gene PH01000573G0640
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000573:441667 - 442703(+ stand)   Name
Alternate name Locus tag PH01000573G0640
Length of gene 1037  bp Length of CDS 660  bp
Product information
Feature type
CDS
Product name
AP2 domain containing protein
Alternate name
Molecular weight
(predicted)
22852.8252199999  kDa
Isoeletric point
(predicted)
9.19943618774414
Length
220  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
(0 result)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G53170.1
ethylene response factor 8
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
ethylene response factor 8 (ERF8); CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: ethylene respon
1E-21
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os04g52090.1 AP2 domain containing protein, expressed 1E-40
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 220
Detailed signature matches
    1. SSF54171 (DNA-bindi...)
    1. PR00367 (ETHRSPELEMNT)
    2. PF00847 (AP2)
    3. SM00380 (AP2)
    4. PS51032 (AP2_ERF)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31677 (FAMILY N...)
  2. PTHR31677:SF0 (SUBF...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 237985 26 83 2.94E-16 cd00018 AP2 cl00033 -
superfamily 241562 26 83 2.94E-16 cl00033 AP2 superfamily - -
non-specific 197689 27 83 5.44E-19 smart00380 AP2 cl00033 -
non-specific 216148 26 59 2.06E-07 pfam00847 AP2 cl00033 C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific DNA binding site R29,G30,R32,R34,W36,R38,E42,R44,R51,W53,T56 11 11 237985
 
DNA sequence
Upstream 1000 bp region from PH01000573G0640 gene.
CGTCCGCTAATACTTTAATCAGCTACACGACGTTAAATAGTTAAAAATAGAGGGAGTATTATGTTGATAAATTGAGATGCCGCCGGTGGTGGTTCGAAAAACAATGTTACGATACAAGAAAGTTGGAATAAAAAAATCAATCAAACAGCAGCATCGCATACGAAGTCACGAGTGGACACAACATGCACCCCACCCTAGGGGCGTGCAGGACGCATACCATAAGCACTCGCTCCAAAGAGAAGGTCATCATAAGAAACCGCGCATGGTGTGCAGTGAATCAATGCCACAAAGCACAGTTTGGAACGCACACGCACGGCACGGCACGGTGCGTCGAAGCCCACACGAGGCAACTGCAGCAGCAACACGCTTCAGCCGAAGTACGCCGAAGTTTCGTATAGGTGTACTACCTGTGCCGACAATAAACGAAAATGGAGGCGGAAATCGCTATGTACTTCTTGCCGAATGGACAGTAGAAAGTGACGCCTGCGCCCCTAGCCCCCTACTAATCCTACGCAGTGTCGGTGCTCCGGTAATATTAAAATGAGCTGCCAATCCGACGGCGGCCGCAACCCACCGACGATGACACGCCCGCACGCTTGCCTTCTCATAAACAAAACGAAAAGAAAAGGCACGGACCGCGCGACGCGGTGTGCGACGCGCCGACAGCAACCACCACCACGCGGCCAGCTGCGGCCACCCGCACCGCACTGTGTGCAGTACTGCACATCGGTCGGCGCAGGCCACGCCGGTCTTGGTAGATCTGATATGTCATCCCCCGATCCGACGGTCACACGTGAGCCACGCCACGAGACACGAGTCACCCGGGAACCTAGGCCAGCACACCGCCGCACCCGCGCGCCGCCTACCGAAGAAACCGACGCGAAGAGACGGCCAGACGCGGGGGCGGCGCCTAGGCCCCACCTCACCCCCTCCCCGGTCAACGTCAGATCGCCCCACCCGCCTCCTCTATATATCGGCGCGCCTCGCCTCCTCCATTCCTC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCCAAAGAGCTCGTCGCGAGCCGAGCACGAGGCTGGCAAGGGAGGCGGCGGTGGCTGCTGGGGGGCGGAGCCGAGGCTCCGCGGCGTGCGGAAGCGGCCGTGGGGCCGGTACGCGGCGGAGATCCGCGACCCGGCCAGGAAGACGCGCGTCTGGCTGGGGACCTTCGACACGGCCGAACAGGCCGCGCGGGCCTACGACGCCGCCGCGCGCCGGCTCCGCGGGCCTTCCGCCAGGACCAATTTCCCCGCTGCCGCCGTGCAGGCGGTGGCGCAGCCCGAGACGGCTACGGCGGTGAGCCTGAGTGGCAGCACCGTGGACGAGTCGTCGTTGTCGTTCCGGGACTCGCCGGTGGGGACGGCTGCGGCGGAATTCATGGCGCCTGTGTCGTTGGACCTGAGGCTGGGGAAGCCGACGGTGGTGGCCGCGCAGCCGTACCTGTTCCTGGACCCGAGGCTGGCGGTCACGATGGCTGTGACGGCACCAGCACCGTTCGCGCCGCCGAGCAGCCGGCATGCGGCGGCCGTGACGGGCAAGAAGGCGTGGGATGACGTGCAGAGTGACACGGGTTCGTCAGAGTCGTCAGTGGTGGACGCGGCGCCGGCGGTGGGCGTGGGGATCGACCTCAACCTGCCGCCGCCGGCCGAGATGGTGATG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000573G0640 gene.
ACGAAAATCTCCTAAGGCCCCTTCTCGTGTAAGATCCGTTTCATAGAATTTGCTTCCTAATTCAACCAGCTCTTGTTGGCTAACTTAATTTGCACCAAGCATGACCACCCACTTGCCCCACTTGCCTAGTCGCTTCCATGATTTTTCTAGTTTAATACTAGTAGTACTACATCCTATGTAGGCAACGTGTCCGTCAGGTCGCGTTCGAGATGGGAGGCTGCCTCGCCTACGCCAGACGGCAGCTGCAGGCTTGCAGCACTGGGTGCCGACGCGCGCGGCGACAAGTTTGCAACGGCACGGCACGACCAAGCGGTGCGTCAAATTACGGTGTGTTCGGTTGGATGATTAGTATCGGATGGTTTCAAATATACTACGGTTCATACGTTTGGTTAGGGAAATGAAATGAAGTCGTCCGGAACGAGATGATTCAAATCAAGAAAATATACCTTAAATATGCTAAACCAACTTGTTCCACGAAATCGGTGGAACCACGTGATTCAAAACGCGCTGCGCCCGTTGCCCCTCTCCAGTCCCACATAACGCAATCGTCGCCGCGTCTCCTATTGACCCACAACGTACCGCCCTCTCTCCAGTCCCACCCAATGTGCCGCCCTTTCTCCTGTCGACTCCATCTTCCTCCCCTCCGGCAACACCCGGGCCAGCCACCGCCGCCACCTATCCTGTCGCCCCCAACCCAGTGAGCTTCATCCACTGCCACCTGTGTCACCTCATGTTCCCCGGGCACGCCCCCCAATGTCGGTTATCGTCCATGGGAGCTCATGCCATGGTCTTCTTTCCCACGTCCAACCAAAACCATTGCCTCCATCGTCGTTCGTCACCCAGTGAATCCCTTCTCGATTCTCCTTTACTCGAGCATCCCCAGGCCACCCCCTTATTTTCCCTACCACCCACTTCGGCTCCCCCTCCACGACGCGCCGCCGCCACGACGGACCCGCCGCGACGCCACGAGCTCCTGTCGTCGGCCCAACTCGGTCCACCCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000573 Download
Protein sequence
Protein sequence
MAPKSSSRAEHEAGKGGGGGCWGAEPRLRGVRKRPWGRYAAEIRDPARKTRVWLGTFDTAEQAARAYDAAARRLRGPSARTNFPAAAVQAVAQPETATAVSLSGSTVDESSLSFRDSPVGTAAAEFMAPVSLDLRLGKPTVVAAQPYLFLDPRLAVTMAVTAPAPFAPPSSRHAAAVTGKKAWDDVQSDTGSSESSVVDAAPAVGVGIDLNLPPPAEMVM
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above