTGGGGGGGGNNNNNNNNNNCGGCGGCATGGGCGATGGAAGCGTCGAGTGGGGGCGAGCTGGCGGGTGACGGCATCGGCAATGGCGGCGGTGACGCACGGGCGTGACGGGGTGGCGAAGGGTGAAGGCGTTGGGGAGAAGACGCCTTCGGGGAATGCAAAGCGGGTTTTGGGATTTTTTATGAATTTTGCTGAATTTGGATTTTGAAAATAAAATTTAAATCAAACTCAAATTGATTTTGAAAATTTGAATTTTGCAAATGTTTCAAGTACGAATAATTTGTACTTTGATTATTGTGCACATTTATGTTTTACATGGAACAATATTTTTGCAATTTCGTACACTTATTTTGAAAATTCTAGGCCTGCCACTGTTTGGAGGTTATGTCAAAAAACCAAAAGAAAACTAGGCTTCTTCATTGGGGTGATGGATCTATCGCGCGGTTAGACCGGGATGAAGAGCTTTTGGCGACGGCGATGGGAACCTAACCATTGTAGTCGTGACTGTTTCTGATTGGACTAGGAGGCAAAATTGAAGTTTAATTTTTCCAGAGGAACATTCTCGGAAACCCACCCCCGCTCCCCACCGCCATTCGTCCGGATAAACCACCCCACCCCTCCCGTCCTAAGTCGGTAAGTCCTAACCCTCCCAACCCCTCGCCCGAACATTCTCGAAACCCCCCTCCCCACTCCCTCCCCTCCCGCCCAAACCCTCCCAATCCCCTCGCCCGAACATTCTCGAACCCCCCCTCCCCTCCCCTCCCCAACCCTGTTCGCCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGAAGGGAGAGGGCCCGGCGATCGGGATCGACCTCGGCACGACCTACTCGTGCGTGGGCGTGTGGCAGCACGACCGCGTGGAGATCATCGCCAACGACCAGGGGAACAGGACCACGCCGTCGTATGTCGCGTTCACCGACACCGAGCGGCTCATCGGCGACGCCGCCAAGAACCAGGTCGACATGAACCCCACCAACACCGTCTTCGATGCTAAGAGGTTGATTGGTAGGCGGTTCTCTGATCCGTCCTTGCAGAGTGACATGAAGCTGTGGCCGTTCAAGGTCATTCCTGGCCCAGGCGACAAGCCGATGATTGTCGTCCAGTACAAGGGCGAGGAGAAGCAGTTTGCCGCCGAGGAGATCTCCTCCATGGTGCTCACCAAGATGAAGGAGACCGCCGAAGCCTACCTCGGCTGCAAGATCAAGAACGCTGTTGTGACAGTGCCGGCCTACTTCAACGACTCGCTGCGGCAGGCCACCAAGGATGCCGGTGTCATTGCCGGCCTCAATGTGATGCGTATCATCAACGAGCCCACCGCTGCTGCCATTGCCTATGGTCTCGACAAGAAGGCCAGCAGCTCCGGCAAGAAGAACGTGCTCATCTTTGACCTTGGCGGCGGCACATTTGATGTGTCGCTGCTCACCATTGAGAAGGGTATCTTCGAGGTGAAGGCCACCGCCGGTGACACCCACCTTGGTGGTGAGGACTTCGACAACCGCATGGACAACAACCTGCTCGGCAAGTTCGAGCTGTCCGGCATCCCTCCTGCTCCCCGCGGTGTGCCCCAGATCAAAGTCTGCTTCCACATCGACGCCAATGGCATTCTCAACGTCTCTGCTGAGGACAAGACCACAGAGCAGAAGAACAAGATCACGATCACGAACGACAAGGGCGGACTGAGCAAGGAGGAGATCAAGAAGATGGTGCAGGAAGCCGAGAAGTACAAGGCGGAAGACGAGGAGCTCAGGAAGAAGGTGGATGCCAAGAACGCGCTCGCCAAGAACGCGCTCGTGAACTACGCCTACAACATGAAGATCACCATCAAGGACGAGAAGATCGCCTCCAAGCTCTCGGCCGACTACAAGAAGAAGATCGAGGACGCCACCGACGGTGCCATCAGCTGGCTCGACAGCAACCAGCTCGCGGAGGCGGACGAGTTCGAGGACAAGATGAAGGAGCTGGAGAGCATCTGCAACCCCATCATTGCGAAGATGTACCAGGGCATTGGTGCGGACATGGGTGGCGCCAGCAGCGTGAGTCCCAAGATTATGGTGCAGGGGGCCAAGGAGGAGCTCAAGGAGGAGCTGCAGCACTCTTTGCTCCCGAAGAGCAAGTTCAAGCTCCACCAGGAGCCTCCCGCCTCCACCAAGCTGGTATGCCACATCTGCTACGGGAAGGTGCTCGGGTCCTACTACCACTGCGCCAAGACCGACCTGTACCTCCACCCGTGCTGCGCGAAACTGCCGCTGTCCGTCAGCCATGGGAAGCGCATCTTCGAGCTCCGCACGGAGGTGAAGCACCGGTGCCGCAGGTGCTGGGCATTGGACTGGTACTACCACCCTTGGTTCTACCGCTCCACATGCGAGACCAACAAGGTGTACCTGCACGTCAAGTGCATGAAGGAGGAGATGGCTGGCCGCAGCGGCGCCGGCGGCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000639G0270 gene.
