gene PH01000600G0380
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000600:298087 - 300264(- stand)   Name
Alternate name Locus tag PH01000600G0380
Length of gene 2178  bp Length of CDS 1386  bp
Product information
Feature type
CDS
Product name
WD-40 repeat family protein
Alternate name
Molecular weight
(predicted)
48810.9964200001  kDa
Isoeletric point
(predicted)
9.2958869934082
Length
461  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP03478070 PH01000600:299342 A A_G
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_236292 3
Please click OG5_236292 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G18950.1
Transducin/WD40 repeat-like superfamily protein
Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing
1E-116
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os12g40260.1 WD-40 repeat family protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
  3. Repeat
1 50 100 150 200 250 300 350 400 461
Detailed signature matches
    1. SSF50978 (WD40 repe...)
    2. PS50294 (WD_REPEATS...)
    1. PS50082 (WD_REPEATS_2)
    2. SM00320 (WD40)
    3. PF00400 (WD40)
    1. PR00320 (GPROTEINBRPT)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22844 (F-BOX AN...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 238121 91 421 1.22E-27 cd00200 WD40 cl02567 -
superfamily 243092 91 421 1.22E-27 cl02567 WD40 superfamily - -
non-specific 238121 194 424 3.97E-18 cd00200 WD40 cl02567 C
non-specific 238121 125 422 2.20E-17 cd00200 WD40 cl02567 -
non-specific 201208 235 269 0.00220375 pfam00400 WD40 cl02567 -
non-specific 197651 233 269 0.00520555 smart00320 WD40 cl02567 -
non-specific 197651 376 420 0.00633993 smart00320 WD40 cl02567 -
non-specific 201208 201 229 0.00938239 pfam00400 WD40 cl02567 N
non-specific 201208 375 420 0.00995891 pfam00400 WD40 cl02567 -
multi-dom 225201 101 423 3.81E-13 COG2319 COG2319 - C
multi-dom 225201 101 423 4.30E-10 COG2319 COG2319 - -
multi-dom 225201 90 272 4.36E-09 COG2319 COG2319 - N
multi-dom 225201 203 424 9.78E-05 COG2319 COG2319 - C
multi-dom 225201 91 236 0.00055765 COG2319 COG2319 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic structural tetrad H93,T106,S110,W116,D118,G130,T145,D149,W155,R156,R200,H201,Y218,D223,W229,R230,H243,F258,D263,W269,R270,V282,M283,V308,D312,W318,Q319,G338,H339,V354,D359,W365,R366,G381,H382,S410,D414,W420,R421 40 39 238121
 
DNA sequence
Upstream 1000 bp region from PH01000600G0380 gene.
CAAATTAATCAAAGACCAGAAATGCTCCTTTTTCTCTCCCAAAGAAAAGAAAGACCAGAAGATCACCAGAAATGTTTCTTTTCCTCTCAGAGGAAAGAAAGGCGATCAAATTAAGTTCGTTCTGTGCTTGACCAAATGTGAATTTGCCAGAAGTGGAAAGAGGCCTCGCATCTCTTCGACACCACGTGTTTAAATTTCGCAAGATTAAATTAGGCGGAGTTCGAGAAATTGAAGGAGGGTGTGAATTCAAACTGGGCTTTTTCCGGTTTATGTTTGACTCGATCGATCGGGATCTCGCTGGTAAGAGGGCAATTAATGAGCCAAAACGATCTCCTGCATACATGCCGTGCCGTGGTCAAACACAACTTGGGGATTTGAATTCAATTCTCTCTAGACCGCCTCATTTTCTCAACGAGTTCGTACTAGCAGTGCACGCCAGGTGCAACAAGCGACAACATACGACTTTTCCCCCCGATTTTCTCAAGAAATGGCGACAAAATATCTATATATATTTTTATGTGATTATTTATGAATGCAAAATGTGTAGGTGTAGTACGTAAAATGTATTTATGAAAGCAAAGCGAAGCCATCTCCCTGTAAAATTCAGCACTGCAGATTTAATCAGGAGAAACTAGTATATGTCTAAAAAACAGCATTTGAGCGATTTCTGAAACGAAAACACTGTGGTGAATATAAATATCGGGGGATAATGTTCCTCCATTTGAATGAGGTGGTTGATCGCTCGATCATTTTTATCCATTTTTTACTTCTTGATTCGGCATGTGTACCCGTTCCTGCACCTCCTTTGTGGCGAAAAAGCACGCGCATCCGTCCGGTTGTTTGTTTCATGAAGCAATTGTGTTTAATGCCATTATTGTTTTTGGTGTTTCAAAGTGGCTTGAACTTTGAGTACGAAGCGTCGTTTAAACTCTTAATTATAGTAGTTGGCTGCAGTTCGTGCTCATGATTGACAAACCTAGCTGCTTTTATATATATGCAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGGAATCACAAGAAGCTGCTGCAGTTTCTGCGGCCGGACCCTGCGGTGGCCGCGGCCAAGTCGTCGGACGACGATGAAGAGGGCGGGTCTTCGCTGCCGTCGCCAACTACAAGCGCGAGCGCGCGCTCATCGCCTGCGGCGTCGCCGTCGCCGTCGCCGTGCATCATGTCGCCTTGGATAAACCTCCCGGGGTTCGGCGCCGAGGGGGTTGGGAAGGACGGCGCGGCGGCGGCGTCGACGGGGCTCCTGGGGTCGCTCGTGAAGGAGGATGGGCACGTGTACTCGCTCGCTGCGGCGGGGGACCTGCTGTACACCGGAACGGACTCCAAGAACGTGAGGGTGTGGAGGGACCGCCGTGAGTTCGCCGGGTTCCGGTCCGGGAGCGGGCTCGTCAAGTCCATAGTCATCGCCGGCGACGGGAAGATTTACACGGGCCACCAGGACGGCAAGGTGCGCGTGTGGCGCGCGTCGGCGGACGATCCTGCCTTGCACAAGAGGGTCGGGTCGCTCCCGAGGTTCACGGACGTTTTGAGGAGCTCAGTCATGCCGTCGCACTACGTCGAGACGCGGCGCCGGCACAGCGCCGTGTGGCTTCGGCACTTCGACGCCGTGTCGTGCCTCAGCCTGGACGCCGGCGCGGGCTTGCTCTACTCGGGCTCGTGGGACAAGACGTTCAAGGTCTGGCGCGTGTCGGACTCGCGGTGCCTGGAGTCGGTGCGCGCCCACGACGACGCCGTGAACACGGTGGCGGGGTTCGACGCGATGGTGTTCACCGGCTCGGCGGACGGGACGGTCAAGGTGTGGCGGCGGGATGCCGGGAAGGGCGGAGCCACGAGGCACGTCATGGAGCGCGTGCTACGCAAGGGCGAGAGCGCGGTGACCGCGATCGCCGTGGCCGCGGAGGCGCGCGTGGTGTACGTCGGCTCGTCGGACGGGGCCGTGACCCACTGGCAGTTTCGCCGTGGCGCCGGCTCCTCAAGCGCGCCGAGGAACGGCGGATCGCTGCGGGGGCACAAGATGGCCGTGCTCTGCGTCGCCGTGGCCGGGCGCGTCGTCGTGAGCGGCTCCGCCGACCGGACGATCTCTGTGTGGCGCCGCGAGGAGGGCGCGGAGCACGCCCACCTCGCCTTGCTAACCGGCCACACCGGGCCGGTCAAGTGCGTGGCCATGGACGAGGAGGATGACGCCCCCGGCGCCGACGGCCACCACCGGTGGGTCGTGTACAGCGGCAGCCTCGACGGGTCCGTCAAGGTTTGGCGCGTCTCCGACGCGCCCGACGCGATGGCGCGGACGCCGGCGCACGTGTGGAAGGGCACGCCGTCGCCGCTGGGGGCGTGGACGCCGTACGCCGCGTCGGAGCTGAAGCGGATGGCCCCGGCGTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000600G0380 gene.
GAGAGGGAGTTGGGGTGGGGGCGAGGGGTATATATAGAGGCGGGCAGGGTGTACGGTTGGGGGAAGGGCGGTTGTGACAGGTGGACGGCTGCGGTTCGATTTGACGAGGCCTCTCTCTCTCTGCCTTTGCGGGGAAAGAGGAGTGGCCTGATGGGTGGGACGGGACACGTGGCGGGGTTTGGAGAGAGCGCGGTACCATGATTGAATTTGAGTGGGGTGGTGATGGTGCCCTGCCCCGCGCACTGAGCCGGTGGTGTACCACGCGATCGTACACTACTGCAAAATGGCATTAGAAATGCATGCACTCCATATGCATGCTAATTTGAAATTCAGAGATTGTGCAACGATCTAGGTCCTTTATTTACCGTTTGATTTCCATACTTTGTGCTCTGTGATAAAGTGTATACGCAATGTTCAGAATGAACGATTAGGTTTATCATTTCGTGGTTCAGCCCTATCAAGTCGGATTATATACCACTCAACCGAAGTGAAGAATACAGTTTTGATAACTTCCTTTTCCAAAAACAAGCTTTGGTAATCAAAATGCGCATTTTGCTTGTGCTGGCAATACAAATTTATCACGACCAAAATTACACCAAGCAACACGTACACCGACCAAAAGGGAGCTAGCACCGTTGTTTCGACGAGACGAAGCTAGCATCGAAGCGTGCGTAAGTGCGTCACCGGAAGGAAGAAAACCACAAGCCAAGAAAATGAAACGGAAATTAACCGCGATCGCTCGCCGGCCGGGACGAAGAAAACAGTAGCCTCCAGCCAGTGACGTAGCTGATTTCGAACTCAAATCGTTTTTTAGTGATTTTTCAAAAAAATTAACATGACTTTTTGATTTTAGATCTCAAACCATTGCTCCGGCGATCCGAGTCCCAGCTTCGCCTCAAACGGAGCTCAAGTGCAACGTATGCACCTGGCTGGTTTGACCTGCACTCACAAGGCAAAGCCGGCCGGGGCCGGGTCTAACACTTGCTGTCATTTAAGCACGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000600 Download
Protein sequence
Protein sequence
MGNHKKLLQFLRPDPAVAAAKSSDDDEEGGSSLPSPTTSASARSSPAASPSPSPCIMSPWINLPGFGAEGVGKDGAAAASTGLLGSLVKEDGHVYSLAAAGDLLYTGTDSKNVRVWRDRREFAGFRSGSGLVKSIVIAGDGKIYTGHQDGKVRVWRASADDPALHKRVGSLPRFTDVLRSSVMPSHYVETRRRHSAVWLRHFDAVSCLSLDAGAGLLYSGSWDKTFKVWRVSDSRCLESVRAHDDAVNTVAGFDAMVFTGSADGTVKVWRRDAGKGGATRHVMERVLRKGESAVTAIAVAAEARVVYVGSSDGAVTHWQFRRGAGSSSAPRNGGSLRGHKMAVLCVAVAGRVVVSGSADRTISVWRREEGAEHAHLALLTGHTGPVKCVAMDEEDDAPGADGHHRWVVYSGSLDGSVKVWRVSDAPDAMARTPAHVWKGTPSPLGAWTPYAASELKRMAPA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above