ATAAAAACAGGGATTTAGCTAAGAGTTCCTGAAAGGGGATATAGTTGCTCTTTATTGTAATAAACCGACGATTGCAAAGATGCCTTAGGGAAGGTGACGAACTAGTCTTAATTACACTGAGTGTGTTGTTTGCTATGCTACTGATTCAATTAGCCTGTTGATCTCCAAAATTTGCTTGTCTTGGCTTTTCGTCATTCACTTTTAAATAACTGGTGAAGATGTGGTAGTTACTCTTAGAAGTAGGGGTGAAAACGGATCAGATAGTTTTTGACCAATCCGAACGAAAACGGACTCGGATTGTCTCGGATCGGATTTTCCTCGGATAATTTTCGGATCGGAAACAGATTCGGATTTTTTTCTCTAAAACGGAAACAAATAAGGTAGGCATGATATCCGGCGGAAACGAATACGGATTATCCGGATAAACGTAATCCGGATATCCGGAGTTTGAAAACAGCCACTGCCAGCCTGGCTCACTTAGAGAGTCAATTGACTTAGGGACTTAGAGGGCTCCTTCATTCAGTTCTTCCACACACCTCACTCCACACTCCACAGTGGCACAGTCGCCACGCCGCCGGCTCTCCTGCGCCTTGACGCCGCCCTCGCCTCGCCGCCGGCGGCCACCTCGCCCGCGGCCCACCTCCGCCGGCCATCTCCCTCGGCTCCCTCCTTCCTCAGCAAAGTCGCGCTCCTCCCTGGCTCCCTCCTCCCCCAGCACGTTCCTTCCCGCCGGCCTCCTCCCCAGCACCCCTCCTCCCAGATCTCCCTCGGCTCCCTCCTTCCCCGGCAAGGTCGCGCTCCTCCCCGGCTCCCTCCTCCCCCGGCGCGCTTCTCCCCGTCGGTGACCCCAGCACCCCTCCTCCTCCCAGATCTCCCCCGGCTCCCTCCTCCCCCGGCAAGGTCGCGCTCCTCCCCGCCGGCCTCCTCCCCAGCACCCCTCCTCCTCCTAGATCTCCCCTGGCTCCCTCCTCCCTCGGCAAGGTGCGGCCCCTCGCGGCGCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000639 Download
Protein sequence
Protein sequence
MAKGEGPAIGIDLGTTYSCVGVWQHDRVEIIANDQGNRTTPSYVAFTDTERLIGDAAKNQVDMNPTNTVFDAKRLIGRRFSDPSLQSDMKLWPFKVIPGPGDKPMIVVQYKGEEKQFAAEEISSMVLTKMKETAEAYLGCKIKNAVVTVPAYFNDSLRQATKDAGVIAGLNVMRIINEPTAAAIAYGLDKKASSSGKKNVLIFDLGGGTFDVSLLTIEKGIFEVKATAGDTHLGGEDFDNRMDNNLLGKFELSGIPPAPRGVPQIKVCFHIDANGILNVSAEDKTTEQKNKITITNDKGGLSKEEIKKMVQEAEKYKAEDEELRKKVDAKNALAKNALVNYAYNMKITIKDEKIASKLSADYKKKIEDATDGAISWLDSNQLAEADEFEDKMKELESICNPIIAKMYQGIGADMGGASSVSPKIMVQGAKEELKEELQHSLLPKSKFKLHQEPPASTKLVCHICYGKVLGSYYHCAKTDLYLHPCCAKLPLSVSHGKRIFELRTEVKHRCRRCWALDWYYHPWFYRSTCETNKVYLHVKCMKEEMAGRSGAGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above